Application of intervention B cell miR-330-5p in preparation of medicine for treating SLE (systemic lupus erythematosus)

Abstract

The invention belongs to the technical field of biological medicines, and discloses an application of an intervention B cell miR-330-5p in preparation of a medicine for treating systemic lupus erythematosus (SLE), and a preparation method of the intervention B cell miR-330-5p. According to the invention, the miR-330-5p, the mimic of the miR-330-5p and the expression vector of the miR-330-5p are applied to the preparation of the medicines for preventing and / or treating the SLE and the medicines for inhibiting the activation of B cells in the SLE state. The invention provides a new intervention target for inhibiting B cell activation, and provides a new way and means for treating B cell activation mediated autoimmune diseases.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an application of intervening B cell miR-330-5p in preparing a drug for treating SLE. Background Art

[0002] Systemic lupus erythematosus (SLE) is a typical autoimmune disease, the main feature of which is that the patient's own immune tolerance disorder leads to imbalance of multiple cellular immune responses in the body, such as overactivation of immune cells and production of a large number of autoantibodies, which affect multiple organs and systems and cause disease. In recent years, biological therapies centered on targeting B cell activation, including intervention of B cell surface co-stimulatory molecules and activation factors, interference with signal transduction function in B cells, and even elimination of B cells, are the research focus of ongoing clinical trials. Although it can improve the condition of SLE to a certain extent, its nonspecific interference with B cells often affects the normal immune system, limiting its clinical application.

[0003] B-cell antigen receptor (BCR) is essential for the development and maturation of normal B cells. There are many mechanisms for BCR activation. KRAS is a member of the RAS family and plays an important role in signal transduction and cell cycle control. In the past, the clinical importance of KRAS has always been in the context of cancer. It is believed that it is closely related to the occurrence and development of cancer. Up to 25% of human cancers have mutations in this gene. It plays a key role in B cell development, proliferation and survival. KRAS deficiency can seriously affect the development of B cells. However, with the progress of research, people began to find that KRAS also plays an important role in the progression of immune system diseases such as rheumatoid arthritis and SLE. MicroRNA (miRNA) is a non-coding RNA widely present in eukaryotes. It mainly regulates target gene expression through RNA processing after gene transcription. MiRNA can inhibit the expression of the target gene by complementary binding to the mRNA fragment of the target gene. MiRNA participates in a variety of biological processes, including gene expression, cell differentiation, proliferation, apoptosis, immune regulation, etc. through the regulation of mRNA, and plays an important role in the development of organisms, the occurrence and development of diseases, etc. Since there is currently no safe and effective solution to inhibit abnormal activation of B cells in SLE patients, there is an urgent need to explore new targets for the treatment of SLE to develop safe and effective new drugs and provide new ideas for the treatment of SLE. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings of the prior art and provide an application of intervening B cell miR-330-5p in the preparation of a drug for treating SLE.

[0005] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0006] In a first aspect, the present invention uses miR-330-5p in the preparation of a drug for preventing and / or treating SLE.

[0007] In a second aspect, the present invention uses miR-330-5p mimics in the preparation of drugs for preventing and / or treating SLE.

[0008] The third aspect is the use of the expression vector of miR-330-5p in the preparation of a drug for preventing and / or treating SLE.

[0009] As a preferred embodiment of the application of the present invention, the miR-330-5p, or the mimic, or the expression vector is overexpressed in B cells; the miR-330-5p targets and inhibits KRAS in B cells.

[0010] In a fourth aspect, the present invention uses miR-330-5p in the preparation of a drug for inhibiting B cell activation in SLE.

[0011] In a fifth aspect, the present invention uses a miR-330-5p mimic in the preparation of a drug for inhibiting B cell activation in SLE.

[0012] In a sixth aspect, the present invention uses an expression vector of miR-330-5p in the preparation of a drug for inhibiting B cell activation in SLE.

[0013] B cells play a key role in SLE. B cells can produce a large number of autoantibodies, which can affect multiple organs and systems and cause disease, exacerbating the progression of SLE. The present invention uses B cells as the research object, and finds that KRAS expression is enhanced in activated B cell lines (U266 and Raji) and SLE patient B cells, while miR-330-5p expression is weakened in SLE patient B cells. After overexpressing miR-330-5p (exogenous supply of miR-330-5p) in the B cells of SLE patients' peripheral blood mononuclear cells (PBMCs), they are transplanted into immunodeficient mice to construct a humanized SLE mouse model, and it is found that the disease state of humanized SLE mice can be significantly improved.

[0014] In a seventh aspect, the present invention provides a B cell for preventing and / or treating SLE, wherein the B cell comprises miR-330-5p or its mimics and / or modified miR-330-5p, or a vector comprising miR-330-5p and / or modified miR-330-5p.

[0015] In an eighth aspect, the present invention provides a drug or preparation for preventing and / or treating SLE, the drug or preparation comprising a therapeutically effective dose of miR-330-5p or its mimics and / or modified miR-330-5p, or a vector comprising miR-330-5p and / or modified miR-330-5p, or comprising the B cells.

[0016] As a preferred embodiment of the medicine or preparation of the present invention, it also includes pharmaceutically acceptable excipients.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The present invention confirms that overexpression of B cell miR-330-5p can target and bind to KRAS, inhibit B cell activation, and improve SLE disease progression, providing a new idea for the treatment of SLE disease mediated by B cell activation. MiR-330-5p, miR-330-5p mimics, and miR-330-5p expression vectors can be used to prepare drugs for preventing and / or treating SLE, and drugs for inhibiting B cell activation in SLE. The present invention provides a new intervention target for inhibiting B cell activation, and provides a new approach and means for treating autoimmune diseases mediated by B cell activation. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Diagram of the B cell activation signaling pathway.

[0020] Figure 2 Detection of B cell (U266 and Raji) activation signaling pathway.

[0021] Figure 3 Bioinformatics prediction of miR-330-5p targeting KRAS.

[0022] Figure 4 shows the detection of miR-330-5p targeting and binding to KRAS. Figure 4A Dual luciferase reporter gene plasmid information; Figure 4B Dual luciferase reporter gene validation of miR-330-5p targeting KRAS; P < 0.05 indicates a significant difference, marked with *.

[0023] Figure 5 shows the expression of miR-330-5p and KRAS in B cells of SLE patients. Figure 5A To detect the expression of miR-330-5p in B cells of SLE patients; Figure 5B Detection of KRAS expression in B cells of SLE patients; P<0.05 indicates significant difference, marked with *.

[0024] Figure 6For the plasmid information of knocking down miR-330-5p.

[0025] Figure 7 This is the plasmid information for overexpressing miR-330-5p.

[0026] FIG8 shows the effect of intervention of miR-330-5p on the activation of B cells in SLE patients; in the figure, Fig. 8A Flow cytometry was used to detect the expression level of CD80 after intervention of miR-330-5p in B cells of SLE patients; Figure 8B To statistically analyze the expression level of CD80 after intervention of miR-330-5p in B cells of SLE patients; Figure 8C Flow cytometry was used to detect the expression level of CD86 after intervention of miR-330-5p in B cells of SLE patients; Fig.8D Statistical analysis of CD86 expression levels after intervention of miR-330-5p in B cells of SLE patients; P<0.05 indicates significant difference, marked with *.

[0027] FIG9 shows the effect of intervention of miR-330-5p in B cells of SLE patients on disease progression in humanized SLE mice; Fig. 9A The expression level of anti-nuclear autoantibodies in the plasma of humanized SLE mice; Fig. 9B The expression level of anti-dsDNA autoantibodies in plasma of humanized SLE mice; Fig. 9C The white pulp ratio of spleen in humanized SLE mice; P<0.05 indicates significant difference, marked with *. DETAILED DESCRIPTION

[0028] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. It should be understood by those skilled in the art that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0029] Unless otherwise specified, the experimental methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.

[0030] Example 1: miR-330-5p targets KRAS in the B cell activation signaling pathway

[0031] (1) Construction of B cell (U266 and Raji) activation model

[0032] 1) Prepare complete culture medium (10% FBS, 1% double antibody, RPMI 1640 culture medium) in advance, take out B cell lines (U266 and Raji) from liquid nitrogen, shake quickly in a 37℃ water bath, take out the cryopreservation tube when the contents are completely changed from solid to liquid, wipe dry with gauze, and put it in the clean bench after alcohol disinfection. Quickly transfer the cells in the cryopreservation tube to a 15mL centrifuge tube, resuspend to 5mL with complete culture medium, and centrifuge (300g, 6min, room temperature). Remove the supernatant, resuspend with 2mL PBS, wash, and centrifuge (300g, 6min, room temperature). Remove the supernatant, resuspend with complete culture medium, transfer the cells to a T25 culture flask, culture at 5% CO2, 37℃ for 24h, then change the medium and remove dead cells. When the cell density reaches 80% to 90%, pass it on. Detect cell activity: Take 10μL of B cells in a 200μL Ep tube, add 10μL of trypan blue, mix gently with a 10μL pipette tip, take 10μL to detect cell activity in a counting plate, and continue with subsequent experiments when the cell activity reaches more than 99% and the cell growth state is good under the microscope.

[0033] 2) Anti-IgM (BCR activation pathway, B cell activation level 1 signal in SLE patients), sCD40L (B cell activation costimulator CD40 pathway, B cell activation level 2 signal in SLE patients), and IL-4 (B cell activation level 3 signal in SLE patients) were added to the cell culture medium, where the concentration of anti-IgM was 5 μg / mL, the concentration of sCD40L was 100 ng / mL, and the concentration of IL-4 was 10 ng / mL. After activating B cells (U266 and Raji), they were cultured in a 5% CO2, 37°C incubator for 48 hours to construct an in vitro B cell activation model.

[0034] (2) Detection of KRAS expression in activated B cells (U266 and Raji)

[0035] The B cells activated in step (1) are subjected to the B cell activation pathway (see Figure 1 )Detection:

[0036] 1) RNA extraction using Trizol

[0037] The cells were seeded in a 6-well plate, cultured at 5% CO2 and 37°C for 48 hours. When the cells grew to 80% to 90%, the cells were collected and centrifuged (300g, 6min, room temperature) to remove the supernatant. After washing with PBS, the cells were transferred to a 1.5mL Eppendorf tube and centrifuged (300g, 6min, room temperature) to remove the supernatant. 6Add 1mL RNAiso Plus to each cell and let stand at room temperature for 10min. Add BCP at a ratio of RNAiso Plus: BCP = 5:1, vortex vigorously for 15s, mix thoroughly, and let stand for 5min. Centrifuge, 15000g, 4℃, 20min. After centrifugation, obvious stratification can be seen. Use a pipette tip to gently draw about 400μL of the upper transparent aqueous phase into a new 1.5mL Eppendorf tube (be careful to avoid drawing the middle white film layer). Add isopropanol at a ratio of transparent aqueous phase: isopropanol = 1:2, and mix by inverting. Let stand at 4℃ for 30min. Centrifuge, 15000g, 4℃, 20min. Remove the supernatant, add 500μL of 75% alcohol pre-cooled at 4℃ in advance, and gently blow to float the precipitate. Centrifuge, 15000g, 4℃, 20min. Repeat the steps once. Remove the supernatant, place the EP tube in a clean bench to air dry, and resuspend with 25μL DEPC water. Measure the concentration.

[0038] 2) mRNA reverse transcription

[0039] Kit: TAKARA Prime Script TM RT reagent Kit with gDNA Eraser (PerfectReal Time)

[0040] The mRNA reverse transcription system is shown in Table 1:

[0041] Table 1 Reaction system for removing genomic DNA

[0042] Reagents volume 5×gDNA Eraser Buffer 2.0μL gDNA Eraser 1.0μL Total RNA 0μL~7μL <![CDATA[RNase Free dH2O]]> Up to 10μL

[0043] Reaction conditions: 42°C, 2 min, 4°C;

[0044] In a 10 μL system, the amount of RNA should not exceed 1 μg.

[0045] Table 2 Reaction system for mRNA reverse transcription

[0046] Reagents volume Genomic DNA removal reaction solution 10.0μL PrimeScript RT Enzyme Mix I 1.0μL RT Primer Mix 1.0μL 5×PrimeScript Buffer 2(for Real Time) 4.0μL RNase Free dH2O 4.0μL

[0047] Reaction conditions: 37°C, 15 min; 85°C, 5 s; 4°C.

[0048] 3) qPCR

[0049] Kit: TB Green Premix Ex Taq II (Tli RNaseH Plus), TB green dye method qPCR reaction system is as follows:

[0050] Table 3 qPCR reaction system

[0051] Reagents Final concentration volume TB Green Premix Ex Taq II(Tli RNaseH Plus)(2×) 1× 5μL PCR Forward primer (10 μM) 0.4μM 0.4μL PCR Reverse primer (10 μM) 0.4μM 0.4μL RT reaction solution 1μL RNAse Free dH2O Up to 10μL

[0052] Reaction conditions: first stage, pre-denaturation (1 cycle), 94°C, 30s; second stage, qPCR reaction (40 cycles), 95°C, 5s denaturation; 60°C, 20s annealing and extension.

[0053] 4) Primer sequence

[0054] Table 4 Primer sequences

[0055]

[0056]

[0057] The experimental results are shown in Figure 2 , KRAS expression in activated B cells (U266 and Raji) was significantly increased.

[0058] (3) Targeted detection of miR-330-5p combined with KRAS

[0059] 1) Predict the target genes of miR-330-5p through bioinformatics databases such as miRDB, miRTar-Base, and TargetScan. Taking TargetScan as an example, the details are as follows: open the Targetscan website, select the corresponding species, fill in the gene name, enter the miRNA name; click submit, the gene has multiple transcripts, select the most commonly used transcript, click ID; call up all predicted miRNA information. The prediction results show that miR-330-5p can bind to the target gene KRAS ( Figure 3 ).

[0060] 2) Synthesize the wild-type target gene, the gene sequence is as follows:

[0061] CCTAATTTTTTTCCTGCTCCATGCAGACTGTTAGCTTTTACCTTAAATGC

[0062] TTATTTTAAAATGACAGTGGAAGTTTTTTTTTCCTCTAAGTGCCAGTATTCC

[0063] CAGAGTTTTGGTTTTTGAACTAGCAATGCCTGTGAAAAAGAAACTGAATAC

[0064] CTAAGATTTCTGTCTTGGGGGCTTTTGGTGCATGCAGTTGATTACTTCTTATTT

[0065] T;

[0066] The mutant target gene was synthesized, and the gene sequence is as follows:

[0067] CCTAATTTTTTTCCTGCTCCATGCAGACTGTTAGCTTTTACCTTAAATGC

[0068] TTATTTTAAAATGACAGTGGAAGTTTTTTTTTCCTCTAAGTGCCAGTATTAA

[0069] ACTCTTTTTGGTTTTTGAACTAGCAATGCCTGTGAAAAAGAAACTGAATAC

[0070] CTAAGATTTCTGTCTTGGGGGCTTTTGGTGCATGCAGTTGATTACTTCTTATTT

[0071] T;

[0072] The dual fluorescence reporter plasmid GV272 was purchased from Shanghai GeneCare Gene Medical Technology Co., Ltd. (see the plasmid map for details). Figure 4A ); the wild-type target gene and mutant target gene fragments were connected to the dual fluorescence reporter plasmid to construct recombinant vectors, which were respectively denoted as WT (KRAS-WT-3'-UTR) and MUT (KRAS-MUT-3'-UTR).

[0073] B cells were evenly seeded in a 24-well cell culture plate, cultured statically with RPMI 1640 culture medium containing 10% fetal bovine serum, and transiently transfected with Lipofectamine 2000. The experiment was divided into 4 groups: WT+miR-330-5p mimics group, WT+mimics negative control group, MUT+miR-330-5p mimics group, and MUT+mimics negative control group. 48 hours after B cell transfection, the activities of Renilla luciferase and firefly luciferase were detected, and the relative luciferase activity values ​​were calculated. Dual-Luciferase Reporter Assay System kit was used for dual luciferase reporter gene detection. The transfected B cells were removed from the incubator, 75 μL of the original culture medium was left (the rest of the culture medium was discarded), and 75 μL of Luciferase Reagent, mix well, incubate for 10 minutes to allow cells to fully lyse. Transfer the lysate to a 96-well plate and detect firefly fluorescence in a multifunctional microplate reader. Then add 75 μL of Stop&Glo Reagent, mix well, incubate for 10 minutes, and detect Renilla fluorescence. The ratio of the two test results represents the relative fluorescence intensity of each well sample. The negative control of each group is 1, and the relative fluorescence intensity of the mimics group is obtained and statistically analyzed.

[0074] The experimental results are shown in Figure 4B Compared with the wild-type plasmid (KRAS-WT-3'-UTR) + miR-NC group, the relative expression of luciferase in the wild-type plasmid (KRAS-WT-3'-UTR) + miR-330-5p group was significantly reduced, and the difference was statistically significant (P < 0.001), indicating that miR-330-5p can bind to the 3'-UTR of wild-type KRAS and inhibit its expression; however, there was no significant difference in the relative expression of luciferase between the mutant plasmid (KRAS-MUT-3'-UTR) + miR-NC group and the mutant plasmid (KRAS-MUT-3'-UTR) + miR-330-5p group, indicating that miR-330-5p cannot bind to the 3'-UTR of mutant KRAS. The above results indicate that miR-330-5p can target and bind to KRAS and inhibit its expression.

[0075] Example 2: B cells of SLE patients highly express KRAS and low express miR-330-5p

[0076] Clinical blood specimens were obtained from patients diagnosed with SLE in the Affiliated Hospital of Guangdong Medical University from September 2023 to November 2024. Healthy volunteers were recruited and peripheral blood was drawn for the isolation of human peripheral blood B cells. The present invention was reviewed and approved by the Ethics Committee of the Affiliated Hospital of Guangdong Medical University. The diagnosis of all enrolled SLE patients met the American College of Rheumatology (ACR) classification criteria revised in 1997; patients with concurrent infections, hepatitis B, allergic diseases, rheumatoid arthritis and other autoimmune diseases, tumors and other serious systemic diseases were excluded.

[0077] (1) B cell extraction from SLE patients

[0078] Extraction with PBS containing 2% FBS. Place the peripheral blood of SLE patients in the EDTA anticoagulation tube in a 50mL centrifuge tube, add PBS containing 2% FBS at a ratio of peripheral blood: PBS containing 2% FBS = 1:1, and mix thoroughly. Place the lymph separation fluid in a 50mL lymphatic tube, and slowly add the mixed solution in step 2) on top of the lymph separation fluid at a ratio of lymph separation fluid: peripheral blood: PBS containing 2% FES = 1:1:1 with a 1mL pipette tip. Centrifuge, 800g, 20min, room temperature. After centrifugation, remove the upper plasma, take the cloud layer of peripheral blood mononuclear cells (PBMC) in a new 50mL centrifuge tube, and add 4 times the system of PBS containing 2% FBS to wash. Centrifuge, 3000rpm, 10min, room temperature, remove platelets. Remove the supernatant and continue to resuspend and wash with PBS containing 2% FBS. Centrifuge, 1200rpm, 10min, room temperature. Remove the supernatant, resuspend the PBMC in 1mL-1.5mL PBS containing 2% FBS, and place in a 5mL flow cytometry tube. Count and adjust the cell concentration to 5×107 cells / mL, add 50μL Cocktail Enhancer and Isolation Cocktail per mL, let stand at room temperature for 7 minutes, and then add RapidSpheres TM (Vortex for 15 seconds in advance). TM Resuspend the cell culture medium to 2.5 mL in Buffer, immediately place the flow tube in a magnet, let it stand for 3 min, pour the liquid into a new flow tube, continue to place it in the magnet and let it stand for 1 min, and finally get the B cells. Centrifuge at 300g for 6 min at room temperature. Remove the supernatant and resuspend with 1 mL of culture medium.

[0079] Count and detect cell activity: Take 10 μL of B cells in a 200 μL Ep tube, add 10 μL of trypan blue, mix gently with a 10 μL pipette tip, take 10 μL in a counting plate to count and detect cell activity, and continue with subsequent experiments when the cell activity reaches more than 95%.

[0080] (2) Detection of KRAS and miR-330-5p in B cells of SLE patients

[0081] 1) The SLE patient B cells in (1) above were subjected to qPCR detection. The experimental method was similar to that in Example 1, step (2).

[0082] The experimental results are shown in Figure 5. B cells of SLE patients highly express KRAS and lowly express miR-330-5p. The above results indicate that miR-330-5p may be a potential target for the treatment of SLE.

[0083] Example 3: Intervention of miR-330-5p can inhibit B cell activation in SLE patients

[0084] (1) Preparation of knockdown and overexpression plasmids for miR-330-5p: The knockdown and overexpression plasmids for miR-330-5p were purchased from Guangzhou Aiji Biotechnology Co., Ltd. The plasmid map for knockdown miR-330-5p is shown in Figure 6 , the plasmid map of overexpressing miR-330-5p is shown in Figure 7 .

[0085] (2) Electroporation of SLE patient B cells: Take 10 μl of celetrix electroporation solution A and electroporation solution B, mix thoroughly, add SLE patient B cells, and then add 2 μg / uL knockdown and overexpression plasmids of miR-330-5p, respectively, and mix evenly. Then add the mixed solution to a 20 μL electroporation tube, place the electroporation tube in the electroporation instrument, and set the electroporation parameters to 850 V and a duration of 20 ms.

[0086] (3) The SLE patient B cells with knockdown and overexpression of miR-330-5p prepared in the above Example (2) were cultured for 24 hours.

[0087] (4) Flow cytometry to detect B cell activation level:

[0088] 1) Extract the cultured B cells, add extracellular staining antibodies (see the table below), incubate at 4°C for 30 minutes in the dark, and then wash twice with PBS.

[0089] Table 5 Staining antibodies and incubation system

[0090] Staining Antibodies Incubation system CD19 FITC (BD Biosciences, USA) 5μL / 100μL system CD80PE (BD Biosciences, USA) 5μL / 100μL system CD86BB700 (BD Biosciences, USA) 5μL / 100μL system

[0091] 2) Flow cytometric analysis: The samples were resuspended in 200 μL PBS (BD Biosciences, USA) and detected using a BD FACS Celesta flow cytometer (BD Biosciences, USA).

[0092] The experimental results are shown in Figure 8. The expression of CD80 and CD86 in the B cells of SLE patients in the miR-330-5p overexpression group was significantly lower than that in the control group and the miR-330-5p knockdown group. The above results indicate that overexpression of miR-330-5p in the B cells of SLE patients inhibits B cell activation.

[0093] Example 4: Intervention of miR-330-5p in B cells of SLE patients improves disease progression in humanized SLE mice

[0094] (1) Construction of humanized SLE mouse model

[0095] 1) NKG immunodeficient mice aged 4-6 weeks were purchased from Saiye Biotechnology Co., Ltd. and randomly divided into B cell miR-330-5p knockdown group (miR-330-5p KD ), B cell miR-330-5p overexpression group (miR-330-5p OE ) and SLE patient PBMC transplantation control group (Control). All the above groups were transplanted by mouse tail vein injection, and the number of transplanted cells was 1×10 7 cells / only.

[0096] 2) Peripheral blood was extracted from SLE patients, PBMCs were isolated, and B cells were obtained (reference example 2). The isolated B cells were knocked down and overexpressed miR-330-5p (reference example 3), respectively, and then mixed with PBMCs without B cells, and injected into NKG immunodeficient mice through the tail vein to construct a humanized SLE mouse model.

[0097] (2) Disease evaluation in humanized SLE mice:

[0098] 1) The anti-nuclear Ab and anti-dsDNA Ab in the plasma of humanized SLE mice were detected using Roche cobas fully automatic biochemical analyzer.

[0099] 2) Pathological evaluation of spleen in humanized SLE mice: Dewaxing: Place the slides in xylene I for 20 min and in xylene II for 20 min; Place the slides in anhydrous ethanol I for 5 s and in anhydrous ethanol II for 5 s → 95% alcohol I for 5 s and in 95% alcohol II for 5 s → Wash with water for 15 s; Place the slides in suberin stain solution for 2 min → Wash with water for 15 s×2 → 1% hydrochloric acid alcohol stain for 3 s → Wash with water for 15 s → 1% ammonia water stain for 3 s → Wash with water for 15 s; Place the slides in eosin stain solution for 2 min → Wash with water for 15 s → anhydrous ethanol for 2 s → Bake dry, seal with neutral resin; Take pictures.

[0100] The experimental results are shown in Figure 9. Compared with the control group and the miR-330-5p knockdown group, the plasma autoantibodies anti-nuclear Ab and anti-dsDNA Ab of humanized SLE mice in the miR-330-5p overexpression group were significantly reduced, and the proportion of spleen white pulp (WP) was significantly reduced. The above results show that overexpression of miR-330-5p in B cells of SLE patients improves the disease progression of humanized SLE mice.

[0101] In summary, KRAS expression is enhanced in activated B cell lines (U266 and Raji) and B cells of SLE patients, while miR-330-5p expression is weakened in B cells of SLE patients. Bioinformatics prediction showed that miR-330-5p can target and bind to KRAS and inhibit the activation of B cells. After overexpressing miR-330-5p in the peripheral blood PBMCs of SLE patients, B cells were transplanted into immunodeficient mice to construct a humanized SLE mouse model, and it was found that the disease state of humanized SLE mice could be significantly improved. The present invention confirms that overexpressing B cell miR-330-5p can target and bind to KRAS, inhibit B cell activation, and improve SLE disease progression, providing a new idea for the treatment of SLE diseases mediated by B cell activation.

[0102] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. Application of miR-330-5p in the preparation of drugs for preventing and / or treating SLE.

2. Use of miR-330-5p mimics in the preparation of drugs for preventing and / or treating SLE.

3. Use of the expression vector of miR-330-5p in the preparation of drugs for preventing and / or treating SLE.

4. The use according to any one of claims 1 to 3, characterized in that: The miR-330-5p, or the mimic, or the expression vector is overexpressed in B cells; the miR-330-5p targets and inhibits KRAS in B cells.

5. Application of miR-330-5p in the preparation of drugs for inhibiting B cell activation in SLE.

6. Application of miR-330-5p mimics in the preparation of drugs for inhibiting B cell activation in SLE.

7. Use of miR-330-5p expression vector in the preparation of drugs for inhibiting B cell activation in SLE.

8. A B cell for preventing and / or treating SLE, characterized in that: The B cells contain miR-330-5p or its mimics and / or modified miR-330-5p, or a vector containing miR-330-5p and / or modified miR-330-5p.

9. A drug or preparation for preventing and / or treating SLE, characterized in that: The medicine or preparation comprises a therapeutically effective dose of miR-330-5p or its mimics and / or modified miR-330-5p, or a vector comprising miR-330-5p and / or modified miR-330-5p, or comprises the B cell according to claim 5.

10. The drug or preparation according to claim 9, characterized in that Also included are pharmaceutically acceptable excipients.

Images