Personalized in-vitro total digestion glycolysis simulation system

Abstract

The invention discloses a personalized in-vitro total digestion glycolysis simulation system, and belongs to the technical field of in-vitro digestion simulation. According to the invention, by dynamically regulating and controlling the emptying amount and the flow velocity of digestive juice, the process of'digesting and absorbing at the same time 'in the small intestine is simulated, and the interaction of colon flora and colon organs is enhanced in combination with a micro-fluidic chip technology, so that the accurate detection of the digestion process and digestion products is realized. The digestion product simulated by the method disclosed by the invention and the flora structure are very close to the real in-vivo structure, so that the method has relatively high authenticity and credibility.

Description

Technical Field

[0001] The invention relates to a personalized in vitro complete digestion and glycolysis simulation system, belonging to the technical field of in vitro digestion simulation. Background Art

[0002] In vitro digestion simulation is a method that simulates the human or animal digestive tract and its digestive environment under in vitro conditions. It can simulate the dynamic behavior of fluid in the digestive tract and is widely used in scientific research such as functional food efficacy evaluation, drug sustained release, infant formula optimization, and intestinal probiotic survival rate.

[0003] Although existing in vitro digestion models can simulate the decomposition and absorption process of food in the gastrointestinal tract to a certain extent, they are significantly insufficient in terms of digestion and absorption in the small intestine. Many static models only focus on enzymatic reactions in the digestive process, which leads to the accumulation of digestion products (mainly glucose) in the system and fails to truly reflect the physiological processes of the human small intestine. In static models, the digestion and absorption conditions of food in vitro are too simple, and there is a lack of dynamic flow and emptying of digestive fluid in the small intestine, resulting in a high measured GI value, which makes it difficult to truly reflect the efficiency and effect of actual digestion and absorption in the human body.

[0004] In recent years, some studies have proposed dynamic simulation systems. However, these systems generally lack the simulation of the synchronous process of "digestion-absorption" in the small intestine, especially the lack of a dynamic regulation mechanism for the emptying volume. After the food is digested and converted into glucose, it still remains in the digestive fluid, rather than being absorbed and transferred in real time, resulting in a high measured GI value, which is difficult to truly reflect the actual digestion and absorption process in the human body. At the same time, the emptying volume and flow rate of the small intestinal digestive fluid are set in a single way, and are not dynamically regulated according to the actual small intestinal environment, making it difficult to accurately simulate the emptying and absorption process of food in the small intestine.

[0005] In the in vitro simulation of colon organoids, the existing models also have limitations in reproducing the colon microecological environment. The dynamic interaction between the colonic flora and the colonic environment is crucial to the colonic fermentation and digestion process, but in the existing organoid and flora co-culture technology, the flora is often cultured separately, and it is difficult to meet the different needs of the flora and organoids at the same time, ignoring the dynamic interaction between the intestinal flora and the colonic environment, and it is difficult to accurately reproduce the complex colonic fermentation process. Therefore, the experimental results are quite different from the human colon environment.

[0006] Therefore, there is an urgent need to develop a dynamic co-culture system based on microfluidic technology that can establish a long-term and stable dynamic interaction relationship between colon organoids and bacterial flora, and improve the physiological authenticity and data reliability of in vitro simulations. Summary of the invention

[0007] To solve the above problems, the present invention proposes a personalized in vitro full digestion and glycolysis simulation system, which simulates the "digestion and absorption" process in the small intestine by dynamically regulating the amount and flow rate of digestive fluid discharge, and combines microfluidic chip technology to enhance the interaction between colon flora and colon organoids, thereby realizing accurate detection of the digestion process and digestion products.

[0008] The first object of the present invention is to provide a method for simulating the complete digestion of food in vitro, wherein the food to be tested is added to an in vitro complete digestion simulation device to simulate the digestion process of the food from the mouth to the colon (i.e., complete digestion simulation);

[0009] Among them, the in vitro full digestion simulation device includes an interconnected oral simulation device, a stomach fermentation tank, a small intestine fermentation tank, a dialysis device, an ascending colon fermentation tank, a transverse colon fermentation tank, a descending colon fermentation tank, a microfluidic chip and a pump.

[0010] In one embodiment, the stomach fermentation tank, small intestine fermentation tank, dialysis device, ascending colon fermentation tank, transverse colon fermentation tank, and descending colon fermentation tank are connected to anaerobic bottles to provide an anaerobic environment; the microfluidic chip is connected to an organoid culture medium bottle, and the organoid culture medium bottle is connected to an air bottle to provide air.

[0011] In one embodiment, the small intestinal digestive fluid is taken out from the small intestinal fermentation tank according to the emptying equation, transferred to a dialysis device, and the small intestinal digestive fluid is dialyzed and transferred to the ascending colon fermentation tank;

[0012] The emptying equation is as follows:

[0013]

[0014] Wherein, t represents the digestion time (min) of the small intestinal digestion simulation system.

[0015] In one embodiment, mucosal spheres are added to the ascending colon fermentation tank, the transverse colon fermentation tank, and the descending colon fermentation tank;

[0016] The preparation method of the mucosal sphere is as follows:

[0017] Adding agar into water to dissolve it, adding mucin to obtain a mucosal gel solution; solidifying the mucosal gel solution to obtain mucosal pellets;

[0018] Optionally, the ratio of agar, mucin and water is 1-3 g: 0.3-0.6 g: 50 mL;

[0019] Optionally, the diameter of the mucosal pellet is 0.3 to 0.7 cm;

[0020] Optionally, the number of the mucosal spheres is 5 to 15.

[0021] In one embodiment, the ascending colon fermenter, the transverse colon fermenter and the descending colon fermenter contain intestinal culture medium, and the intestinal culture medium is inoculated with intestinal microbial liquid; the intestinal microbial liquid is prepared by fermentation of artificial intestinal flora;

[0022] The artificial intestinal flora consists of Prevotella copri ATCC-33547, Faecalibacterium prausnitzii ATCC-27768, Roseburia faecis Mingzhoubio-B84313, Bifidobacterium longum ATCC-15707, Ruminococcus bromii ATCC-27255, Bifidobacterium adolescentis ATCC-15707, Bacteroides uniformis ATCC-25285, Collinsella aerofaciens ATCC-25986, Ruminococcus gnavus ATCC-29149 and Akkermansia muciniphila ATCC-baa-835 is composed of 0.10-0.30:0.10-0.30:0.05-0.20:0.05-0.20:0.05-0.20:0.005-0.1:0.005-0.1:0.01-0.03:0.01-0.03:0.01-0.03;

[0023] Optionally, in the intestinal culture medium, the inoculation amount of the intestinal microbial culture liquid is 8-12% v / v;

[0024] Optionally, the number of viable bacteria in the intestinal microbial culture reaches 10 9 CFU / mL or above;

[0025] Optionally, the volume ratio of the intestinal culture medium in the ascending colon fermenter, the transverse colon fermenter and the descending colon fermenter is 4-6:6-10:6-10.

[0026] In one embodiment, colon organoids are planted in a microfluidic chip, and organoid culture medium and descending colon fermentation broth are introduced;

[0027] Alternatively, colon organoids are obtained by isolation of colon tissue or differentiation of stem cells;

[0028] Alternatively, colon organoids can be of murine or human origin;

[0029] Optionally, the number of organoids in the microfluidic chip is 20 to 50;

[0030] Optionally, the flow rate of the organoid culture medium into the microfluidic chip is 0.5 to 1 μL / min; the flow rate of the colon fermentation solution into the microfluidic chip is 0.5 to 1 μL / min;

[0031] Optionally, air is aerated into the organoid culture medium and anaerobic gas is aerated into the colonic lysate.

[0032] In one embodiment, the pH values ​​in the ascending colon fermenter, the transverse colon fermenter, and the descending colon fermenter are 5.6-6.0, 6.0-6.4, and 6.4-6.9, respectively;

[0033] Optionally, the emptying rate of the ascending colon fermenter, the transverse colon fermenter, and the descending colon fermenter is 10 to 15 mL / h.

[0034] In one embodiment, the food to be tested includes: starch, cereal food, meat products, vegetable products;

[0035] Optionally, the starch includes: common starch, resistant starch, slowly digestible starch;

[0036] Optionally, the cereal foods include: bread, steamed bread, and rice.

[0037] In one embodiment, common starch includes commercially available starches such as corn starch, tapioca starch, potato starch, and sweet potato starch; resistant starch includes indigestible starches such as acetylated starch, propionylated starch, and butyrylated starch; and slowly digestible starch is obtained by mixing one or more of the above common starch and resistant starch.

[0038] In one embodiment, in an oral simulation device, the food to be tested and the salivary electrolyte stock solution are added with α-amylase, CaCl2 solution and water, and homogenized to obtain an oral simulation chewable material;

[0039] In the gastric fermentation tank, the oral simulated chewing material and the gastric fluid electrolyte stock solution are mixed, and CaCl2 solution, hydrochloric acid solution and water are added to react to obtain gastric digestive fluid;

[0040] In the small intestinal fermentation tank, the gastric digestive juice and the intestinal electrolyte stock solution are mixed, and pancreatic enzyme, saccharifying enzyme, CaCl2 solution, sodium hydroxide solution and water are added to react to obtain the small intestinal digestive juice;

[0041] The dialysis device contains dialysis fluid and a dialysis bag, and the digestive fluid from the small intestine is pumped into the dialysis bag;

[0042] Optionally, the small intestinal digestive fluid pumping rate in the dialysis device is 80 to 120 mL / h;

[0043] Optionally, the dialysate is an intestinal electrolyte stock solution.

[0044] In one embodiment, the oral simulation device can be realized using a conventional homogenizing device (190-220N, processing for 10s).

[0045] In one embodiment, salivary electrolyte stock solution (SSF) is composed of 14-16 g / L KCl, 3-4 g / L KH2PO4, 6-7 g / L NaHCO3, 0.3-0.7 g / L MgCl2(H2O)6, 0.04-0.08 g / L (NH4 )2 CO3, pH adjusted to 7.0;

[0046] Gastric electrolyte stock solution (SGF) is composed of 6-8g / L KCl, 0.5-1.0g / L KH2PO4, 10-15g / L NaHCO3, 10-12g / L NaCl, 0.2-0.6g / L MgCl2(H2O)6, 0.3-0.7g / L(NH4 )2 CO3, pH adjusted to 3.0;

[0047] The intestinal electrolyte stock solution (SIF) was prepared by 6-8 g / L KCl, 0.5-1.0 g / L KH2PO4, 40-45 g / L NaHCO3, 8-10 g / L NaCl, 0.8-1.5 g / L MgCl2(H2O)6, and the pH was adjusted to 7.0.

[0048] The second object of the present invention is to provide the use of any of the above methods in simulating food digestion in vitro, screening drugs or constructing disease models.

[0049] The third object of the present invention is to provide a method for improving the accuracy and authenticity of in vitro complete digestion simulation of food, wherein the food to be tested is added to an in vitro complete digestion simulation device to simulate the digestion process of the food from the mouth to the colon;

[0050] The in vitro complete digestion simulation device includes an oral simulation device, a stomach fermentation tank, a small intestine fermentation tank, a dialysis device, an ascending colon fermentation tank, a transverse colon fermentation tank, a descending colon fermentation tank, a microfluidic chip and a pump that are interconnected;

[0051] Optionally, the small intestinal digestive fluid is taken out from the small intestinal fermentation tank according to the emptying equation, transferred to a dialysis device, and the small intestinal digestive fluid is dialyzed and transferred to the ascending colon fermentation tank;

[0052] The emptying equation is as follows:

[0053]

[0054] Wherein, t represents the digestion time of the small intestinal digestion simulation system (min);

[0055] Optionally, mucosal spheres are added to the ascending colon fermentation tank, the transverse colon fermentation tank, and the descending colon fermentation tank;

[0056] The preparation method of the mucosal sphere is as follows:

[0057] Adding agar into water to dissolve it, adding mucin to obtain a mucosal gel solution; solidifying the mucosal gel solution to obtain mucosal pellets;

[0058] Optionally, the ratio of agar, mucin and water is 1-3 g: 0.3-0.6 g: 50 mL;

[0059] Optionally, the diameter of the mucosal pellet is 0.3 to 0.7 cm;

[0060] Optionally, the number of mucosal globules is 5 to 15;

[0061] Optionally, the ascending colon fermenter, the transverse colon fermenter and the descending colon fermenter contain intestinal culture medium, and the intestinal culture medium is inoculated with intestinal microbial liquid; the intestinal microbial liquid is prepared by fermentation of artificial intestinal flora;

[0062] The artificial intestinal flora consists of Prevotella copri ATCC-33547, Faecalibacterium prausnitzii ATCC-27768, Roseburia faecis Mingzhoubio-B84313, Bifidobacterium longum ATCC-15707, Ruminococcus bromii ATCC-27255, Bifidobacterium adolescentis ATCC-15707, Bacteroides uniformis ATCC-25285, Collinsella aerofaciens ATCC-25986, Ruminococcus gnavus ATCC-29149 and Akkermansia muciniphila ATCC-baa-835 is composed of 0.10-0.30:0.10-0.30:0.05-0.20:0.05-0.20:0.05-0.20:0.005-0.1:0.005-0.1:0.01-0.03:0.01-0.03:0.01-0.03;

[0063] Optionally, in the intestinal culture medium, the inoculation amount of the intestinal microbial culture liquid is 8-12% v / v;

[0064] Optionally, the number of viable bacteria in the intestinal microbial culture reaches 10 9CFU / mL or above;

[0065] Optionally, the volume ratio of the intestinal culture medium in the ascending colon fermenter, the transverse colon fermenter and the descending colon fermenter is 4-6:6-10:6-10;

[0066] Optionally, colon organoids are planted in the microfluidic chip, and organoid culture medium and descending colon fermentation liquid are introduced;

[0067] Alternatively, colon organoids are obtained by isolation of colon tissue or differentiation of stem cells;

[0068] Optionally, the number of organoids in the microfluidic chip is 20 to 50;

[0069] Optionally, the flow rate of the organoid culture medium into the microfluidic chip is 0.5 to 1 μL / min; the flow rate of the colon fermentation solution into the microfluidic chip is 0.5 to 1 μL / min;

[0070] Optionally, air is aerated into the organoid culture medium; anaerobic gas is aerated into the colonic fermentation fluid;

[0071] Optionally, the pH values ​​in the ascending colon fermenter, the transverse colon fermenter, and the descending colon fermenter are 5.6-6.0, 6.0-6.4, and 6.4-6.9, respectively;

[0072] Optionally, the emptying rate of the ascending colon fermenter, the transverse colon fermenter, and the descending colon fermenter is 10 to 15 mL / h;

[0073] Optionally, the foods to be tested include: starch, cereal foods, meat products, vegetable products;

[0074] Optionally, the starch includes: common starch, resistant starch, slowly digestible starch;

[0075] Optionally, the cereal foods include: bread, steamed bread, rice;

[0076] Optionally, in an oral simulation device, the food to be tested and the salivary electrolyte stock solution are added with α-amylase, CaCl2 solution and water, and homogenized to obtain an oral simulation chewable material;

[0077] In the gastric fermentation tank, the oral simulated chewing material and the gastric fluid electrolyte stock solution are mixed, and CaCl2 solution, hydrochloric acid solution and water are added to react to obtain gastric digestive fluid;

[0078] In the small intestinal fermentation tank, the gastric digestive juice and the intestinal electrolyte stock solution are mixed, and pancreatic enzyme, saccharifying enzyme, CaCl2 solution, sodium hydroxide solution and water are added to react to obtain the small intestinal digestive juice;

[0079] The dialysis device contains dialysis fluid and a dialysis bag, and the digestive fluid from the small intestine is pumped into the dialysis bag;

[0080] Optionally, the small intestinal digestive fluid pumping rate in the dialysis device is 80 to 120 mL / h;

[0081] Optionally, the dialysate is an intestinal electrolyte stock solution.

[0082] In one embodiment, the accuracy and authenticity refer to that the starch digestibility, bacterial flora structure and short-chain fatty acid structure of the simulated digestion products during the in vitro complete digestion simulation of the model food are closer to the in vivo digestion results of mice.

[0083] Beneficial Effects of the Invention

[0084] The present invention uses a dialysis device to remove glucose produced during the digestion process, simulates the "digestion and absorption" state of the small intestine, and introduces an emptying equation to dynamically adjust the emptying volume of the digestive fluid, ensuring that the actual flow rate of the digestive fluid is consistent with that of the small intestine, thereby improving the realism of the simulation. Based on microfluidic chip technology, the present invention co-cultivates colon organoids and specific intestinal flora in a microfluidic environment, accurately regulates the growth conditions and metabolic processes of the colon flora, and enhances the simulation effect of the complex physiological environment of the colon stage.

[0085] The digestion products and bacterial flora structure simulated by the method of the present invention are very close to the real in vivo structure and have high authenticity and credibility. BRIEF DESCRIPTION OF THE DRAWINGS

[0086] Figure 1 It is a schematic diagram of the in vitro full digestion simulation system; including the overall flow chart of the in vitro dynamic digestion system from the mouth to the colon; including the simulated oral digestion device, stomach digestion tank, small intestine digestion tank, small intestine dialysis device, ascending colon fermentation tank, transverse colon fermentation tank, descending colon fermentation tank, and intestinal organoid-microflora microfluidic chip;

[0087] Figure 2 It is the hydrolysis curve of the slowly digestible starch in the small intestine digestion in Example 1, Comparative Example 1 and Comparative Example 4;

[0088] Figure 3 It is a PCA analysis diagram of intestinal bacteria in the colon fermentation of slowly digestible starch in Example 1, Comparative Example 3 and Comparative Example 5;

[0089] Figure 4 is a graph showing the relative abundance of intestinal bacteria in the colonic fermentation of slowly digestible starch in Example 1, Comparative Example 3, and Comparative Example 5;

[0090] Figure 5 is the content of short-chain fatty acids in the slowly digestible starch in colonic fermentation in Example 1, Comparative Example 3 and Comparative Example 5;

[0091] Figure 6The growth of intestinal organoids in colonic fermentation of slowly digestible starch in Example 1 and Comparative Example 2 and the number of buds on the seventh day;

[0092] Figure 7 It is the PI staining image and average fluorescence intensity of the intestinal organoids of the slowly digestible starch in the colon fermentation on the seventh day in Example 1 and Comparative Example 2;

[0093] Figure 8 It is the relative expression levels of colon Muc2 and Lgr5 in the colonic fermentation of slowly digestible starch in Example 1, Comparative Example 2 and Comparative Example 5. DETAILED DESCRIPTION

[0094] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0095] Device

[0096] The structure of the in vitro complete digestion simulation system is as follows Figure 1 As shown, it includes the overall flow chart of the in vitro dynamic digestion system from the mouth to the colon; it includes a simulated oral digestion device, a stomach digestion tank, a small intestine digestion tank, a small intestine dialysis device, an ascending colon fermentation tank, a transverse colon fermentation tank, a descending colon fermentation tank, and an intestinal organoid-microflora microfluidic chip.

[0097] The simulated oral digestion device is an intelligent mechanized beating homogenization device purchased from Ningbo Licheng Instrument Co., Ltd., product model LC-11L; or it can be achieved by conventional homogenization equipment;

[0098] The stomach digestion tank, the small intestine digestion tank, the small intestine dialysis device, the ascending colon fermentation tank, the transverse colon fermentation tank, and the descending colon fermentation tank are glass fermentation tanks, all of which are connected to the anaerobic bottle through a silicone tube; or it can be achieved through conventional fermentation equipment;

[0099] The small intestinal dialysis device is a container containing a dialysis bag and dialysis fluid. The dialysis bag is a SP131345 cellulose dialysis bag (20000) 20 kDa Dalton, purchased from Shanghai Yuanye Biotechnology Co., Ltd.;

[0100] The microfluidic chip is the BeonChip electrochemical-3D cell culture microfluidic chip, purchased from Micro-Nano Cube Technology (Beijing) Co., Ltd., product model BE-GRADIENT;

[0101] The microfluidic chip was connected to the descending colon fermenter and the organoid culture medium bottle via silicone tubes;

[0102] The simulated oral digestion device, the stomach digestion tank, the small intestine digestion tank, the small intestine dialysis device, the ascending colon fermentation tank, the transverse colon fermentation tank, the descending colon fermentation tank and the intestinal organoid-microflora microfluidic chip are connected by a pump and a silicone tube;

[0103] Optionally, the simulated oral digestion device, gastric digestion tank, small intestinal digestion tank, small intestinal dialysis device, ascending colon fermentation tank, transverse colon fermentation tank, descending colon fermentation tank are connected to the culture medium feeding bottle and pH feeding bottle through silicone tubes; or the culture medium feeding and pH adjustment are achieved by manual addition.

[0104] raw material

[0105] Corn starch was purchased from Hangzhou Prostar Starch Co., Ltd.;

[0106] Preparation method of slow digestible starch:

[0107] A certain amount of corn starch was dispersed in deionized water to prepare a 30% (w / w) starch suspension, which was placed on a heating plate and maintained at 40°C. The pH of the suspension was adjusted to 8-9 with a 1 mol / L NaOH solution, and then 15% (v / w) acetic anhydride was added dropwise within 0.5 h, and the reaction was continued for 2 h. Finally, the pH of the system was adjusted to 6.5 with a 1 mol / L HCl solution to terminate the reaction.

[0108] The obtained acylated starch was washed twice with deionized water and ethanol, then dried in an oven at 40°C, ground and passed through a 100-mesh sieve to obtain a sample; the resistant starch content was measured to be 62%;

[0109] 38 g of common corn starch was added to every 62 g of acetylated starch, and the mixture was mixed to obtain a slowly digestible starch having a resistant starch content of 50%.

[0110] Preparation of electrolyte stock solutions: The compositions of salivary electrolyte stock solutions (SSF), gastric electrolyte stock solutions (SGF) and intestinal electrolyte stock solutions (SIF) are shown in Table 1.

[0111] Table 1 Preparation of electrolyte stock solution for simulated digestion fluid

[0112]

[0113]

[0114] Note: “ / ” means not to add.

[0115] Pancreatin was purchased from Sigma-Aldrich (8 U / mg, P7545, EC 232-468-9);

[0116] Glucoamylase was purchased from Sigma-Aldrich (260 U / mL, A7095, EC 3.2.1.3);

[0117] α-Amylase was purchased from Sigma-Aldrich (16 U / mg, A3176, EC 647-015-00-4);

[0118] Intestinal culture medium preparation: 8g corn starch, 4.50g yeast extract, 3g tryptone, 0.43g bile salt No. 3, 4.50g NaCl, 2.50g KCl, 0.40g KH2PO4, 4.50g MgCl2·6H2O, 0.20g CaCl2·2H2O, 1.0mL Tween 80 and 1L deionized water. After autoclaving at 121℃ for 15 minutes, 0.5g mucin, 0.8g L-cysteine ​​hydrochloride, 0.05g heme and 2mL trace element stock solution were added;

[0119] Preparation of trace element stock solution: 3.0 g MgSO4·7H2O, 0.10 g FeSO4·7H2O, 0.10 g CaCl2·2H2O, 0.32 g MnCl2·4H2O, 0.18 g CoSO4·7H2O, 0.01 g CuSO4·5H2O, 0.18 g ZnSO4·7H2O, 0.092 g NiSO4·6H2O and 1 L deionized water.

[0120] Preparation of artificial intestinal flora:

[0121] As shown in Table 2, the strains were cultured (the strains in Table 2 can be purchased through commercial channels) and mixed according to the bacterial count ratio. The mixing method was as follows: the strains were cultured to the logarithmic growth phase, the cells were collected, and the cells were resuspended in sterile PBS. The bacterial count of each strain was adjusted to 10 8 CFU / mL, and artificial intestinal flora was obtained by compounding.

[0122] Table 2 Artificial intestinal flora

[0123]

[0124]

[0125] Preparation of intestinal mucosal pellets:

[0126] Mucin is the main structural and functional component of the mucus covering the surface of the intestinal epithelium. Agar is selected as the coagulant of the mucosal sphere. The preparation method of the intestinal mucosal sphere is as follows: weigh 2g of agar and heat it to 100℃ in 50mL of distilled water to dissolve it. After the solution becomes clear and transparent, cool it to 60℃ and add 0.5g of mucin. After it is fully dissolved, adjust the pH of the solution to 8 to obtain a mucosal gel solution; add the mucosal gel solution into a mold to solidify it into a small ball with a diameter of 0.5cm, and sterilize it with ultraviolet light in a clean bench for 20 minutes.

[0127] Colon organoid construction:

[0128] To construct colon organoids, follow these steps:

[0129] (1) Culture and proliferation of pluripotent stem cells:

[0130] Human induced pluripotent stem cells (hiPSCs, which can be purchased commercially) were cultured using a standard feeder-free culture system-mTeSR1 medium. HiPSCs were cultured in a culture dish coated with Matrigel at 37°C and 5% CO2, and the culture medium was changed every day. When the confluence of hiPSCs reached 70-80%, the cells were dissociated with EDTA solution, gently pipetted to form a single cell suspension, and re-seeded in a culture dish newly coated with Matrigel and continued to be cultured.

[0131] (2) Directed differentiation into mesoderm:

[0132] When the confluence of hiPSCs cells reaches about 70%, directed differentiation is started; RPMI culture medium containing 10 μM CHIR99021 (Wnt signal agonist) is used to induce cells to differentiate into mesoderm. After culturing for 2 to 3 days, cell morphological changes are observed every day, and the cells will gradually develop mesoderm characteristics.

[0133] (3) Formation of colon-specific precursor cells:

[0134] Continue to culture the mesoderm cells in the basal medium to promote their differentiation into intestinal precursor cells for 3 to 4 days. During this period, replace the medium to ensure that the cells maintain growth.

[0135] (4) Formation of three-dimensional colon organoids:

[0136] After the cells differentiated into colonic progenitor cells, the cells were resuspended in ice-cold Matrigel matrix at an appropriate density (1000-5000 cells / 10 μL) and seeded in the center of a 24-well plate, 55 μL per well; the 24-well plate was inverted and placed in a 37°C incubator for 20 minutes to allow Matrigel to solidify. Use growth medium and continue to culture at 37°C, 5% CO2. Change the medium every 3 days and continue to observe organoid formation until visible structures are formed.

[0137] After visible structures are formed, the growth medium is replaced with differentiation medium and culture is continued for 5 to 7 days (the time is determined according to the state of the organoids) to promote the differentiation of organoids into mature colon cells and obtain colon organoids with mature three-dimensional structures.

[0138] The basal culture medium used is one or more of DMEM / F12 or Advanced DMEM / F12 supplemented with 10 mM HEPEs, 2 mM Glutamax, and 100 units / mL Penicillin-streptomycin.

[0139] The growth medium was basal medium supplemented with 0.5nM Wnt3a, B27, N2, 500μM N-acetyl cysteine, 500nM A83-01, 10nM Human-Gastrin, 5nM Prostaglandin E2, 10μM SB 202190, 10mM Nicotinamide, 10μM Y027632 dihydrochloride, 50ng / mL EGF, 500ng / mL R-spondin1, and 100ng / mL Noggin.

[0140] The differentiation medium is a basal medium supplemented with 500 ng / mL R-spondin1, 100 ng / mL Noggin, B27, N2, 500 μM N-acetyl cysteine, 500 μM N-acetyl cysteine, 500 nM A83-01, 50 ng / mL EGF, and 10 nM Human-Gastrin.

[0141] Detection Methods

[0142] 1. Calculation method of starch hydrolysis rate in in vitro simulation:

[0143] Starch hydrolysis rate (%) = glucose content × 0.9 × 100 / S; wherein S is the total mass of starch, and 0.9 is the stoichiometric constant of starch extracted from the glucose content.

[0144] Glucose content detection method: Take 3 portions of supernatant (6 μL) from each centrifuge tube of the sample to be tested and place them in an ELISA plate, then add 200 μL of glucose determination reagent, place the ELISA plate in an ELISA reader, measure the absorbance of the supernatant at 520 nm, and calculate the glucose content based on the glucose standard curve; ELISA test conditions: oscillate for 10 seconds, keep constant temperature at 37°C, and keep warm for 10 minutes.

[0145] 2. Calculation method of digestibility in mice:

[0146] The contents of the mouse ileum were taken, washed with water, and dried to obtain unhydrolyzed starch. The in vivo starch hydrolysis rate was calculated by comparing the mass of unhydrolyzed starch with that of starch administered by oral administration;

[0147] Starch hydrolysis rate (%) = 1-unhydrolyzed starch mass / intragastric starch mass × 100%.

[0148] 3. Detection of intestinal flora abundance

[0149] DNA from intestinal flora was extracted using a DNA purification kit, and the V3-V4 region of the bacterial 16S rRNA gene was PCR amplified using primers 341F and 806R. After PCR products were detected and purified by 2% agarose gel electrophoresis, they were sequenced using the Novasek 6000PE250 platform, providing at least 50,000 raw data for each sample. Sequencing data were quality controlled using the DADA2 plug-in in QIIME2.0, including denoising, splicing, and chimera removal, to form amplicon sequencing variants (ASVs).

[0150] 4. Determination of short-chain fatty acids (SCFAs)

[0151] Take 25 mg of the sample to be tested in a 2 mL EP tube, add pure water and vortex evenly, centrifuge at 4 ° C for 20 min (5000 r / min). Take 0.8 mL of the supernatant in a 2 mL EP tube, add 0.1 mL of H2SO4 solution (50%) and 0.8 mL of the extract, centrifuge for 15 min (4 ° C, 10000 r / min), and then stand at -20 ° C for 30 min. Finally, take the supernatant in an injection bottle and detect it by gas chromatography-mass spectrometry (GC-MS). Chromatographic conditions: Chromatographic column: Agilent HP-FFAP capillary column (30m×250μm×0.25μm); temperature program: 80 ° C for 1 min, increase to 200 ° C at 10 ° C / min, maintain for 5 min, increase to 240 ° C at 40 ° C / min, maintain for 1 min; carrier gas (He) flow rate 3 mL / min, injection volume 1 μL; split ratio: 5:1. Mass spectrometry conditions: ionization voltage -70 eV; transfer line temperature 240 °C; ion source temperature 200 °C; quadrupole temperature 150 °C; mass scan range m / z 33-150.

[0152] 5. Organoid dead cell detection

[0153] PI (propidium iodide) staining is used to detect dead cells in colon organoids. First, the organoids after culture are gently washed with PBS to remove the residual culture medium. The organoids are then fixed in 4% paraformaldehyde for 30 minutes. After fixation, 0.5% Triton X-100 / PBS solution is used for cell permeabilization for 10 minutes. Next, the organoids are reacted with 50μg / mL of PI dye for 30 minutes. PI can enter the damaged cell membrane and bind to DNA, thereby marking dead cells. After staining, the sample is washed again with PBS and observed by laser confocal microscopy. Cells positive for PI staining show red fluorescence, representing dead cells or cells with damaged cell membranes.

[0154] 6. Real-time fluorescence quantitative polymerase chain reaction experiment

[0155] Colon organoid samples were collected using organoid dissociation solution, and total RNA was extracted from the cells using an RNA extraction kit. The purity of the RNA in the sample was determined using a spectrophotometer to ensure that the absorbance ratio at 260 / 280nm was between 1.8 and 2.0. After the RNA sample was qualified, it was diluted to the same concentration. The extracted RNA was reverse transcribed into cDNA using a cDNA reverse transcription kit. qRT-PCR experiments were performed using a SYBR qPCR Master Mix kit and a real-time fluorescence quantitative PCR instrument. In each sample, β-actin was used as a reference gene to detect the expression of target genes (such as Muc2 and Lgr5). The following primers were used in the qRT-PCR reaction:

[0156] β-actin: front primer: CCACAGCTGAGAGGGAAA (SEQ ID NO.1), back primer: AAGGAAGGCTGGAAAAGAGC (SEQ ID NO.2);

[0157] Muc2: front primer: AGGGCTCGGAACTCCAGAAA (SEQ ID NO. 3), back primer: CCAGGGAATCGGTAGACATCG (SEQ ID NO. 4);

[0158] Lgr5: front primer: CCTACTCGAAGACTTACCCAGT (SEQ ID NO. 5), back primer: GCATTGGGGTGAATGATAGCA (SEQ ID NO. 6);

[0159] Pass 2 -ΔΔCt The relative expression of target genes relative to reference genes was calculated by this method, and the expression levels of genes such as Muc2 and Lgr5 in organoids were quantitatively analyzed.

[0160] 7. Data processing

[0161] In all experiments, data were repeated at least 3 times and expressed as mean ± standard deviation (SD). Data analysis was performed using GraphPad Prism 7.0 (GraphPad Prism Software Inc., San Diego, California) software. The comparison between two groups was performed using the bilateral Student's t-test method. For more than two groups, the p value was calculated using the Dunnett's post-hoc testing method in One-way ANOVA. *p<0.05, **p<0.01, ***p<0.001, all compared with the examples.

[0162] Example 1: A method for simulating complete in vitro digestion of food

[0163] A method for simulating complete in vitro digestion of food, comprising the following steps:

[0164] (1) Simulating oral digestion: prepare 10 mL of the sample to be tested (10% slowly digestible starch, 50% resistant content, g / mL), 7.0 mL of SSF electrolyte stock solution with a pH of 7.0, vortex and oscillate to mix, add 1.0 mL of SSF electrolyte stock solution containing 1500 U / mL α-amylase, 50 μL of 0.3 mol / L CaCl2 solution and 1.5 mL of ultrapure water, and mix well; transfer to an intelligent mechanized beating homogenizer, apply a force of 204 N for 10 s to obtain an oral simulated chew;

[0165] (2) Simulated gastric digestion: Take 20 mL of simulated oral chewing material, add 15 mL of SGF electrolyte stock solution, 3.2 mL of SGF electrolyte stock solution without porcine pepsin, 10 μL of 0.3 mol / L CaCl2 solution, 1.5 mL of ultrapure water and 0.4 mL of 1.0 mol / L hydrochloric acid solution, mix well, adjust the solution pH to 3.0 in a gastric digestion tank, react at 37°C and 100 r / min for 2 h, and obtain gastric digestion solution:

[0166] (3) Simulated small intestinal digestion: Pump gastric digestive fluid into the small intestinal digestion tank, about 40 mL, then add 22 mL SIF electrolyte stock solution, 10 mL pancreatic enzyme (final concentration 4000 U), 0.2 mL saccharifying enzyme, 80 μL 0.3 mol / L CaCl2 solution, 0.3 mL 1.0 mol / L sodium hydroxide solution and 2.6 mL ultrapure water. After mixing, adjust the solution pH to 7.0 in the small intestinal digestion tank, react at 37 ° C and 100 r / min, and pump the small intestinal digestion fluid into the small intestinal digestion dialysis device. The pumping rate is carried out according to the emptying equation:

[0167]

[0168] Here, t represents the time (min) from the start of small intestinal digestion.

[0169] (4) Small Intestinal Digestive Fluid Dialysis

[0170] The dialysis reaction was carried out in a dialysis bag. At the beginning of the reaction, the dialysis bag was placed in 500 mL of dialysis solution (dialysis solution was an intestinal electrolyte stock solution), and the dialysis solution was continuously pumped into the dialysis device at a rate of 100 mL / h.

[0171] Samples were taken from the digestive fluid in the dialysis bag every 10 minutes, and the digestive fluid was taken out and pumped into the sampling and detection device for detection (detecting the glucose content in the dialysis fluid) to obtain the starch digestibility of the sample at each time point under the in vitro small intestine simulated digestion reaction.

[0172] (5) Simulated colonic fermentation

[0173] Inoculate artificial intestinal flora (inoculation volume 10% v / v) into the intestinal culture medium and ferment until the colony forming unit reaches 10 9 CFU / mL, and intestinal microbial liquid was obtained. 50mL, 80mL, and 50mL of intestinal microbial liquid were inoculated into the ascending colon fermentation tank, the transverse colon fermentation tank, and the descending colon fermentation tank, and then 500mL, 800mL, and 500mL of intestinal culture medium were added into the three reactors respectively, and stirred at 30rpm under 37°C. 10 mucosal balls were added into each tank, and anaerobic gas (hydrogen 5%, carbon dioxide 10%, nitrogen 85%) was passed for 10min every 8h; the pH values ​​of the three reactors were controlled in the range of 5.6-6.0, 6.0-6.4, and 6.4-6.9, respectively (different pH values ​​within the range will not affect the results), and fermented continuously for 24h after inoculation to stabilize the flora environment.

[0174] The digestive fluid in the dialysis bag is continuously pumped into the colon fermentation tank for further fermentation according to the emptying equation, wherein the digestive fluid in the ascending colon fermentation tank, the transverse colon fermentation tank and the descending colon fermentation tank is slowly and continuously emptied, and the emptying rate is 12.5 mL / h (i.e., 12.5 mL is transferred from the ascending colon fermentation tank to the transverse colon fermentation tank per hour; 12.5 mL is transferred from the transverse colon fermentation tank to the descending colon fermentation tank per hour).

[0175] (6) Colon organoid-microbiome microfluidic chip

[0176] Based on the BeonChip electrochemical-3D cell culture microfluidic chip BE-GRADIENT, the colon organoids and colon lysate were interacted as follows:

[0177] The colon organoids with mature three-dimensional structure were dissolved with matrix gel and implanted into microfluidic chips, 30 organoids / chip. The microfluidic chip was made of PDMS material, with a channel width of 1 μm, a length of 300 μm, a depth of 50 μm, and a culture chamber volume of 14 μL. The colon lysate and differentiation medium (air, i.e., 5% carbon dioxide, 15% oxygen, and 80% nitrogen) were introduced through external pumps at a flow rate of 1 μL / min to ensure the continuous dynamic interaction between the organoids and the colon lysate, and the culture was continued at 37°C for 7 days.

[0178] Detect the growth status of organoids and the bacterial community structure in the effluent (waste liquid) after the interaction.

[0179] Comparative Example 1: Testing the small intestinal digestion effect without using a dialysis device

[0180] On the basis of Example 1, step (4) was omitted, that is, the small intestinal digestive fluid was sampled every 10 minutes according to the emptying equation, and the precipitate and supernatant were obtained by centrifugation. The precipitate and 20% v / v were pumped into the ascending colon fermentation tank, and the remaining steps were consistent with Example 1.

[0181] Detection of starch digestibility in small intestinal digestive juice.

[0182] Comparative Example 2: Testing the colon digestion effect without adding specific flora

[0183] On the basis of Example 1, the intestinal microbial culture liquid is not inoculated in step (5) (i.e., the intestinal microbial culture liquid is replaced with an equal amount of intestinal culture medium in the ascending colon fermentation tank, the transverse colon fermentation tank, and the descending colon fermentation tank), and the remaining steps are consistent with Example 1.

[0184] Detect the growth status of organs on microfluidic chips.

[0185] Comparative Example 3: Testing colon digestion without adding intestinal organoids

[0186] On the basis of Example 1, step (6) is changed to not implant organoids in the microfluidic chip, and the remaining steps are consistent with Example 1.

[0187] Detect the bacterial flora structure and short-chain fatty acid structure in the excluded fluid.

[0188] Comparative Example 4: Verification of small intestinal digestion in mice

[0189] 24 C57BL / 6 male mice aged 6-8 weeks were selected as experimental subjects. The mice were fasted for 12 hours before the experiment, and were fed a slow digestible starch sample solution (slow digestible starch, resistance content 50%, g / mL) by oral gavage at a dose of 300 mg / kg body weight. The starch digestion in the small intestine of 6 mice was detected at each time point of 1, 2, 3, and 4 hours.

[0190] Comparative Example 5: Verification of colonic glycolysis in mice

[0191] Six C57BL / 6 male mice aged 6-8 weeks were selected as experimental subjects. First, the mice were treated with broad-spectrum antibiotics for one week, including vancomycin (0.5 g / L), ampicillin (1 g / L), neomycin (1 g / L), and metronidazole (1 g / L), and the antibiotics were prepared in drinking water. After the intestinal flora was cleared, 200 μL of the artificial intestinal flora prepared in Example 1 was gavaged every day for 7 days.

[0192] The mice were fasted for 12 hours before the experiment and were fed a slowly digestible starch sample solution (slowly digestible starch, resistance content 50%, g / mL) by oral gavage at a dose of 300 mg / kg body weight. After feeding, they resumed normal diet and were observed for another 24 hours. Fecal samples were collected for determination of flora and short-chain fatty acid content.

[0193] Example 2: In vitro digestion simulation effect detection

[0194] Detecting the starch digestibility of the digestive fluid in the dialysis bag of Example 1, the growth status of the organoids in the microfluidic chip after interaction, the bacterial community structure in the microfluidic waste liquid, and the content of short-chain fatty acids;

[0195] Detecting the hydrolysis rate of starch during small intestinal digestion of Comparative Example 1 and Comparative Example 4;

[0196] Detecting the bacterial flora structure and short-chain fatty acid structure in the microfluidic discharge liquid (waste liquid) of Comparative Example 3 and Comparative Example 5;

[0197] The growth status of the organoids after the interaction between Comparative Examples 2 and 5 was detected.

[0198] The test results are as follows:

[0199] (1) Starch digestibility

[0200] The results of starch digestibility in the small intestine of Example 1, Comparative Example 1 and Comparative Example 4 are as follows Figure 2 As shown, the results indicate that Example 1 (an in vitro simulation system using a dialysis device) exhibited a relatively stable and gradually increasing hydrolysis rate throughout the digestion process, indicating that the dialysis device played a positive role in simulating the "digestion and absorption" process of the small intestine.

[0201] As time goes by, the hydrolysis rate of Example 1 is significantly higher than that of Comparative Example 1 (without using a dialysis device), and is closer to the starch digestion characteristics in mice; that is, the dialysis device of Example 1 can effectively approach the in vivo digestion conditions in terms of dynamic digestion and absorption, and can more realistically simulate the absorption characteristics of the small intestine.

[0202] (2) Bacterial community structure after interaction

[0203] The bacterial flora structure in the discharge liquid of Example 1, Comparative Example 3 and Comparative Example 5 is as follows Figure 3 As shown, the results indicate that the in vitro simulation system of Example 1 is highly similar to the colon fermentation environment in mice in terms of flora structure; the flora composition of Comparative Example 3 (colon digestion test without adding intestinal organoids) deviates greatly on the PCA graph, and there is a clear gap between Example 1 and Comparative Example 5.

[0204] It can be seen that the interaction between intestinal organoids and microbiota can better maintain the diversity and stability of colonic microbiota, thereby more realistically reproducing the colonic fermentation environment in vivo. The advantages of Example 1 in simulating the in vivo environment, especially in the reduction effect of intestinal microecology during dynamic digestion, absorption and fermentation, are closer to the in vivo environment.

[0205] The relative abundance of intestinal bacteria in the discharge fluid of Example 1, Comparative Example 3 and Comparative Example 5 is as follows Figure 4 As shown, the results show that the relative abundance of the main flora in Example 1 showed significant similarity compared with the colonic fermentation group of mice in Comparative Example 5, especially the abundance of strains such as Prevotella copri, Faecalibacterium prausnitzii, Bifidobacterium longum, Bacteroides uniformis, etc. There was no significant difference between the two, and the in vitro simulation system of Example 1 had advantages in maintaining the intestinal flora structure.

[0206] Compared with Comparative Example 3, the absence of intestinal organoids resulted in significant changes in the flora structure, and the abundance of most strains was significantly lower than that in Example 1 and Comparative Example 5. It can be seen that the presence of intestinal organoids in the in vitro system is crucial to maintaining the stability of the intestinal microbial ecosystem, and an environment lacking organoid support is difficult to maintain a flora balance similar to that in vivo.

[0207] The short-chain fatty acid structures in the discharge liquid of Example 1, Comparative Example 3 and Comparative Example 5 are as follows Figure 5As shown, the results show that the proportion of acetic acid production in Example 1 is significantly higher than that in Comparative Example 3, and is relatively close to the in vivo colonic fermentation verification group (Comparative Example 5) in mice, with statistically significant differences. At the same time, in the production of propionic acid and butyric acid, Example 1 is relatively close to Comparative Example 5, but is lower in Comparative Example 3 (without the addition of intestinal organoids). Therefore, Example 1 is closer to the in vivo experiment in the production of SCFAs, further verifying the good simulation effect of the in vitro simulation system on the in vivo colon environment during dynamic digestion, absorption and colonic fermentation.

[0208] (3) Organoid growth status

[0209] Example 1, Comparative Example 2 Organoids after interaction (seven days) in the microfluidic chip Figure 6 As shown, the results show that in Example 1, the intestinal organoids have clear morphology and complete structure in the culture and differentiation stages, and show a high number of buds; in Comparative Example 2, the lack of a supporting environment for specific flora leads to poor growth of the organoids in the culture and differentiation stages, and the average number of buds is significantly lower than that in Example 1. The importance of specific flora in the growth process of organoids, and their absence will lead to unstable growth and incomplete differentiation of organoids.

[0210] Example 1, Comparative Example 2 Organoid PI staining and average fluorescence intensity after interaction (seven days) in the microfluidic chip are shown in Figure 7 As shown. PI staining is used to detect cell death in organoids, and the results show that the organoids of Example 1 show a lower PI staining fluorescence intensity, indicating that the cell survival rate of the organoids is higher in this in vitro simulation system. In contrast, the PI staining intensity of Comparative Example 2 is significantly higher, suggesting that the degree of cell damage in the organoids is higher without the addition of specific flora, indicating that the cell integrity and survival rate of the organoids in Example 1 are significantly better than those in Comparative Example 2. The in vitro simulation system of Example 1 provides a stable growth environment and a higher cell survival rate for organoids, which can better simulate the in vivo colon environment and support the dynamic digestion and fermentation research of slowly digestible starch.

[0211] The relative expression results of Muc2 and Lgr5 in the organoids after interaction (seven days) in the microfluidic chip of Example 1, Comparative Example 2 and Comparative Example 5 are as follows Figure 8 shown.

[0212] Lgr5 is an important marker of colon stem cells, and its higher expression reflects the activity of colon tissue. The results show that the relative expression of the Lgr5 gene in Example 1 is significantly higher than that in Comparative Example 2 and Comparative Example 5, indicating that the in vitro simulation system can better support the activity and proliferation potential of colon stem cells and has a high similarity to the in vivo environment.

[0213] Muc2 is the main component of the intestinal mucus layer and is closely related to the intestinal barrier function and flora stability. The Muc2 gene expression of Example 1 is also significantly higher than that of Comparative Example 2 and Comparative Example 5. The Muc2 expression of Example 1 is close to that of the in vivo control group (Comparative Example 5). Example 1 is closer to the colon environment in mice in terms of Lgr5 and Muc2 gene expression, and the in vitro simulation system has a real simulation ability of the colon microecology during dynamic digestion and colon fermentation.

[0214] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A method for simulating complete in vitro digestion of food, characterized in that: The food to be tested is added into an in vitro complete digestion simulation device to simulate the digestion process of the food from the mouth to the colon; Among them, the in vitro full digestion simulation device includes an interconnected oral simulation device, a stomach fermentation tank, a small intestine fermentation tank, a dialysis device, an ascending colon fermentation tank, a transverse colon fermentation tank, a descending colon fermentation tank, a microfluidic chip and a pump.

2. The method according to claim 1, characterized in that According to the emptying equation, the small intestinal digestive fluid is taken out from the small intestinal fermentation tank and transferred to the dialysis device. The small intestinal digestive fluid is dialyzed and transferred to the ascending colon fermentation tank; The emptying equation is as follows: Simulated small intestine tank digestion fluid emptying volume (mL) = 2 ( -t / 1100) 2.5 ; Wherein, t represents the digestion time (min) of the small intestinal digestion simulation system.

3. The method according to any one of claims 1 to 2, characterized in that: Mucosal pellets are added to the ascending colon fermentation tank, the transverse colon fermentation tank, and the descending colon fermentation tank; The preparation method of the mucosal sphere is as follows: Adding agar into water to dissolve it, adding mucin to obtain a mucosal gel solution; solidifying the mucosal gel solution to obtain mucosal pellets; Optionally, the ratio of agar, mucin and water is 1-3 g: 0.3-0.6 g: 50 mL; Optionally, the diameter of the mucosal pellet is 0.3 to 0.7 cm; Optionally, the number of the mucosal spheres is 5 to 15.

4. The method according to any one of claims 1 to 3, characterized in that: The ascending colon fermentation tank, the transverse colon fermentation tank and the descending colon fermentation tank contain intestinal culture medium, and the intestinal culture medium is inoculated with intestinal microbial liquid; the intestinal microbial liquid is prepared by fermentation of artificial intestinal flora; The artificial intestinal flora consists of Prevotella copri ATCC-33547, Faecalibacterium prausnitzii ATCC-27768, Roseburia faecis Mingzhoubio-B84313, Bifidobacterium longum ATCC-15707, Ruminococcus bromii ATCC-27255, Bifidobacterium adolescentis ATCC-15707, Bacteroides uniformis ATCC-25285, Collinsella aerofaciens ATCC-25986, Ruminococcus gnavus ATCC-29149 and Akkermansia muciniphila ATCC-baa-835 is composed of 0.10-0.30:0.10-0.30:0.05-0.20:0.05-0.20:0.05-0.20:0.005-0.1:0.005-0.1:0.01-0.03:0.01-0.03:0.01-0.03; Optionally, in the intestinal culture medium, the inoculation amount of the intestinal microbial culture liquid is 8-12% v / v; Optionally, the number of viable bacteria in the intestinal microbial culture reaches 10 9 CFU / mL or above; Optionally, the volume ratio of the intestinal culture medium in the ascending colon fermenter, the transverse colon fermenter and the descending colon fermenter is 4-6:6-10:6-10.

5. The method according to any one of claims 1 to 4, characterized in that: The microfluidic chip is colonized with colon organoids, and is fed with organoid culture medium and descending colon fermentation fluid; Alternatively, colon organoids are obtained by isolation of colon tissue or differentiation of stem cells; Optionally, the number of organoids in the microfluidic chip is 20 to 50; Optionally, the flow rate of the organoid culture medium into the microfluidic chip is 0.5 to 1 μL / min; the flow rate of the colon fermentation solution into the microfluidic chip is 0.5 to 1 μL / min; Optionally, air is aerated into the organoid culture medium and anaerobic gas is aerated into the colonic lysate.

6. The method according to any one of claims 1 to 5, characterized in that: The pH values ​​in the fermentation tanks for ascending colon, transverse colon, and descending colon were 5.6-6.0, 6.0-6.4, and 6.4-6.9, respectively; Optionally, the emptying rates of the ascending colon fermenter, the transverse colon fermenter, and the descending colon fermenter are 10 to 15 mL / h.

7. The method according to any one of claims 1 to 6, characterized in that: The foods to be tested include: starch, cereal foods, meat products, and vegetable products; Optionally, the starch includes: common starch, resistant starch, slowly digestible starch; Optionally, the cereal foods include: bread, steamed bread, and rice.

8. The method according to any one of claims 1 to 6, characterized in that: In the oral simulation device, the food to be tested and the salivary electrolyte stock solution are added with α-amylase, CaCl2 solution and water, and homogenized to obtain an oral simulation chewing material; In the gastric fermentation tank, the oral simulated chewing material and the gastric fluid electrolyte stock solution are mixed, and CaCl2 solution, hydrochloric acid solution and water are added to react to obtain gastric digestive fluid; In the small intestinal fermentation tank, the gastric digestive juice and the intestinal electrolyte stock solution are mixed, and pancreatic enzyme, saccharifying enzyme, CaCl2 solution, sodium hydroxide solution and water are added to react to obtain the small intestinal digestive juice; The dialysis device contains dialysis fluid and a dialysis bag, and the digestive fluid from the small intestine is pumped into the dialysis bag; Optionally, the small intestinal digestive fluid pumping rate in the dialysis device is 80 to 120 mL / h; Optionally, the dialysate is an intestinal electrolyte stock solution.

9. Use of the method according to any one of claims 1 to 8 in simulating food digestion in vitro, screening drugs or constructing disease models.

10. A method for improving the accuracy and authenticity of in vitro complete digestion simulation of food, characterized in that: The food to be tested is added into an in vitro complete digestion simulation device to simulate the digestion process of the food from the mouth to the colon; The in vitro complete digestion simulation device includes an oral simulation device, a stomach fermentation tank, a small intestine fermentation tank, a dialysis device, an ascending colon fermentation tank, a transverse colon fermentation tank, a descending colon fermentation tank, a microfluidic chip and a pump that are interconnected; Optionally, the small intestinal digestive fluid is taken out from the small intestinal fermenter according to the emptying equation, transferred to a dialysis device, and the small intestinal digestive fluid is dialyzed and transferred to the ascending colon fermenter; The emptying equation is as follows: Wherein, t represents the digestion time of the small intestinal digestion simulation system (min); Optionally, mucosal spheres are added to the ascending colon fermentation tank, the transverse colon fermentation tank, and the descending colon fermentation tank; The preparation method of the mucosal sphere is as follows: Adding agar into water to dissolve it, adding mucin to obtain a mucosal gel solution; solidifying the mucosal gel solution to obtain mucosal pellets; Optionally, the ratio of agar, mucin and water is 1-3 g: 0.3-0.6 g: 50 mL; Optionally, the diameter of the mucosal pellet is 0.3 to 0.7 cm; Optionally, the number of mucosal globules is 5 to 15; Optionally, the ascending colon fermenter, the transverse colon fermenter and the descending colon fermenter contain intestinal culture medium, and the intestinal culture medium is inoculated with intestinal microbial liquid; the intestinal microbial liquid is prepared by fermentation of artificial intestinal flora; The artificial intestinal flora consists of Prevotella copri ATCC-33547, Faecalibacterium prausnitzii ATCC-27768, Roseburia faecis Mingzhoubio-B84313, Bifidobacterium longum ATCC-15707, Ruminococcus bromii ATCC-27255, Bifidobacterium adolescentis ATCC-15707, Bacteroides uniformis ATCC-25285, Collinsella aerofaciens ATCC-25986, Ruminococcus gnavus ATCC-29149 and Akkermansia muciniphila ATCC-baa-835 is composed of 0.10-0.30:0.10-0.30:0.05-0.20:0.05-0.20:0.05-0.20:0.005-0.1:0.005-0.1:0.01-0.03:0.01-0.03:0.01-0.03; Optionally, in the intestinal culture medium, the inoculation amount of the intestinal microbial culture liquid is 8-12% v / v; Optionally, the number of viable bacteria in the intestinal microbial culture reaches 10 9 CFU / mL or above; Optionally, the volume ratio of the intestinal culture medium in the ascending colon fermenter, the transverse colon fermenter and the descending colon fermenter is 4-6:6-10:6-10; Optionally, colon organoids are planted in the microfluidic chip, and organoid culture medium and descending colon fermentation liquid are introduced; Alternatively, colon organoids are obtained by isolation of colon tissue or differentiation of stem cells; Optionally, the number of organoids in the microfluidic chip is 20 to 50; Optionally, the flow rate of the organoid culture medium into the microfluidic chip is 0.5 to 1 μL / min; the flow rate of the colon fermentation solution into the microfluidic chip is 0.5 to 1 μL / min; Optionally, air is aerated into the organoid culture medium; anaerobic gas is aerated into the colonic fermentation fluid; Optionally, the pH values ​​in the ascending colon fermenter, the transverse colon fermenter, and the descending colon fermenter are 5.6-6.0, 6.0-6.4, and 6.4-6.9, respectively; Optionally, the emptying rate of the ascending colon fermenter, the transverse colon fermenter, and the descending colon fermenter is 10 to 15 mL / h; Optionally, the foods to be tested include: starch, cereal foods, meat products, vegetable products; Optionally, the starch includes: common starch, resistant starch, slowly digestible starch; Optionally, the cereal foods include: bread, steamed bread, rice; Optionally, in an oral simulation device, the food to be tested and the salivary electrolyte stock solution are added with α-amylase, CaCl2 solution and water, and homogenized to obtain an oral simulation chewable material; In the gastric fermentation tank, the oral simulated chewing material and the gastric fluid electrolyte stock solution are mixed, and CaCl2 solution, hydrochloric acid solution and water are added to react to obtain gastric digestive fluid; In the small intestinal fermentation tank, the gastric digestive juice and the intestinal electrolyte stock solution are mixed, and pancreatic enzyme, saccharifying enzyme, CaCl2 solution, sodium hydroxide solution and water are added to react to obtain the small intestinal digestive juice; The dialysis device contains dialysis fluid and a dialysis bag, and the digestive fluid from the small intestine is pumped into the dialysis bag; Optionally, the small intestinal digestive fluid pumping rate in the dialysis device is 80 to 120 mL / h; Optionally, the dialysate is an intestinal electrolyte stock solution.

Images