Screening method of colorectal cancer circulation microRNA marker

Abstract

The invention discloses a method for detecting a colorectal cancer circulation microRNA marker based on a solid nanopore technology, and belongs to the field of molecular detection.The method comprises the following steps that literatures are retrieved in a database, and screening is conducted according to an inclusion standard and an exclusion standard; the method comprises the following steps: extracting diagnostic data of each colorectal cancer circulation marker in literatures, carrying out diagnostic meta analysis, and screening out the colorectal cancer circulation marker with diagnostic performance as a target to be detected; the method comprises the following steps: designing hairpin DNA (deoxyribonucleic acid) H1 and H2, and synthesizing miR-21, miR-21-a, H1-6x, H2-6x, H1-4x, H2-4x, H1-2x and H2-2x; preparing a mother solution from the microRNA dry powder and the hairpin DNA dry powder, diluting the microRNA and hairpin DNA mother solution with a buffer solution, incubating, and cooling to obtain a sample; the method comprises the following steps: dissolving agarose in TAE, heating and melting, adding a coloring agent, standing and solidifying, adding gel into an electrophoresis tank, adding a sample and a DNA marker, and carrying out electrophoresis; the invention provides an effective means for rapid detection and quantitative analysis of microRNA.

Description

Technical Field

[0001] The present invention relates to the field of molecular detection, and in particular to a method for screening circulating microRNA markers for colorectal cancer. Background Art

[0002] Colorectal cancer is a malignant tumor involving the colon, rectum and appendix. It is the third most common cancer in the world. A sedentary lifestyle, being overweight, drinking a lot, smoking, an unhealthy diet and lack of physical activity can easily induce colorectal cancer. The mortality rate of colorectal cancer is high, ranking second among all cancers. Most patients are diagnosed in the middle or late stages, missing the best time for diagnosis and treatment. It is estimated that there will be more than 1.9 million new cases of colorectal cancer and 935,000 deaths worldwide in 2020. Early diagnosis of colorectal cancer can greatly reduce mortality and treatment costs.

[0003] Currently, colonoscopy is considered the gold standard for diagnosing colorectal cancer. Some imaging methods such as CT and MRI can also assist in the diagnosis of colorectal cancer, but their detection costs are high and they are highly invasive. Patient compliance is poor and they are not suitable for large-scale screening. Fecal occult blood test is currently an early screening method for colorectal cancer, but it is not widely accepted due to its low sensitivity and easy false positive results. In recent years, liquid biopsy has become a recognized new source of biomarkers. Biomarkers in human plasma, serum, urine, saliva and other body fluids have been used to diagnose a variety of diseases including tumors. And the detection of biomarkers in blood or other biological fluids has many advantages, such as minimal invasiveness and easy access. Therefore, exploring methods for screening biomarkers in biological fluids is a very valuable study. Summary of the invention

[0004] In view of the deficiencies of the prior art, the present invention proposes a method for screening circulating microRNA markers for colorectal cancer.

[0005] A method for screening circulating microRNA markers for colorectal cancer comprises the following steps:

[0006] Literature on the diagnosis of colorectal cancer using circulating microRNA markers for colorectal cancer was searched in databases and screened according to specific inclusion and exclusion criteria;

[0007] Extract the diagnostic data of various circulating microRNA markers of colorectal cancer in the literature, conduct diagnostic meta-analysis, and screen out circulating microRNA markers of colorectal cancer with diagnostic performance as targets to be detected;

[0008] Design hairpin DNA H1 and H2, synthesize miR-21, miR-21-a, H1-6x, H2-6x, H1-4x, H2-4x, H1-2x and H2-2x; prepare microRNA dry powder and hairpin DNA dry powder into a mother solution, dilute the microRNA and hairpin DNA mother solution with a buffer, incubate, cool down, and obtain a sample;

[0009] Dissolve agarose in TAE, heat to melt, add stain, let stand to solidify, add gel to electrophoresis tank, add the above samples and DNA marker, and perform electrophoresis.

[0010] Preferably, the buffer comprises NaCl, MgCl2 and EDTA.

[0011] Preferably, the specific inclusion criteria include: the source of the test samples in the literature includes any one of serum or plasma, the literature uses two or more microRNAs to diagnose colorectal cancer, the experimental group in the literature is patients diagnosed with colorectal cancer by colonoscopy, the control group in the literature is a population with benign diseases or a healthy population, and the literature can extract sensitivity, specificity, area under the ROC curve, TP, FP, TN and FN related data.

[0012] Preferably, the diagnostic meta-analysis includes evaluating sensitivity, specificity, positive likelihood ratio, negative likelihood, diagnostic odds ratio, AUC value and publication bias.

[0013] Preferably, the incubation temperature is 95°C.

[0014] Preferably, the electrophoresis time is 30 min.

[0015] Preferably, the exclusion criteria include literature published before 2000, literature types being meta-analysis, review, conference, letter to the editor or patent, and literature research subjects being animals or cells.

[0016] Preferably, the incubation time is 5 min.

[0017] Preferably, the stain is GelStain.

[0018] Preferably, the electrophoresis voltage is 120V.

[0019] Compared with the prior art, the present invention has the following advantages:

[0020] The present invention screens out microRNAs with diagnostic value for colorectal cancer by a meta-analysis method. Compared with a single study, a meta-analysis can provide a higher level of evidence and more accurately evaluate the diagnostic value of each microRNA, thereby providing more comprehensive and accurate biomarker information for clinical research. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0022] Figure 1 Screening flow chart;

[0023] Figure 2 This is the gel imaging result of the detection system;

[0024] Figure 3 Schematic diagram of the principle of solid-state nanopore detection of microRNA;

[0025] Figure 4 This is a scanning electron microscope image of the silicon nitride solid-state nanopore prepared in the experiment;

[0026] Figure 5 This is the current signal trajectory diagram of the test solution passing through the solid-state nanopore. DETAILED DESCRIPTION

[0027] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] Example 1 Screening for circulating microRNA markers for colorectal cancer

[0029] (1) Literature on circulating microRNAs for the diagnosis of colorectal cancer was searched in Pubmed, Web of Science, Cochrane library, and Embase databases from the time of database establishment to July 2023. The search was performed using subject terms plus free words. Free words for the subject heading Colorectal Neoplasms include Colorectal Neoplasm, Neoplasm, Colorectal, Neoplasms, Colorectal, Colorectal Tumors, Colorectal Tumor, Tumor, Colorectal, Tumors, Colorectal, Colorectal Cancer, Cancer, Colorectal, Cancers, Colorectal, Colorectal Cancers, Colorectal Carcinoma, Carcinoma, Colorectal, Carcinomas, Colorectal, Colorectal Carcinomas, the free words of the subject heading MicroRNAs include MicroRNA, RNA, Micro, MicroRNA, microRNA, microRNAs, RNA, Small Temporal, Temporal RNA, Small, Small Temporal RNA, stRNA, Primary MicroRNA, MicroRNA, Primary, pri-microRNA, pri microRNA, Primary microRNA, microRNA, Primary, pre-microRNA, premicroRNA, free words of the subject headings Sensitivity and Specificity include Specificity andSensitivity, Sensitivity, Specificity. The free words of the subject heading Diagnosis include Diagnoses, Diagnose, Diagnoses and Examinations, Examinations and Diagnoses, Diagnoses and Examination, Examination and Diagnoses. The free words of the subject heading Serum include Serums, BloodSerum, Serum,Blood, free words for the subject heading Plasma include Plasmas, Blood Plasma, Blood Plasmas, Plasma, Blood, Plasmas, Blood, Fresh Frozen Plasma, Fresh Frozen Plasmas, Frozen Plasma, Fresh, Frozen Plasmas, Fresh, Plasma, Fresh Frozen, Plasmas, Fresh Frozen. ,

[0030] (2) The inclusion and exclusion criteria were used to screen the literature that met the requirements. The inclusion criteria included: ① involving the diagnosis of colorectal cancer by microRNA; ② the test sample source was serum or plasma; ③ the diagnosis of colorectal cancer using two or more microRNAs; ④ the experimental group was patients diagnosed with colorectal cancer by colonoscopy, and the control group was patients with benign diseases or healthy people; ⑤ the article could extract relevant data such as sensitivity, specificity, area under the ROC curve (AUC), TP, FP, TN, FN; ⑥ the language of the literature was English. The exclusion criteria included: ① the sample size was less than 10; ② the publication time was earlier than 2000; ③ the literature type was meta-analysis, review, conference, letter to the editor or patent; ④ the research subjects were animals or cells; ⑤ it was repeated or the full text was not available.

[0031] (3) A total of 15 articles met the requirements. The basic information of the included articles is shown in Table 1.1. The Spearman correlation coefficient was 0.189P=0.499, indicating that there was no heterogeneity caused by threshold effect. The Cochran-Q test value of sensitivity was 52.85, P<0.01, I 2 The value was 73.5%; the Cochran-Q test value of specificity was 59.01, P < 0.01, I 2 The value was 76.3%, which showed that there was heterogeneity caused by non-threshold effect. The random effects model was used to combine the diagnostic indicators.

[0032] Table 1 Basic information of included literature

[0033]

[0034]

[0035]

[0036] (4) The combined diagnostic value results of the 15 articles showed that the combined sensitivity (95% CI) was 0.86 (0.84-0.88), the specificity (95% CI) was 0.86 (0.84-0.88), the positive likelihood ratio (95% CI) was 6.89 (4.99-9.52), the negative likelihood ratio (95% CI) was 0.17 (0.12-0.22), the diagnostic odds ratio (95% CI) was 45.71 (29.17-71.63), and the area under the fitted SROC curve AUC (95% CI) was 0.94 (0.92-0.96). The funnel plot results of bias detection showed that there was no publication bias in the included studies, indicating that microRNA has a high diagnostic value in detecting colorectal cancer.

[0037] (5) Among the 15 articles, 5 articles selected microRNA combinations that included miR-21, so 5 studies on miR-21 were included in the diagnostic meta-analysis. The diagnostic value of the microRNA combination containing miR-21 for colorectal cancer showed that the combined sensitivity (95% CI) was 0.87 (0.82-0.90), the specificity (95% CI) was 0.91 (0.88-0.94), the positive likelihood ratio (95% CI) was 9.00 (6.52-12.41), the negative likelihood ratio (95% CI) was 0.13 (0.06-0.30), the diagnostic odds ratio (95% CI) was 80.54 (28.90-224.46), and the area under the fitted SROC curve AUC (95% CI) was 0.96 (0.94-0.98). The results showed that circulating miR-21 could well distinguish colorectal cancer patients from healthy people. Therefore, miR-21 was selected as the target to be detected in this study.

[0038] Example 2 Hybridization chain reaction amplification of microRNA signal

[0039] (1) Design of hairpin probes: Hairpin DNA H1 and H2 were designed based on the sequence of miR-21 on the NUPACK website (nupack.org), and miR-21, miR-21 with single base mutations, and H1 and H2 with different complementary sequence lengths were synthesized to test the specificity of the detection system. The sequence of H1 is SEQ ID NO: 1: ATCAGACTGATGTTGACCGATAGAGGTCAACATCAGTCTGATAAGCTA; the sequence of H2 is SEQ ID NO: 2:

[0040] TCTATCGGTCAACATCAGTCTGATTAGCTTATCAGACTGATGTTGACC. The sequence information of miR-21, miR-21-a, H1-6x, H2-6x, H1-4x, H2-4x, H1-2x, and H2-2x is shown in Table 2 (corresponding to SEQ ID NOs. 3 to 10, respectively).

[0041] Table 2 Oligonucleotide sequences

[0042]

[0043] (2) Sample pretreatment: Prepare microRNA powder and hairpin DNA powder into 100 μM stock solutions with DEPC water and ultrapure water, respectively. Dilute the microRNA and hairpin DNA stock solutions to 5 μM with 10 mM HEPES buffer (pH 7.2, 0.5 M NaCl, 10 mM MgCl2, 1 mM EDTA). Incubate at 95 °C for 5 min in a PCR instrument, then cool to 25 °C at a rate of -0.1 °C / s and leave for 1 h.

[0044] (3) Detection system configuration

[0045] In 10 mM HEPES, 0.5 M NaCl, 10 mM MgCl2, 1 mM EDTA (pH = 7.2) buffer, the concentrations of miR-21, H1, and H2 were adjusted to 250 nM, 500 nM, and 500 nM, and the reaction was carried out at 4°C overnight.

[0046] (4) 2% agarose gel verification

[0047] Weigh 1g agarose and dissolve it in 50mL 1×TAE. Heat it in a microwave oven until the agarose is completely melted. Let it stand for 1 minute, cool to about 65°C, add 5μL GelStain dye, and shake well. Pour it into the gel mold and let it stand for 30 minutes to solidify. Put the gel into the electrophoresis tank and pour 1×TAE to cover the gel. After adding the sample and 2000bp DNA marker to the sample tank, start the electrophoresis instrument with a voltage of 120V and run the electrophoresis for 30 minutes. After the electrophoresis is completed, take out the gel, place it in the gel imaging system for observation, take pictures and record the electrophoresis results.

[0048] The electrophoresis results are as follows Figure 2As shown, lane 1 is a 2kb DNA marker, lane 2 is miR-21 plus H1-6x plus H2-6x, lane 3 is miR-21-a plus H1-6x plus H2-6x, lane 4 is H1-6x plus H2-6x, lane 5 is miR-21 plus H1-4x plus H2-4x, lane 6 is miR-21-a plus H1-4x plus H2-4x, lane 7 is H1-4x plus H2-4x, lane 8 is miR-21 plus H1-2x plus H2-2x, lane 9 is miR-21-a plus H1-2x plus H2-2x, and lane 10 is H1-2x plus H2-2x. The three combinations of H1 and H2 with different sequences can all stably exist without the addition of microRNA, and almost no hybridization chain reaction is triggered. For the combinations of H1-6x and H2-6x, the addition of miR-21 and miR-21-a will trigger the hybridization chain reaction. For the combinations of H1-2x and H2-2x, it is difficult to trigger the hybridization chain reaction by adding miR-21 and miR-21-a. For the combinations of H1-4x and H2-4x, the addition of miR-21 can trigger the hybridization chain reaction, while the addition of miR-21-a almost does not trigger the hybridization chain reaction. It can specifically identify miR-21 and distinguish single-base variations. Therefore, the H1 and H2 in the final detection solution are H1-4x and H2-4x.

[0049] Example 3 Detection of miR-21 by Silicon Nitride Solid-State Nanopore

[0050] Detection principle reference Figure 3 When there is no target in the sample to be tested, the two hairpin DNAs exist stably and independently, and almost no characteristic current is generated when passing through the hole; when there is a target in the sample to be tested, it will trigger a hybridization chain reaction to produce long double-stranded DNA, and a characteristic current will be generated when passing through the hole, achieving accurate detection of the target miR-21.

[0051] (1) Preparation of silicon nitride solid nanopores

[0052] First, prepare the piranha solution (98% concentrated sulfuric acid and 30% hydrogen peroxide are mixed in a volume ratio of 3:1, and the hydrogen peroxide is added to the concentrated sulfuric acid very slowly and stirred rapidly). Soak the silicon nitride nanopore in the 120°C piranha solution for 15-30 minutes, then rinse the nanopore repeatedly with deionized water, and carefully dry the water on the nanopore silicon wafer with KIMTECH dust-free paper. Then use tweezers to load the nanopore silicon wafer into the Teflon microfluidic device, avoiding touching the center of the silicon wafer to prevent the silicon wafer from breaking. Two fluorinated silicone rubber sealing rings seal the nanopore silicon wafer in the middle, forming two separate fluid pools.

[0053] After the electrolyte is added to the liquid pool, the Ag / AgCI electrodes connected to the Keithley2612A digital source meter are inserted into the liquid pools on both sides of the silicon nitride film. The LabVIEW pulse voltage manufacturing program is opened to continuously apply a constant voltage to both sides of the film. The voltage is gradually increased until the apparent current jumps and solid-state nanopores are formed. The scanning electron microscope image is as follows: Figure 4 shown.

[0054] (2) Via-hole signal acquisition

[0055] The solid nanopore connected liquid pool obtained in the above steps is placed in a Faraday cage, and the Faraday cage is placed on an anti-vibration table to prevent external electromagnetic interference and mechanical vibration from affecting the measurement results. Two Ag / AgCl electrodes are respectively inserted into the liquid pools on both sides of the solid nanopore, connected to the patch clamp amplifier through the patch clamp probe, and the patch clamp is connected to the digital-to-analog converter and connected to the computer. The applied voltage is controlled and the current is monitored and recorded through the visualization software on the computer. Before the sample through-hole detection, the sample is mixed with Tris-KCl buffer (10mM Tris-HCl, 1M KCl, pH 8.0) in a ratio of 1:19, and the capillary sample tube is assembled and connected with a 1mL syringe to add the sample. After the sample is added, the Ag / AgCl electrode is connected to both ends of the fluid pool, and the patch clamp is connected to detect the current at the same time, and then the entire device is placed in an aluminum shielding box. The sampling frequency is 250KHz, the low-pass filter frequency is 10KHz, and the detection voltage is 100-500mV. The visualization software Clampex was used to monitor the current changes in real time. The applied voltage and sample concentration were optimized according to the results to ensure a sufficient signal-to-noise ratio. The visualization software Clampfit was used to observe the characteristics of the obtained current signal. Figure 5 As shown, a negative peak represents a pore-transmitting event of a long double-stranded DNA, enabling accurate detection of miR-21.

[0056] Example 4

[0057] The method for screening circulating microRNA biomarkers for colorectal cancer comprises the following steps:

[0058] (1) Identify the research question: including the study population, disease, or condition.

[0059] (2) Establish search methods: Search for articles on microRNA diagnosis of colorectal cancer from English and Chinese databases. Use keywords and subject terms for the search.

[0060] (3) Establish inclusion and exclusion criteria: determine which studies will be included in the analysis and which will be excluded.

[0061] (4) Data extraction: The following information was extracted from the screened literature: first author and publication year, country, sample size, microRNA type, sensitivity, specificity, area under the ROC curve (AUC), TP, FP, TN, and FN.

[0062] (5) Quality evaluation: The quality of the literature was evaluated using the QUADAS-2 tool.

[0063] (6) Heterogeneity test: Cochran-Q test was used and I was calculated 2 Quantitative assessment of heterogeneity.

[0064] (7) Meta-analysis: The data were subjected to diagnostic meta-analysis using the statistical analysis software Meta-disc 1.4 and RevMan 5.4 to evaluate sensitivity, specificity, positive likelihood ratio (PLR), negative likelihood ratio (NLR), diagnostic odds ratio (DOR), AUC value, and publication bias.

[0065] (8) Subgroup analysis: All subject data were divided into different subgroups based on the region, sample number, and sample source to analyze the source of heterogeneity.

[0066] In step (1), included studies need to distinguish patients diagnosed with colorectal cancer from healthy controls by plasma / serum microRNA combination levels.

[0067] In the step (2), literature was retrieved through the English databases Pubmed, Web of Science, Cochrane library, and Embase, and the retrieval time was from the establishment of the database to July 2023.

[0068] In the step (2), the free words related to the subject words are searched using the MeSH database of NCBI, and the literature database is searched in the form of subject words plus free words.

[0069] In step (3), the inclusion criteria include: ① involving the diagnosis of colorectal cancer through microRNA; ② the source of the test sample is serum or plasma; ③ two or more microRNAs are used to diagnose colorectal cancer; ④ the experimental group is patients diagnosed with colorectal cancer by colonoscopy, and the control group is people with benign diseases or healthy people; ⑤ the article can extract relevant data such as sensitivity, specificity, area under the ROC curve, TP, FP, TN, FN, etc.; ⑥ the language of the literature is English.

[0070] TP is the number of people who are actually sick and correctly diagnosed as positive, FP is the number of people who are actually healthy but misdiagnosed as sick, TN is the number of people who are actually sick but misdiagnosed as healthy, and FN is the number of people who are actually healthy and correctly diagnosed. Sensitivity = TP / (TP+FN), which represents the ratio of people who are actually sick (positive) to those who are correctly diagnosed as sick (positive), and specificity = TN / (TN+FP), which represents the ratio of people who are actually healthy (negative) to those who are diagnosed as healthy (negative). TP, FP, TN, and FN can be estimated based on the number of colorectal cancer patients, the number of healthy people, sensitivity, and specificity.

[0071] In step (3), the exclusion criteria include: ① the sample size is less than 10; ② the publication time is earlier than 2000; ③ the literature type is meta-analysis, review, conference, letter to the editor or patent, etc.; ④ the research object is animals or cells; ⑤ duplication or inability to obtain the full text.

[0072] In step (5), the QUADAS-2 quality assessment form mainly includes four parts: Patient Selection, which assesses whether the selection of cases in the study may be biased; Index Test, which is used to assess whether the execution and result interpretation of the diagnostic test to be evaluated are biased; Reference Standard, which is used to assess whether the test as the diagnostic "gold standard" is properly performed and interpreted; Case Flow and Timing, which is used to assess the case flow, including the execution time points of the diagnostic test and the reference standard. Each part includes an assessment of the risk of bias, and the first three parts also include an assessment of clinical applicability. The assessor answers "yes", "no" or "uncertain" based on the landmark questions in the study design to determine the level of bias risk. If the answer to all landmark questions is "yes", it can be assessed as a low risk of bias; if the answer to any question is "no", there may be a risk of bias; "uncertain" means that it is difficult to make a judgment due to insufficient information.

[0073] In step (6), the Cochran-Q test is used and I is calculated. 2 The Cochran-Q test is a statistical method used to assess the heterogeneity between the results of multiple independent studies. It is based on the chi-square distribution and is used to test the homogeneity of research results. If the test result is significant, it indicates that there is significant heterogeneity between the studies. where w i is the weight of the ith study, is the average of all study weights, and k is the number of studies. The degree of freedom is equal to the number of studies minus 1. The calculated Q value is compared with the critical value of the corresponding degree of freedom in the chi-square distribution table. If the Q value is greater than the critical value, the homogeneity hypothesis is rejected and heterogeneity is considered to exist. 2 The statistic is an indicator to measure the size of heterogeneity, and its calculation formula is: i 2 The value ranges from 0% to 100%, usually: 0% indicates no heterogeneity, 25% indicates low heterogeneity, 50% indicates moderate heterogeneity, 75% indicates high heterogeneity, and 100% indicates very large heterogeneity. 2 If the P value is less than or equal to 0.05 or i 2 If the value exceeds 50%, it indicates that there is great heterogeneity among the studies. In this case, a random effects model should be selected and the reasons for this heterogeneity should be further explored.

[0074] In step (7), PLR is the likelihood ratio of a positive result of a diagnostic test, that is, the ratio of the probability that the patient is actually ill to the probability that an actually healthy person is misdiagnosed as ill. It reflects the possibility that the patient is actually ill when the test result is positive. In contrast to PLR, NLR is the likelihood ratio of a negative result of a diagnostic test, reflecting the possibility that the patient is actually disease-free when the test result is negative. DOR is the ratio of PLR to NLR, and is used to measure the overall effectiveness of a diagnostic test. The larger the DOR value, the better the diagnostic performance of the test. The AUC value refers to the area under the receiver operating characteristic curve (ROC), which is used to evaluate the accuracy of a diagnostic test. An AUC value close to 1 indicates that the test has a high accuracy, while an AUC value close to 0.5 indicates that the accuracy of the test is comparable to random guessing.

[0075] In step (7), publication bias is tested by Egger test, which is performed by checking the symmetry of the funnel plot. Ideally, the funnel plot should be symmetrical, indicating that there is no publication bias. If the regression coefficient is significantly different from zero (P<0.05), it indicates that there is publication bias.

[0076] Example 5

[0077] The method for detecting target microRNA based on solid-state nanopore specifically comprises the following steps:

[0078] (1) Design and synthesize hairpin DNA sequences for the target microRNA sequence, and prepare a detection solution to capture the microRNA and trigger the hybridization chain reaction.

[0079] (2) Preparation of silicon nitride solid-state nanopores.

[0080] (3) The target microRNA is added to the detection solution, reacted at 4°C overnight, dissolved in 1 M KCl solution, and detected using a solid-state nanopore detection device.

[0081] In the step (1), hairpin DNA sequences H1 and H2 are designed by NUPACK software. The hairpin DNA is a single-stranded DNA, and its sequence is self-complementary. The secondary structure consists of a long stem, a loop, and a short stem. The long stem sequence of H1 is complementary to the loop plus the short stem sequence of H2, and the loop plus the short stem sequence of H1 is complementary to the long stem sequence of H2. However, due to the existence of the hairpin structure, H1 and H2 can stably exist independently in the solution. The long stem sequence of H1 is also complementary to the sequence of the target microRNA. When the target microRNA is added to the detection system, it can bind to H1 to open the hairpin structure of H1 and trigger a hybridization chain reaction.

[0082] In the step (1), before use, the microRNA powder is prepared into 100 μM with DEPC water. The DNA powder is prepared into 100 μM with ultrapure water, and each hairpin DNA is diluted to 5 μM using 10mM HEPES, 0.5M NaCl, 10mM MgCl2, 1mM EDTA (pH = 7.2) buffer. Incubate at 95°C for 5 minutes to open the hairpin structure, then cool to 25°C at a rate of -0.1°C / s and leave for 1 hour to produce a stable hairpin structure. The final detection solution is 10mM HEPES, 0.5M NaCl, 10mM MgCl2, 1mM EDTA (pH = 7.2) buffer containing 500nM hairpin DNA H1 and H2.

[0083] In step (2), the steps for preparing the solid-state nanopore are as follows: first prepare a piranha solution (98% concentrated sulfuric acid and 30% hydrogen peroxide are mixed in a volume ratio of 3:1, and the hydrogen peroxide is added to the concentrated sulfuric acid very slowly and stirred rapidly), and the silicon nitride nanopore is placed in a 120°C piranha solution and soaked for 15-30 minutes, and then the nanopore is repeatedly rinsed with deionized water, and the water on the nanopore silicon wafer is carefully absorbed with KIMTECH dust-free paper. Then, the nanopore silicon wafer is loaded into the Teflon microfluidic device with tweezers to avoid touching the center of the silicon wafer to prevent the silicon wafer from breaking. Two fluorinated silicone rubber sealing rings seal the nanopore silicon wafer in the middle, forming two separate fluid pools.

[0084] After the electrolyte is added to the liquid pool, the Ag / AgCI electrodes connected to the Keithley2612A digital source meter are inserted into the liquid pools on both sides of the silicon nitride film respectively. The LabVIEW pulse voltage manufacturing program is opened to continuously apply a constant voltage to both sides of the film. The voltage is gradually increased until the meter current jumps and a solid-state nanopore is formed.

[0085] In the step (3), before the sample through-hole detection, the sample is mixed with Tris-KCl buffer (10mM Tris-HCl, 1M KCl, pH 8.0) at a ratio of 1:19 and added to one end of the fluid pool. The driving voltage is 100-500mV, the sampling frequency is 250KHz, the low-pass filter frequency is 10KHz, and the through-hole event is identified according to the amplitude and duration of the characteristic current.

[0086] In the description of this specification, the description with reference to the terms "one embodiment", "example", "specific example", etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner.

[0087] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, and these changes and improvements all fall within the scope of the present invention to be protected.

Claims

1. A method for screening circulating microRNA markers for colorectal cancer, characterized in that: The following steps are involved: Literature on the diagnosis of colorectal cancer using circulating microRNA markers for colorectal cancer was searched in databases and screened according to specific inclusion and exclusion criteria; Extract the diagnostic data of various circulating microRNA markers of colorectal cancer in the literature, conduct diagnostic meta-analysis, and screen out circulating microRNA markers of colorectal cancer with diagnostic performance as targets to be detected; Design hairpin DNA H1 and H2, synthesize miR-21, miR-21-a, H1-6x, H2-6x, H1-4x, H2-4x, H1-2x and H2-2x; prepare microRNA dry powder and hairpin DNA dry powder into a mother solution, dilute the microRNA and hairpin DNA mother solution with a buffer, incubate, cool down, and obtain a sample; Dissolve agarose in TAE, heat to melt, add stain, let stand to solidify, add gel to electrophoresis tank, add the above samples and DNA marker, and perform electrophoresis.

2. The method for screening circulating microRNA markers for colorectal cancer according to claim 1, characterized in that: The buffer includes NaCl, MgCl2 and EDTA.

3. The method for screening circulating microRNA markers for colorectal cancer according to claim 1, characterized in that: The specific inclusion criteria include: the source of the test samples in the literature includes any one of serum or plasma, the literature uses two or more microRNAs to diagnose colorectal cancer, the experimental group of the literature is patients diagnosed with colorectal cancer by colonoscopy, the control group of the literature is people with benign diseases or healthy people, and the literature can extract sensitivity, specificity, area under the ROC curve, TP, FP, TN and FN related data.

4. The method for screening circulating microRNA markers for colorectal cancer according to claim 1, characterized in that: The diagnostic meta-analysis included the evaluation of sensitivity, specificity, positive likelihood ratio, negative likelihood, diagnostic odds ratio, AUC value, and publication bias.

5. The method for screening circulating microRNA markers for colorectal cancer according to claim 1, characterized in that: The incubation temperature is 95°C.

6. The method for screening circulating microRNA markers for colorectal cancer according to claim 1, characterized in that: The electrophoresis time is 30 min.

7. The method for screening circulating microRNA markers for colorectal cancer according to claim 1, characterized in that: The exclusion criteria included that the publication time of the literature was earlier than 2000, the literature type was meta-analysis, review, conference, letter to the editor or patent, and the research subjects of the literature were animals or cells.

8. The method for screening circulating microRNA markers for colorectal cancer according to claim 1, characterized in that: The incubation time is 5 min.

9. The method for screening circulating microRNA markers for colorectal cancer according to claim 1, characterized in that: The stain is GelStain.

10. The method for screening circulating microRNA markers for colorectal cancer according to claim 1, characterized in that: The voltage of the electrophoresis is 120V.

Images