Myoferlin-targeted 1, 5-diaryl-1, 2, 4-triazole derivatives as well as synthesis and application of Myoferlin-targeted 1, 5-diaryl-1, 2, 4-triazole derivatives

Abstract

The invention discloses a 1, 5-diaryl-1, 2, 4-triazole compound shown as a structural formula I and a structural formula II or a pharmaceutically acceptable salt and a pharmaceutical composition containing the 1, 5-diaryl-1, 2, 4-triazole compound. The invention also discloses application of the compound or the pharmaceutically acceptable salt in preparation of drugs for treating various malignant tumors and related diseases of tumor metastasis. The compounds shown in the formulas I and II can inhibit proliferation, invasion, infiltration and the like of tumor cells such as gastric cancer cells, breast cancer cells, prostate cancer cells, colon cancer cells, liver cancer cells, non-small cell lung cancer cells and bladder cancer cells in a concentration gradient dependent manner, and have the characteristics of high efficiency, low toxicity and the like; the method has a wide application prospect in the biological medicine industry.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to a novel 1,5-diaryl-1,2,4-triazole derivative targeting Myoferlin, its synthesis and application. Background Art

[0002] Cancer, also known as malignant tumor, is one of the leading causes of disease-related death worldwide.

[0003] Tumor metastasis is a complex process: tumor cells are released from the primary tumor site and invade surrounding tissues, enter the blood circulation or lymphatic circulation, are captured by the capillary bed of distant organs, and invade other tissues and organs from the circulatory system, causing organ failure and ultimately causing death of the patient. Molecular targeted drugs are a class of chemical drugs that target oncogenic proteins in cell signaling pathways and treat tumors by regulating signaling pathways that are closely related to the occurrence and development of cancer. Compared with traditional chemotherapy drugs, it has better therapeutic selectivity, more significant effects, and fewer side effects. Therefore, there is an urgent need to find targets for treating tumors and develop targeted drugs that can effectively inhibit tumor metastasis.

[0004] Myoferlin (MYOF) protein belongs to the ferlin membrane protein family. It is closely related to the migration and invasion of tumor cells and is involved in a series of membrane-related functions in cells, including endocytosis and cell membrane repair, vesicle transport, protein recycling, etc. Immunohistochemistry in the human protein atlas shows that MYOF is upregulated to varying degrees in various types of cancer, including melanoma, breast cancer, ovarian cancer, cervical cancer, endometrial cancer, prostate cancer, pancreatic cancer and glioma, and the malignancy of the tumor is positively correlated with the expression of MYOF (www.proteinatalas.org; www.cbioportal.org). In the process of cancer development, cancer cells need to exchange information and substances more frequently with other cells and the surrounding environment, thereby affecting the proliferation, differentiation, invasion and migration of cancer cells. MYOF participates in regulating the expression and distribution of various cancer-related intracellular and extracellular signals by regulating physiological and chemical processes such as vesicle transport, membrane vesicle fusion, and endocytosis and exocytosis, thereby leading to the proliferation and metastasis of cancer cells. Therefore, MYOF plays an important accelerating function in the progression of various cancers. (CIPTA S, et al. Am J Physiol Cell Physiol, 2009, 297(3): C481-2). Studies have shown that MYOF can regulate the local plasma membrane in cancer cells and affect the transport of receptors and proteins on the plasma membrane. The epithelial-mesenchymal transition (EMT) process plays an important role in the metastasis and invasion of cancer. In this process, epithelial cells transfer the ability of cell metastasis and invasion to mesenchymal cells, participating in tissue healing, organ fibrosis, and cancer occurrence (Gu H, et al. Curr Top Med Chem, 2020, 20(17): 1509-15.). It has been reported that knocking down MYOF in MDA-MB-231 cells can inhibit the EMT process of tumor cells, reduce the invasive ability of breast cancer cells, and also downregulate the expression of matrix metalloproteinases (MMPs). Similarly, knocking down MYOF can reverse the EMT process and inhibit breast cancer metastasis (Ruth Li, PLoS ONE 7(6):e39766). In the signaling pathway related to breast cancer and MYOF, high expression of MYOF can regulate the activity of epidermal growth factor receptor, and the co-localization of MYOF and caveolin can regulate the activated epidermal growth factor receptor (EGFR) in cells.

[0005] In view of the important role of MYOF protein in the process of tumor metastasis, MYOF has good target innovation as a potential drug target, and the development of anti-tumor drugs targeting MYOF protein has broad market prospects. As one of the most important physical and chemical properties of drugs, solubility is usually the decisive factor in the oral bioavailability of drugs. In the process of new drug development, the determination and improvement of drug solubility is an indispensable task. At the same time, in the process of drugs passing through the biological membrane in the form of molecules in the gastrointestinal tract and being further absorbed, the water solubility of the drug also plays a vital role in its PK properties. In the present invention, by transforming and modifying the molecular structure of the drug, compared with the disclosed MYOF inhibitor 6y, the water solubility of the MYOF inhibitor can be increased by dozens or even hundreds of times under pH 2.0 and 7.4 (see Appendix). Figure 4 ), significantly improving its physical and chemical properties and enhancing its drugability. Summary of the invention

[0006] The present invention creates a class of small molecule inhibitors containing a five-membered nitrogen-containing heterocycle, which can exert their anti-tumor growth and metastasis effects by targeting the Myoferlin (MYOF) protein. The present invention creatively designs and synthesizes a new class of 1,5-diaryl-1,2,4-triazole structured compounds or derivatives or pharmaceutically acceptable salts or related analogs thereof. After further mechanism studies, the compound of structural formula I of the present invention can specifically bind to the MYOF protein and effectively inhibit the proliferation and migration of tumor cells. At the same time, compared with the existing MYOF inhibitor 6y, the compound of the present invention significantly improves its water solubility under various pH conditions (such as pH 2.0, 7.4 and 9.0) ( Figure 4 ), greatly improving the drugability of the candidate compound. Taking all factors into consideration, the compound of the present invention, i.e., the MYOF inhibitor, is expected to be developed into a potential candidate anti-tumor drug.

[0007] The present invention provides a class of 1,5-diaryl-1,2,4-triazole compounds and related analogs which can be used as anti-tumor lead compounds.

[0008] The present invention provides a pharmaceutical composition, which comprises the 1,5-diaryl-1,2,4-triazole compound or a pharmaceutically acceptable salt thereof, and may also include but not limited to a pharmaceutically acceptable salt and a pharmaceutically acceptable carrier.

[0009] The present invention provides a MYOF inhibitor, which comprises the 1,5-diaryl-1,2,4-triazole compound or a pharmaceutically acceptable salt thereof or the pharmaceutical composition.

[0010] The present invention provides the use of such 1,5-diaryl-1,2,4-triazole compounds and related analogs for preparing drugs for inhibiting related diseases caused by abnormal expression of MYOF.

[0011] The present invention also provides the use of the above-mentioned compound or a pharmaceutical composition containing the above-mentioned compound in the preparation of drugs for treating various malignant tumors, especially breast cancer, lung cancer, liver cancer, prostate cancer, skin cancer, colon cancer, pancreatic cancer, leukemia, ovarian cancer, gastric cancer, bladder cancer, kidney cancer and oral cancer, as well as related cancer metastasis and recurrence.

[0012] The present invention provides a class of 1,5-diaryl 1,2,4-triazole compounds or pharmaceutically acceptable salts thereof, which are represented by the following structural formula I:

[0013]

[0014] Wherein, Ar2 is a nitrogen-containing five-membered heterocyclic ring, and Ar1 and Ar3 are aromatic rings or aromatic heterocyclic rings;

[0015] n is 0-6;

[0016] A, B, D, and E are each independently selected from C or N atoms, and A, B, and E are not C atoms at the same time; A, B, D, and E are not N atoms at the same time;

[0017] F, G are each independently selected from C or N atoms;

[0018] Ar1 and Ar3 are one of the following aromatic rings or aromatic heterocyclic rings: benzene ring, pyridine ring, pyrimidine ring;

[0019] R1 is independently selected from one or more of the following groups: hydrogen, hydroxyl, C1-C3 alkoxy, halogen, C1-C3 alkyl, fluoroalkoxy, fluoroalkyl, carbonyl, cyano, nitro, and deuterated isotopes of hydrogen in alkoxy, etc.;

[0020] R2 is independently selected from one or more of the following groups: hydrogen, hydroxyl, C1-C3 alkoxy, halogen, C1-C3 alkyl, nitro, aldehyde, etc.;

[0021] Furthermore, the 1,5-diaryl 1,2,4-triazole compound or the pharmaceutically acceptable salt thereof, when Ar2 is a nitrogen-containing five-membered heterocyclic ring and Ar3 is a benzene ring, is represented by the following structural formula II:

[0022]

[0023] n is 0-6;

[0024] A, B, D, and E are each independently selected from C or N atoms, and A, B, and E are not C atoms at the same time; A, B, D, and E are not N atoms at the same time;

[0025] Ar1 is one of the following aromatic rings or aromatic heterocyclic rings: benzene ring, pyridine ring, pyrimidine ring;

[0026] R1 is independently selected from one or more of the following groups: hydrogen, hydroxyl, C1-C3 alkoxy, halogen, C1-C3 alkyl, fluoroalkoxy, fluoroalkyl, carbonyl, cyano, nitro, and deuterated isotopes of hydrogen in alkoxy, etc.;

[0027] R2 is independently selected from one or more of the following groups: hydrogen, hydroxy, C1-C3 alkoxy, halogen, C1-C3 alkyl, nitro, aldehyde, etc.

[0028] In the present invention, the pharmaceutically acceptable salt of the 1,5-diaryl 1,2,4-triazole compound is an acid addition salt formed by the 1,5-diaryl 1,2,4-triazole compound and an acid; wherein the acid includes but is not limited to hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, acetic acid, tartaric acid, salicylic acid, citric acid, methanesulfonic acid, p-toluenesulfonic acid, lactic acid, pyruvic acid, maleic acid, succinic acid, and the like.

[0029] Furthermore, the present invention also provides 1,5-diaryl-1,2,4-triazole compounds or pharmaceutically acceptable salts thereof, including but not limited to the following:

[0030] N-(4-(1-1H-pyrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0031] N-(4-(1-1H-pyrazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide;

[0032] N-(4-(1-1H-pyrazolyl)butyl)-3-(3-ethyl-5-(5-methoxy-2-pyrimidinyl)-1-1H-1,2,4-triazolyl)benzamide;

[0033] N-(4-(1-1H-pyrazolyl)butyl)-3-(3-ethyl-5-(4-methyl-2-pyridyl)-1-1H-1,2,4-triazolyl)benzamide;

[0034] N-(4-(1-1H-pyrazolyl)butyl)-3-(5-(4-chloro-2-pyridinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide;

[0035] 3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)-N-(4-(4-fluoro-1-1H-pyrazolyl)butyl)benzamide; 3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)-N-(4-(4-fluoro-1-1H-pyrazolyl)butyl)benzamide;

[0036] N-(4-(4-bromo-1-1H-pyrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0037] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0038] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide;

[0039] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(5-methoxy-2-pyrimidinyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-(methoxy-d3)phenyl)-1-1H-1,2,4-triazolyl)benzamide; -(4-(4-bromo-2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(4,5-dibromo-2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0040] N-(4-(1-1H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0041] N-(4-(1-1H-1,2,3-triazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide;

[0042] N-(4-(4-bromo-1-1H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(1-1H-1,2,4-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0043] N-(4-(1-1H-1,2,4-triazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide;

[0044] N-(4-(2-2H-tetrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0045] N-(4-(2-2H-tetrazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide;

[0046] N-(4-(2-2H-tetrazolyl)butyl)-3-(3-ethyl-5-(5-methoxy-2-pyrimidinyl)-1-1H-1,2,4-triazolyl)benzamide;

[0047] N-(4-(1-1H-tetrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0048] N-(6-(2-2H-1,2,3-triazolyl)hexyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0049] N-(5-(2-2H-1,2,3-triazolyl)pentyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0050] N-(3-(2-2H-1,2,3-triazolyl)propyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0051] N-(2-(2-2H-1,2,3-triazolyl)ethyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0052] N-(2-(1-1H-pyrazolyl)ethyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0053] N-(2-(1-1H-pyrazolyl)ethyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide;

[0054] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(2-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0055] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(3-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0056] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-hydroxyphenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0057] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-nitrophenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-(trifluoromethoxy)phenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(5-(4-aminophenyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide;

[0058] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-fluorophenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0059] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(5-(4-chlorophenyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide;

[0060] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(5-(4-bromophenyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide;

[0061] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-(trifluoromethyl)phenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0062] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-phenyl-1-1H-1,2,4-triazolyl)benzamide;

[0063] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(p-tolyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-ethylphenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0064] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-propylphenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0065] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(5-methoxy-2-pyridinyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(6-methoxy-3-pyridinyl)-1-1H-1,2,4-triazolyl)benzamide.

[0066] The present invention also provides a pharmaceutical composition, which contains the 1,5-diaryl 1,2,4-triazole compound of the present invention, and / or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

[0067] The present invention also provides a MYOF inhibitor, which includes the above-mentioned 1,5-diaryl-1,2,4-triazole compound and / or a pharmaceutically acceptable salt thereof, and may also be or include the pharmaceutical composition.

[0068] In a specific embodiment, the compound of the present invention and / or its pharmaceutically acceptable salt, the MYOF inhibitor, the pharmaceutical composition, etc. are formulated into an injectable fluid, an aerosol, a cream, a gel, a pill, a capsule, a syrup, a transdermal patch or an excipient.

[0069] The present invention also provides the use of 1,5-diaryl-1,2,4-triazole compounds or pharmaceutically acceptable salts thereof, or the pharmaceutical composition or the inhibitor in the preparation of drugs for inhibiting or binding MYOF (myoferlin) protein.

[0070] The present invention also proposes the use of the 1,5-diaryl-1,2,4-triazole compound or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition or the inhibitor in the preparation of anti-tumor drugs.

[0071] The present invention also proposes the use of the 1,5-diaryl-1,2,4-triazole compound or its pharmaceutically acceptable salt, or the pharmaceutical composition or the inhibitor in the preparation of a drug for inhibiting the proliferation, migration and infiltration of tumor cells; wherein the tumor cells include melanoma cells, liver cancer cells, lung cancer cells, prostate cancer cells, breast cancer cells, skin cancer cells, colon cancer cells, pancreatic cancer cells, leukemia cells, ovarian cancer cells, gastric cancer cells, bladder cancer cells, renal cancer cells and oral cancer cells, myeloma, esophageal cancer and head and neck squamous cell carcinoma, etc.

[0072] The present invention also proposes the use of the 1,5-diaryl-1,2,4-triazole compound or its pharmaceutically acceptable salt, or the pharmaceutical composition or the inhibitor in the preparation of a drug for treating malignant tumors; wherein the malignant tumors include melanoma, liver cancer, lung cancer, prostate cancer, skin cancer, colon cancer, pancreatic cancer, breast cancer, leukemia, ovarian cancer, gastric cancer, bladder cancer, kidney cancer, oral cancer, myeloma, esophageal cancer, head and neck squamous cell carcinoma, etc.

[0073] The present invention also proposes the use of the 1,5-diaryl-1,2,4-triazole compound or its pharmaceutically acceptable salt, or the pharmaceutical composition or the inhibitor in the preparation of a drug for treating metastasis and recurrence of malignant tumors; wherein the malignant tumors include liver cancer, lung cancer, prostate cancer, skin cancer, colon cancer, pancreatic cancer, breast cancer, leukemia, ovarian cancer, gastric cancer, bladder cancer, kidney cancer, oral cancer, myeloma, esophageal cancer, head and neck squamous cell carcinoma, etc.

[0074] In the present invention, the 1,5-diaryl-1,2,4-triazole compound or a pharmaceutically acceptable salt thereof, the inhibitor or the pharmaceutical composition can be used alone or in combination with other drugs.

[0075] The present invention also provides a method for preparing the 1,5-diaryl-1,2,4-triazole compounds (HJ001-HJ034, HJ036-HJ045) of the structural formula I and II, and the reaction formula is as follows:

[0076]

[0077] Reagents and reaction conditions: (a) N,N-dimethylformamide, N,N-diisopropylethylamine, 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate, room temperature; (b) dichlorothionyl, methanol, 80°C; (c) acetic acid, 80°C; (d) methanol / water, lithium aluminum hydride, room temperature; (e) potassium carbonate, dimethyl sulfoxide, 60°C; (f) hydrazine monohydrate, ethanol, 40°C.

[0078] n is 0-6; A, B, D, E are each independently selected from C or N atoms, and A, B, E are not C atoms at the same time, and A, B, D, E are not N atoms at the same time; F, G are each independently selected from C or N atoms; Ar1 ​​and Ar3 are one of the following aromatic rings or aromatic heterocycles: benzene ring, pyridine ring, pyrimidine ring; R1 is independently selected from one or more of the following groups: hydrogen, hydroxyl, C1-C3 alkoxy, halogen, C1-C3 alkyl, fluoroalkoxy, fluoroalkyl, carbonyl, cyano, nitro, and deuterated hydrogen in alkoxy, etc.; R2 is independently selected from one or more of the following groups: hydrogen, hydroxyl, C1-C3 alkoxy, halogen, C1-C3 alkyl, nitro, aldehyde, etc.

[0079] The present invention also provides a method for preparing the 1,5-diaryl-1,2,4-triazole compound (HJ035) of the structural formula I and II, and the reaction formula is as follows:

[0080]

[0081] Reagents and reaction conditions: methanol, palladium on carbon, hydrogen, room temperature.

[0082] The beneficial effects of the present invention include: the present invention proposes a class of 1,5-diaryl-1,2,4-triazole compounds or pharmaceutically acceptable salts thereof represented by structural formula I-II and pharmaceutical compositions containing such compounds, and the compounds or pharmaceutically acceptable salts thereof can be used to prepare drugs, inhibitors, etc. for treating various malignant tumors and diseases related to tumor metastasis. In the present invention, by introducing a five-membered heterocyclic ring containing multiple (2-4) nitrogen atoms as the tail linker of the compound, it is found through relevant experimental verification that the water solubility of the target compound can be significantly improved (attached Figure 4 The present invention innovatively proposes a strategy and application of increasing the saturated solubility of a compound in water by introducing a plurality of (2-4) nitrogen atoms into a nitrogen-containing five-membered heterocyclic ring, and brings significant beneficial effects in application.

[0083] The compounds represented by formula I-II of the present invention can inhibit the proliferation, invasion and infiltration of tumor cells such as gastric cancer cells, breast cancer cells, prostate cancer cells, colon cancer cells, liver cancer cells, non-small cell lung cancer cells and bladder cancer cells in a concentration gradient-dependent manner, have high efficiency and low toxicity, and have broad application prospects in the biopharmaceutical industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0084] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without paying any creative work.

[0085] Figure 1 These are the test results of the antiproliferative activities of the compounds HJ001, HJ009, HJ021, HJ032 and HJ037 of the present invention in cells with high or low MYOF expression, respectively.

[0086] Figure 2 It is a schematic diagram of the inhibition of the clone formation of cancer cells by the compound HJ001 of the present invention.

[0087] Figure 3 It is a schematic diagram of the inhibition of cancer cell migration by the compound HJ001 of the present invention.

[0088] Figure 4 These are the results of the solubility tests in water of multiple compounds including compound HJ001 in the present invention.

[0089] Figure 5 This is a schematic diagram of detecting the binding of the compound HJ001 of the present invention to the MYOF protein through a thermal drift experiment.

[0090] Figure 6 It is a schematic diagram of the sensitivity of the preferred compound HJ001 to gastric cancer cells after knocking out MYOF in the present invention.

[0091] Figure 7 It is a schematic diagram of the inhibition of gastric cancer MKN45 by the preferred compound HJ001 of the present invention in mice. DETAILED DESCRIPTION

[0092] The present invention is further described in detail in conjunction with the following specific examples and drawings, and the protection content of the present invention is not limited to the following examples. Without departing from the spirit and scope of the inventive concept, changes and advantages that can be thought of by those skilled in the art are included in the present invention, and the attached claims are the scope of protection. The process, conditions, reagents, experimental methods, etc. for implementing the present invention, except for the contents specifically mentioned below, are all common knowledge and common common sense in the art, and the present invention does not specifically limit the content.

[0093] 1 H-NMR was measured with a Bruker 500MHz instrument. Unless otherwise specified, all solvents and reagents were not specially treated before use; unless otherwise specified, all reactions were followed by TLC, and all post-treatments were washed with saturated brine and dried over anhydrous sodium sulfate; the purification of products was performed using silica gel (200-300 mesh) column chromatography unless otherwise specified; the silica gel used included 200-300 mesh and GF 254 Produced by Qingdao Ocean Chemical Plant or Yantai Yuanbo Silica Gel Company.

[0094] Example 1: Preparation of each compound

[0095] Example 1-1: N-(4-(1-1H-pyrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0096] Take compound 4-methoxybenzoic acid (760 mg, 5.0 mmol) and propionamidine hydrochloride (640 mg, 6.0 mmol) in N,N-dimethylformamide, under nitrogen atmosphere, add HATU (2.9 g, 7.5 mmol) and DIEA (0.97 g, 7.5 mmol) in an ice bath and stir for 5 min, then change to room temperature (25 ° C) and stir for 8 h. After completion, cool, add compound 3-hydrazinobenzoic acid methyl ester (4.0 g, 10.0 mmol) and glacial acetic acid (3.0 g, 25.0 mmol) and heat to 80 ° C. After reacting for 3 h, cool to room temperature, wash the reaction solution twice with saturated sodium bicarbonate aqueous solution until no bubbles are generated, extract with ethyl acetate, wash the ethyl acetate layer with saturated brine, dry with anhydrous sodium sulfate, and evaporate the organic phase. After column chromatography purification, the compound 3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzoic acid methyl ester was obtained. (1.24 g, yield: 74%): 1H NMR(500MHz,DMSO-d6)δ8.03(s,1H),7.96(d,J=1.9Hz,1H),7.66–7.56(m,2H),7.38(d,J=2.1Hz,2H ),7.37(d,J=2.1Hz,2H),6.97(d,J=2.1Hz,2H),6.95(d,J=2.1Hz,2H),3.87(s,3H),3.77(s,3H),2. 75 (q, J = 7.6 Hz, 2H), 1.31 (t, J = 7.6 Hz, 3H). Take the compound 3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzoic acid methyl ester (337 mg, 1.0 mmol) and dissolve it in 6 mL of methanol. Add LiOH·H2O (168 mg, 4.0 mmol) aqueous solution (1.5 mL) dropwise under nitrogen atmosphere ice bath conditions, and then react at room temperature overnight. Add 3M hydrochloric acid to make it acidic, extract it twice with ethyl acetate, wash the organic phase with water and saturated brine, dry it with anhydrous sodium sulfate, and concentrate it under reduced pressure to obtain the crude product 3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzoic acid with a yield of 94%. Take compound 1H-pyrazole (500mg, 7.3mmol), potassium carbonate (1.2g, 7.5mmol) and dissolve in DMSO (20ml), react at 60℃ for 30min under nitrogen protection, add compound 2-(4-bromobutyl)isoindoline-1,3-dione (2.1g, 7.3mmol), react at 60℃ for 5h and then cool to room temperature, extract the reaction solution with ethyl acetate, wash the ethyl acetate layer with saturated brine, dry it with anhydrous sodium sulfate, and evaporate the organic phase. After column chromatography purification, compound 2-(4-(1H-pyrazol-1-yl)butyl)isoindoline-1,3-dione (843mg, yield: 43%) was obtained: 1HNMR (500MHz,CDCl3)δ7.86(dd,J=5.1,3.7Hz,2H),7.73(d,J=5.0,3.6Hz,2H),7.51(d,J=1.8Hz,1H),7.41(d,J=4.0Hz,1H),6.25(dd,J=2.0Hz,1H),4.21(t,J=7.0,1.6Hz,2H),3.73(t,J=7.1,1.7Hz,2H),1.98–1.89(m,2H),1.75–1.66(m,2H). The compound 2-(4-(1H-pyrazol-1-yl)butyl)isoindoline-1,3-dione (300mg, The product was concentrated under reduced pressure, 1M potassium hydroxide solution and dichloromethane were added for extraction, and the product was dried over anhydrous sodium sulfate. The organic phase was evaporated to dryness to obtain 147 mg of the crude compound 4-(1-1H-pyrazolyl)butan-1-amine. Compound 3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzoic acid (150 mg, 0.6 mmol), HATU (317 mg, 0.8 mmol) and DIEA (241 mg, 0.8 mmol) were placed in a flask, and 3 mL of DMF was injected into the flask at 0°C under nitrogen protection and ice bath. After 5 minutes, 4-(1-1H-pyrazolyl)butan-1-amine (77 mg, 0.6 mmol) was added. After 15 minutes, the ice bath was removed and the product was reacted at room temperature for 3 hours. After extraction with ethyl acetate, the product was concentrated under reduced pressure to obtain the corresponding crude amide product. After column chromatography purification, the product HJ001 (172 mg, yield: 70%) was obtained. 1 H NMR (500MHz, CDCl3) δ7.96–7.87(m,2H),7.55–7.38(m,6H),6.90–6.78(m,3H),6.28(dd,1H),4.22(d,2H),3.83(d,J =2.0Hz,3H),3.52–3.44(m,2H),2.90(q,J=7.5Hz,2H),1.99(dd,J=10.0,4.9Hz,2H),1.67–1.59(m,2H),1.44(t,3H).

[0097] Table 1 Preparation of 1,2,4-triazole compounds shown in Examples 1-2 to 1-45 (HJ002-045)

[0098]

[0099]

[0100]

[0101]

[0102] The following Examples 1-2 to 1-45 provide the preparation methods and product detection results of the compounds HJ002-HJ045 of the present invention. Example 1-2, N-(4-(1-1H-pyrazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide

[0103] Using a method similar to that for preparing compound HJ001, 4-methoxybenzoic acid was replaced with 5-bromopyrimidine-2-carboxylic acid, and compound HJ002 was obtained after column chromatography purification with a yield of 88%: 1H NMR (500 MHz, CDCl3) δ7.96–7.87 (m, 2H), 7.55–7.38 (m, 6H), 6.90–6.78 (m, 3H), 6.28 (dd, 1H), 4.22 (d, 2H), 3.83 (d, J = 2.0 Hz, 3H), 3.52–3.44 (m, 2H), 2.90 (q, J = 7.5 Hz, 2H), 1.99 (dd, J = 10.0, 4.9 Hz, 2H), 1.67–1.59 (m, 2H), 1.44 (t, 3H). Example 1-3, N-(4-(1-1H-pyrazolyl)butyl)-3-(3-ethyl-5-(5-methoxy-2-pyrimidinyl)-1-1H-1,2,4-triazolyl)benzamide

[0104] Using a method similar to that used to prepare compound HJ001, 4-methoxybenzoic acid was replaced with 5-methoxypyrimidine-2-carboxylic acid, and compound HJ003 was obtained after column chromatography purification with a yield of 79%: 1H NMR(500MHz,DMSO-d6)δ8.59(s,3H),7.93–7.83(m,2H),7.70(d,J=2.2Hz,1H),7.54–7.47(m,1H),7.44–7.37(m,2H),6.21(dd,J=2.1Hz,1H),4.1 2(d,J=6.9Hz,2H),3.94(s,3H),3.26(dd,J=6.5Hz,2H),2.79(q,J=7.6Hz,2H),1.78(dd,J=7.1Hz,2H),1.48–1.40(m,2H),1.33(t,J=7.6Hz,3H).

[0105] Example 1-4, N-(4-(1-1H-pyrazolyl)butyl)-3-(3-ethyl-5-(4-methyl-2-pyridyl)-1-1H-1,2,4-triazolyl)benzamide

[0106] Using a method similar to that used to prepare compound HJ001, 4-methoxybenzoic acid was replaced with 4-methylpyridine-2-carboxylic acid, and compound HJ004 was obtained after column chromatography purification with a yield of 78%: 1H NMR (500MHz, CDCl3) δ8.34–8.25(m,1H),7.96–7.82(m,3H),7.55(s,1H),7.51–7.38(m,3H),7.15(s,1H),6.82(s,1H),6.29(dd,J=2.0Hz,1H),4.3 3–4.14(m,2H),3.48(dd,J=5.8Hz,2H),2.98–2.85(m,2H),2.43(s,3H),2 .00(dd,J=7.2Hz,2H),1.64(dd,J=6.9Hz,2H),1.45(t,J=7.6,1.7Hz,3H).

[0107] Example 1-5, N-(4-(1-1H-pyrazolyl)butyl)-3-(5-(4-chloro-2-pyridyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide

[0108] A method similar to that for preparing compound HJ001 was used to replace 4-methoxybenzoic acid with 4-chloropyridine-2-carboxylic acid. Compound HJ005 was obtained after column chromatography purification with a yield of 82%: 1H NMR (500 MHz, CDCl3) δ8.29 (d, J = 5.3 Hz, 1H), 8.09 (d, J = 2.0 Hz, 1H), 7.93 (dd, 2H), 7.57 (d, J = 1.9 Hz, 1H), 7.50 (d, J = 4.7 Hz, 2H), 7.47–7.43 (m, 1H), 7.32–7.29 (m, 1H), 6. .92(s,1H),6.32(d,J=2.4Hz,1H),4.32–4.24(m,2H),3.54–3.43(m,2H),2.96–2.87 (m,2H),2.01(dd,J=7.0Hz,2H),1.65(dd,J=6.6Hz,2H),1.45(t,J=7.7,1.0Hz,3H).

[0109] Example 1-6, 3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)-N-(4-(4-fluoro-1-1H-pyrazolyl)butyl)benzamide

[0110] Using a method similar to that used to prepare compound HJ001, 1H-pyrazole was replaced with 4-fluoro-1H-pyrazole, and compound HJ006 was obtained after column chromatography purification with a yield of 68%: 1H NMR(500MHz, CDCl3)δ7.95(d,J=6.0Hz,2H),7.56–7.46(m,3H),7.42(d,J=7.9Hz ,1H),7.35(d,J=4.2Hz,1H),7.31(d,J=4.7Hz,1H),6.93–6.85(m,2H),6.73(s,1 H),4.22–4.06(m,2H),3.84(d,J=1.6Hz,3H),3.49(q,J=6.2Hz,2H),2.97(q,J=7 .8Hz,2H),1.99–1.91(m,2H),1.62(dd,J=6.8Hz,2H),1.46(t,J=7.6,1.5Hz,3H).

[0111] Example 1-7, 3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)-N-(4-(4-fluoro-1-1H-pyrazolyl)butyl)benzamide

[0112] Using a method similar to that used to prepare compound HJ006, 4-methoxybenzoic acid was replaced with 5-methoxypyrimidine-2-carboxylic acid, and compound HJ007 was obtained after column chromatography purification with a yield of 87%: 1H NMR (500MHz, CDCl3) δ8.83–8.76(m,2H),8.02–7.90(m,2H),7.58–7.48(m,2H),7.38(dd,J=16.4,4.4Hz,2H),6.86(s,1H),4.17(t, J=6.8Hz,2H),3.50(d,J=6.2Hz,3H),3.00(dd,J=7.6Hz,2H),2.02–1.91(m,2H),1.64(dd,J=7.0Hz,2H),1.47(t,J=7.6,1.0Hz,3H).

[0113] Example 1-8, N-(4-(4-bromo-1-1H-pyrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0114] Using a method similar to that used to prepare compound HJ006, 4-fluoro-1H-pyrazole was replaced with 4-bromo-1H-pyrazole, and compound HJ008 was obtained after column chromatography purification with a yield of 86%: 1H NMR(500MHz, CDCl3)δ8.04(d,J=6.7Hz,2H),7.71–7.55(m,3H),7.55–7.39(m,3H),6.93(d,J=8.4Hz,3H),4.19(tt,J=12.3,6.7Hz ,2H),3.86(s,3H),3.51(d,J=6.1Hz,2H),3.09(q,J=7.5Hz,2H),1.97(q,J=7.1Hz,2H),1.67–1.62(m,2H),1.50(t,J=7.5Hz,3H).

[0115] Example 1-9, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0116] Using a method similar to that for preparing compound HJ001, 1H-pyrazole was replaced with 2H-1,2,3-triazole, and compound HJ009 was obtained after column chromatography purification with a yield of 89%: 1H NMR (500MHz, CDCl3) δ7.93–7.85 (m, 2H), 7.63 (d, J = 0.9 Hz, 2H), 7.53–7.39 (m, 4H), 6.87 (d, J = 8.4 Hz, 2H), 6.46 (s, 1H), 4.53 (t, 2H), 3.84 (d, J = 0.9 Hz, 3H), 3.49 (q, J = 6.4 Hz, 2H), 2.92 (dd, J = 7.6 Hz, 2H), 2.08 (dd, J = 6.7 Hz, 2H), 1.48–1.42 (m, 3H).

[0117] Example 1-10, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide

[0118] Using a method similar to that used to prepare compound HJ009, 4-methoxybenzoic acid was replaced with 5-bromopyrimidine-2-carboxylic acid, and compound HJ010 was obtained after column chromatography purification with a yield of 74%: 1H NMR (500MHz, CDCl3) δ8.78(d,J=1.2Hz,2H),7.93–7.89(m,1H),7.87(d,J=1.8Hz,1H),7.62(d,J=1.2Hz,2H),7.55–7.46(m,2H),6.51(s,1H ),4.57–4.50(m,2H),3.50(q,J=6.4Hz,2H),3.24–3.15(m,7H),3.05–2.89(m,4H),2.08(dq,J=14.7,8.2,7.6Hz,3H),1.64(t,J=7.2Hz,3H).

[0119] Example 1-11, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(5-methoxy-2-pyrimidinyl)-1-1H-1,2,4-triazolyl)benzamide

[0120] A method similar to that for preparing compound HJ009 was used to replace 4-methoxybenzoic acid with 5-methoxypyrimidine-2-carboxylic acid. Compound HJ011 was obtained after column chromatography purification with a yield of 69%: 1H NMR (500 MHz, CDCl3) δ8.39 (s, 2H), 7.94–7.85 (m, 2H), 7.62 (s, 2H), 7.54–7.47 (m, 2H), 6.49 (s, 1H), 4.53 (t, J = 6.7 Hz, 2H), 3.96 (s, 3H), 3.50 (td, J = 6.9, 5.2 Hz, 2H), 2.97 (q, J = 7.6 Hz, 2H), 2.13–2.05 (m, 2H), 1.64 (dd, J = 7.0 Hz, 2H), 1.46 (t, J = 7.6 Hz, 3H).

[0121] Example 1-12, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-(methoxy-d3)phenyl)-1-1H-1,2,4-triazolyl)benzoyl

[0122] A method similar to that used to prepare compound HJ009 was used to replace 4-methoxybenzoic acid with 4-methoxy-d3benzenecarboxylic acid. Compound HJ012 was obtained after column chromatography purification with a yield of 78%: 1H NMR (500 MHz, CDCl3) δ7.92–7.84 (m, 2H), 7.63 (d, J = 1.2 Hz, 2H), 7.51–7.38 (m, 4H), 6.92–6.83 (m, 2H), 6.44 (s, 1H), 4.53 (td, J = 6.7, 1.2 Hz, 2H), 3.57–3.43 (m, 2H), 2.90 (q, J = 7.6 Hz, 2H), 2.13–2.03 (m, 2H), 1.66–1.61 (m, 2H), 1.44 (dd, J = 7.6, 1.2 Hz, 3H).

[0123] Example 1-13: N-(4-(4-bromo-2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0124] A similar method to that used to prepare compound HJ009 was used to replace 2H-1,2,3-triazole with 4-bromo-2H-1,2,3-triazole. Compound HJ013 was obtained after column chromatography purification with a yield of 59%: 1H NMR (500MHz, CDCl3) δ7.94–7.88(m,1H),7.88–7.84(m,1H),7.57(d,J=1.2 Hz,1H),7.52–7.47(m,1H),7.47–7.39(m,3H),6.90–6.84(m,2H),6.40(s,1 H),4.51–4.44(m,2H),3.83(d,J=1.3Hz,3H),3.53–3.44(m,2H),2.94–2.84 (m,2H),2.06(dd,J=7.0Hz,2H),1.64(dd,J=7.6Hz,2H),1.49–1.40(m,3H).

[0125] Example 1-14, N-(4-(4,5-dibromo-2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0126] A similar method to that used to prepare compound HJ009 was used to replace 2H-1,2,3-triazole with 4,5-dibromo-2H-1,2,3-triazole. Compound HJ014 was obtained after column chromatography purification with a yield of 83%: 1H NMR (500MHz, CDCl3) δ7.94–7.82(m,2H),7.56–7.40(m,4H),6.88(dd,J=8.8,1.4Hz,2H),6.34(s,1H),4.49–4.43(m,2H),3.84( s,3H),3.51(d,J=6.5Hz,2H),2.92(q,J=7.6Hz,2H),2.05(dd,J=6.9Hz,2H),1.65(d,J=15.2Hz,2H),1.45(t,J=7.6,1.8Hz,3H).

[0127] Example 1-15, N-(4-(1-1H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0128] Using a method similar to that for preparing compound HJ009, compound HJ015 can be obtained at the same time. Compound HJ015 is obtained after column chromatography purification with a yield of 85%: 1H NMR (500MHz, CDCl3) δ8.24(s,1H),8.17(d,J=7.7Hz,1H),7.86(s,2H),7.71(d,J=8.4Hz,2H),7.65–7.59(m,1H),7.48(d,J=8.1Hz,2H),6.91(d,J= 8.4Hz,2H),4.54(s,2H),3.84(d,J=1.2Hz,3H),3.53(d,J=6.0Hz,2H),3. 13(q,J=7.4Hz,2H),2.13–2.04(m,2H),1.71(dd,2H),1.55–1.47(m,3H).

[0129] Example 1-16, N-(4-(1-1H-1,2,3-triazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide

[0130] Compound HJ016 was obtained by a method similar to that of compound HJ010. After purification by column chromatography, compound HJ016 was obtained with a yield of 83%: 1H NMR (500 MHz, CDCl3) δ8.81 (d, J = 1.2 Hz, 2H), 8.50 (s, 2H), 8.40 (s, 1H), 8.19 (d, J = 6.6 Hz, 1H), 7.63 (d, J = 6.4 Hz, 3H), 4.71 (t, J = 7.2 Hz, 2H), 3.54 (s, 2H), 3.11 (q, J = 7.6 Hz, 2H), 2.14 (d, J = 7.4 Hz, 2H), 1.52–1.45 (m, 3H).

[0131] Example 1-17, N-(4-(4-bromo-1-1H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)

[0132] Compound HJ017 was obtained by a method similar to that of preparing compound HJ013. Compound HJ017 was purified by column chromatography with a yield of 80%: 1H NMR (500 MHz, CDCl3) δ7.88 (d, J = 8.8 Hz, 2H), 7.61 (d, J = 1.1 Hz, 1H), 7.55–7.39 (m, 4H), 6.93–6.84 (m, 2H), 6.41 (s, 1H), 4.48–4.41 (m, 2H), 3.84 (d, J = 1.1 Hz, 3H), 3.55–3.47 (m, 2H), 2.91 (q, J = 7.7 Hz, 2H), 2.02 (dd, J = 7.1 Hz, 2H), 1.65 (dd, J = 7.3 Hz, 2H), 1.47–1.40 (m, 3H).

[0133] Example 1-18, N-(4-(1-1H-1,2,4-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0134] A similar method to that used to prepare compound HJ009 was used to replace 2H-1,2,3-triazole with 1H-1,2,4-triazole. Compound HJ018 was obtained after column chromatography purification with a yield of 74%: 1H NMR (500MHz, CDCl3) δ8.18(s,1H),7.99(s,1H),7.91(d,J=6.7Hz,2H),7.55–7.44(m,3H),7.41(d,J=7.9Hz,1H),6.88(d,J=8.5Hz,2H),6.57(s,1H), 4.28(t,J=6.8Hz,2H),3.84(s,3H),3.51(q,J=6.5Hz,2H),2.93(q,J=7.6H z, 2H), 2.01 (p, J = 6.9Hz, 2H), 1.65 (p, J = 7.1Hz, 2H), 1.45 (t, J = 7.6Hz, 3H).

[0135] Example 1-19, N-(4-(1-1H-1,2,4-triazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide

[0136] A method similar to that used to prepare compound HJ018 was used to replace 4-methoxybenzoic acid with 5-methoxypyrimidine-2-carboxylic acid. Compound HJ019 was obtained after column chromatography purification with a yield of 87%: 1H NMR (500 MHz, CDCl3) δ 9.17 (s, 1H), 8.80 (s, 2H), 8.25 (s, 1H), 7.99 (s, 2H), 7.53 (d, J = 4.3 Hz, 2H), 7.00 (s, 1H), 4.40 (s, 2H), 3.53 (s, 2H), 2.92 (q, J = 7.6 Hz, 2H), 2.06 (d, J = 5.7 Hz, 2H), 1.43 (t, J = 7.6 Hz, 3H).

[0137] Example 1-20, N-(4-(2-2H-tetrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0138] A method similar to that for preparing compound HJ001 was used to replace 1H-pyrazole with 1H-tetrazole, and compound HJ020 was obtained after column chromatography purification with a yield of 82%: 1H NMR (500 MHz, CDCl3) δ8.54 (s, 1H), 7.91–7.78 (m, 2H), 7.57–7.37 (m, 4H), 6.93–6.83 (m, 2H), 6.30 (s, 1H), 4.74 (t, J = 6.8 Hz, 2H), 3.84 (s, 3H), 3.52 (dd, J = 6.6 Hz, 2H), 2.91 (q, J = 7.6 Hz, 2H), 2.14 (dd, J = 7.0 Hz, 2H), 1.69–1.64 (m, 2H), 1.44 (t, J = 7.6 Hz, 3H).

[0139] Example 1-21, N-(4-(2-2H-tetrazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1H-1,2,4-triazol-1-yl)benzamide

[0140] A method similar to that used to prepare compound HJ020 was used to replace 4-methoxybenzoic acid with 5-bromopyrimidine-2-carboxylic acid. Compound HJ021 was obtained after column chromatography purification with a yield of 80%: 1HNMR (500 MHz, CDCl3) δ8.79 (s, 2H), 8.53 (d, J = 1.4 Hz, 1H), 7.92–7.82 (m, 2H), 7.57–7.44 (m, 2H), 6.34 (s, 1H), 4.77–4.7 1 (m, 2H), 3.53 (q, J = 6.3 Hz, 2H), 2.99-2.89 (m, 2H), 2.15 (dd, J = 6.7 Hz, 2H), 1.71-1.63 (m, 2H), 1.48-1.40 (m, 3H). Example 1-22, N-(4-(2-2H-tetrazolyl)butyl)-3-(3-ethyl-5-(5-methoxy-2-pyrimidinyl)-1-1H-1,2,4-triazolyl)benzamide

[0141] A method similar to that for preparing compound HJ020 was used to replace 4-methoxybenzoic acid with 5-methoxypyrimidine-2-carboxylic acid. Compound HJ022 was obtained after column chromatography purification with a yield of 77%: 1H NMR (500 MHz, CDCl3) δ8.52 (s, 1H), 8.36 (s, 2H), 7.91–7.83 (m, 2H), 7.52–7.44 (m, 2H), 6.59 (s, 1H), 4.73 (t, J = 6.9 Hz, 2H), 3.95 (s, 3H), 3.52 (dd, J = 6.6 Hz, 2H), 2.94–2.86 (m, 2H), 2.13 (p, J = 7.0 Hz, 2H), 1.69–1.62 (m, 2H), 1.43 (q, J = 7.6, 0.9 Hz, 3H).

[0142] Example 1-23, N-(4-(1-1H-tetrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0143] Using a method similar to that for preparing compound HJ020, compound HJ023 can be obtained at the same time. Compound HJ023 is obtained after column chromatography purification with a yield of 58%: 1H NMR(500MHz, CDCl3)δ8.72(s,1H),7.99–7.88(m,2H),7.52(dd,J=17.3,8.5Hz,3H),7.43(d,J=7.9Hz,1H),6.88(d,J=8.1Hz,2H),6.64(s,1H),4.54 (d,J=7.1Hz,2H),3.84(d,J=1.7Hz,3H),3.54(d,J=6.5Hz,2H),2.94(d,J= 7.8Hz,2H),2.06(dd,J=7.4Hz,2H),1.74–1.64(m,3H),1.48–1.42(m,3H).

[0144] Example 1-24, N-(6-(2-2H-1,2,3-triazolyl)hexyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0145] A similar method to that used to prepare compound HJ009 was used to replace 2-(4-bromobutyl)isoindoline-1,3-dione with 2-(6-bromohexyl)isoindoline-1,3-dione, and compound HJ024 was obtained after column chromatography purification with a yield of 79%: 1H NMR (500MHz, CDCl3) δ7.93–7.79(m,2H),7.60(s,2H),7.56–7.39(m,4H),6.88(d,J=8.4Hz,2H),6.22(s,1H),4.51–4.44(m,2H),3.84(s, 3H), 3.43(dd,J=6.6Hz,2H), 2.92(q,J=7.6Hz,2H), 2.00(dd,J=7.1Hz,2H), 1.61(dd,J=7.2Hz,2H), 1.49–1.39(m,5H), 1.39–1.31(m,2H).

[0146] Example 1-25, N-(5-(2-2H-1,2,3-triazolyl)pentyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0147] A similar method to that used to prepare compound HJ009 was used to replace 2-(4-bromobutyl)isoindoline-1,3-dione with 2-(5-bromopentyl)isoindoline-1,3-dione, and compound HJ025 was obtained after column chromatography purification with a yield of 69%: 1H NMR(500MHz, CDCl3)δ7.88(d,J=7.7Hz,1H),7.83(s,1H),7.59(d,J=1.2Hz,2H), 7.53–7.45(m,3H),7.42(d,J=7.9Hz,1H),6.94–6.83(m,2H),6.22(s,1H),4.54–4 .44(m,2H),3.84(s,3H),3.45(d,J=6.5Hz,2H),2.93(q,J=7.6Hz,2H),2.08–1.9 9(m,2H),1.67(dd,J=7.4Hz,2H),1.45(dd,J=7.6,1.1Hz,3H),1.41–1.35(m,2H).

[0148] Example 1-26, N-(3-(2-2H-1,2,3-triazolyl)propyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0149] A similar method to that used to prepare compound HJ009 was used to replace 2-(4-bromobutyl)isoindoline-1,3-dione with 2-(3-bromopropyl)isoindoline-1,3-dione. Compound HJ026 was obtained after column chromatography purification with a yield of 65%: 1H NMR (500MHz, CDCl3) δ7.94–7.83 (m, 2H), 7.64 (s, 2H), 7.53–7.40 (m, 4H), 6.91–6.79 (m, 3H), 4.64–4.54 (m, 2H), 3.82 (s, 3H), 3.46 (q, J = 6.2 Hz, 2H), 2.91 (dd, J = 7.6 Hz, 2H), 2.27 (dd, J = 6.4 Hz, 2H), 1.45 (t, J = 7.6 Hz, 3H).

[0150] Example 1-27, N-(2-(2H-1,2,3-triazol-2-yl)ethyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1H-1,2,4-triazol-1-yl)benzamide

[0151] A similar method to that used to prepare compound HJ009 was used to replace 2-(4-bromobutyl)isoindoline-1,3-dione with 2-(2-bromoethyl)isoindoline-1,3-dione, and compound HJ027 was obtained after column chromatography purification with a yield of 58%: 1H NMR(500MHz, CDCl3) δ7.85(d,J=8.0Hz,2H),7.66(d,J=1.8Hz,2H),7.54–7.41(m,4H),6.88(dd,J=8.8,1.8Hz,3H) ,4.74–4.64(m,2H),4.05–3.99(m,2H),3.84(d,J=1.7Hz,3H),2.93(dd,J=7.7Hz,2H),1.45(t,J=7.6,1.7Hz,3H).

[0152] Example 1-28, N-(2-(1-1H-pyrazolyl)ethyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0153] Using a method similar to that for preparing compound HJ001, 2-(4-bromobutyl)isoindoline-1,3-dione was replaced with 2-(2-bromoethyl)isoindoline-1,3-dione, and compound HJ028 was obtained after column chromatography purification with a yield of 76%: 1H NMR (500MHz, CDCl3) δ7.95–7.84 (m, 2H), 7.63–7.38 (m, 6H), 7.29 (s, 1H), 6.94–6.87 (m, 2H), 6.31 (dd, J=2.3Hz, 1H), 4.44–4.30 (m, 2H), 3.95–3.87 (m, 2H), 3.85 (q, J=1.2Hz, 3H), 3.08–2.95 (m, 2H), 1.53–1.44 (m, 3H).

[0154] Example 1-29, N-(2-(1-1H-pyrazolyl)ethyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide

[0155] Using a method similar to that used to prepare compound HJ002, 2-(4-bromobutyl)isoindoline-1,3-dione was replaced with 2-(2-bromoethyl)isoindoline-1,3-dione, and compound HJ029 was obtained after column chromatography purification with a yield of 47%: 1H NMR(500MHz, CDCl3)δ8.79(d,J=1.2Hz,2H),7.96(dd,J=3.6,1.4Hz,1H),7.90(s,1H),7.73–7.68(m,1H),7.59(d,J=2.4Hz,1H), 7.58–7.50(m,3H),6.46–6.40(m,1H),4.68–4.58(m,2H),3.99(dd,J=5.5Hz,2H),2.95(dd,J=7.6,1.1Hz,2H),1.49–1.42(m,3H).

[0156] Example 1-30, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(2-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0157] Using a method similar to that used to prepare compound HJ009, 4-methoxybenzoic acid was replaced with 2-methoxybenzoic acid, and compound HJ030 was obtained after column chromatography purification with a yield of 87%: 1H NMR(500MHz, CDCl3)δ7.81(d,J=7.5Hz,1H),7.76(s,1H),7.62(d,J=17.6Hz ,3H),7.50–7.33(m,3H),7.13–7.04(m,1H),6.83(d,J=8.4Hz,1H),6.35(s,1 H),4.52(d,J=6.7Hz,2H),3.49–3.41(m,2H),3.36(s,3H),2.95(q,J=7.6Hz ,2H),2.06(dd,J=6.9Hz,2H),1.61(dd,J=7.1Hz,2H),1.46(t,J=7.6Hz,3H).

[0158] Example 1-31, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(3-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0159] A method similar to that for preparing compound HJ009 was used to replace 4-methoxybenzoic acid with 3-methoxybenzoic acid, and compound HJ031 was obtained after column chromatography purification with a yield of 58%: 1H NMR (500 MHz, CDCl3) δ7.94–7.85 (m, 2H), 7.63 (d, J = 1.2 Hz, 2H), 7.50 (dd, J = 7.8 Hz, 1H), 7.42 (d, J = 8.0 Hz, 1H), 7.26–7.21 (m, 1H), 7.18 (s, 1H), 6.98 (dd, J = 7.1, 6.1, 1.9 Hz, 1H). z,2H),6.46(s,1H),4.58–4.49(m,2H),3.78(d,J=1.1Hz,3H),3.49(dd,J=6.1Hz,2H) ,2.95(q,J=7.6Hz,2H),2.14–2.03(m,2H),1.64(dd,J=6.9,6.1Hz,2H),1.46(t,3H).

[0160] Example 1-32, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-hydroxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0161] Using a method similar to that used to prepare compound HJ009, 4-methoxybenzoic acid was replaced with 4-hydroxybenzoic acid, and compound HJ032 was obtained after column chromatography purification with a yield of 67%: 1H NMR(500MHz,DMSO-d6)δ9.95(s,1H),8.60(d,J=5.5Hz,1H),7.95–7.87(m,2H) ,7.76(d,J=1.0Hz,2H),7.58–7.51(m,1H),7.47–7.40(m,1H),7.24(d,J=8.4Hz ,2H),6.78–6.70(m,2H),4.50–4.41(m,2H),3.27(d,J=6.4Hz,2H),2.73(q,J= 7.5Hz,2H),1.89(dd,J=7.0Hz,2H),1.45(dd,J=7.0Hz,2H),1.33–1.27(m,3H).

[0162] Example 1-33, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-nitrophenyl)-1-1H-1,2,4-triazolyl)benzamide

[0163] Using a method similar to that used to prepare compound HJ009, 4-methoxybenzoic acid was replaced with 4-nitrobenzoic acid, and compound HJ033 was obtained after column chromatography purification with a yield of 64%: 1H NMR (500MHz, CDCl3) δ8.27–8.21(m,2H),7.95(d,J=8.3Hz,2H),7.77(dd,J= 8.7,1.5Hz,2H),7.63(d,J=1.4Hz,2H),7.58–7.52(m,1H),7.43–7.38(m,1H ),6.55(s,1H),4.57–4.49(m,2H),3.50(q,J=6.2Hz,2H),3.02–2.93(m,2H) ,2.09(dd,J=7.0Hz,2H),1.65(dd,J=7.1Hz,2H),1.48(t,J=7.5,1.4Hz,3H).

[0164] Example 1-34, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-(trifluoromethoxy)phenyl)-1-1H-1,2,4-triazolyl)benzamide

[0165] Using a method similar to that used to prepare compound HJ009, 4-methoxybenzoic acid was replaced with 4-trifluoromethoxybenzoic acid, and compound HJ034 was obtained after column chromatography purification with a yield of 71%: 1H NMR(500MHz, CDCl3)δ7.90(m,J=6.2,1.8Hz,2H),7.63(d,J=1.8Hz,2H),7.57–7.47(m,3H),7.41–7.35(m,1H),7.20(d,J=8.2Hz,2H),6.57–6.45(m ,1H),4.53(d,J=6.8,1.8Hz,2H),3.54–3.44(m,2H),2.90(q,J=7.6,1.8H z,2H),2.13–2.04(m,2H),1.68–1.60(m,2H),1.44(t,J=7.6,1.8Hz,3H).

[0166] Example 1-35, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(5-(4-aminophenyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide

[0167] HJ033 was dissolved in methanol, and a catalytic amount of palladium on carbon was added, and the mixture was reacted under hydrogen at room temperature for 24 hours, and then filtered and purified by column chromatography to obtain HJ035. Yield: 82%. 1H NMR (500MHz, CDCl3) δ8.25–8.21(m,2H),7.93(d,J=8.3Hz,2H),7.87(dd,J=8.7 ,1.5Hz,2H),7.61(d,J=1.4Hz,2H),7.55–7.52(m,1H),7.41–7.35(m,1H),6.45 (s,1H),5.42(s,2H),4.59–4.42(m,2H),3.54(q,J=6.2Hz,2H),3.07–2.96(m,2 H), 2.19 (dd, J = 7.0Hz, 2H), 1.75 (dd, J = 7.1Hz, 2H), 1.46 (t, J = 7.5, 1.4Hz, 3H).

[0168] Example 1-36, N-(4-(2H-1,2,3-triazol-2-yl)butyl)-3-(3-ethyl-5-(4-fluorophenyl)-1H-1,2,4-triazol-1-yl)benzamide

[0169] Using a method similar to that used to prepare compound HJ009, 4-methoxybenzoic acid was replaced with 4-fluorobenzoic acid, and compound HJ036 was obtained after column chromatography purification with a yield of 75%: 1H NMR (500MHz, CDCl3) δ7.91–7.86(m,2H),7.63(s,2H),7.51–7.45(m,3H),7.39–7.35(m,1H),7.10–7.02(m,2H),6.57–6.50(m,1H),4. 53(t,J=6.7Hz,2H),3.49(dd,J=6.5Hz,2H),2.89(q,J=7.6Hz,2H),2.12–2.03(m,2H),1.63(dd,J=7.0Hz,2H),1.44(t,J=7.6Hz,3H).

[0170] Example 1-37, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(5-(4-chlorophenyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide

[0171] Using a method similar to that used to prepare compound HJ009, 4-methoxybenzoic acid was replaced with 4-chlorobenzoic acid, and compound HJ037 was obtained after column chromatography purification with a yield of 86%: 1H NMR (500MHz, CDCl3) δ7.94–7.83(m,2H),7.66–7.58(m,2H),7.53–7.47(m,1H),7.47–7.40(m,2H),7.40–7.31(m,3H),6.54(s,1H),4.54(dd,J= 6.7,1.3Hz,2H),3.50(dd,J=6.4Hz,2H),2.90(qd,J=7.6,1.4Hz,2H),2.09(p,J=6.9Hz,2H),1.64(dd,J=7.4Hz,2H),1.44(t,J=7.8,2.1Hz,3H).

[0172] Example 1-38, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(5-(4-bromophenyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide

[0173] Using a method similar to that used to prepare compound HJ009, 4-methoxybenzoic acid was replaced with 4-bromobenzoic acid, and compound HJ038 was obtained after column chromatography purification with a yield of 55%: 1H NMR (500MHz, CDCl3) δ7.77(dd,J=4.6,2.5Hz,2H),7.65(d,J=0.8Hz,2H),7.63–7.59(m,1H),7.52–7.48(m,1H),7.46–7.40(m,1H),7.40–7.30(m,3H) ), 6.36 (s, 1H), 4.54 (t, J = 6.7Hz, 2H), 3.46 (dd, J = 6.5Hz, 2H), 2.94 (dd, J = 7.5Hz, 2H), 2.07 (p, J = 6.9Hz, 2H), 1.61 (dd, J = 7.1Hz, 2H), 1.46 (td, 3H).

[0174] Example 1-39, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-(trifluoromethyl)phenyl)-1-1H-1,2,4-triazolyl)benzamide

[0175] Using a method similar to that used to prepare compound HJ009, 4-methoxybenzoic acid was replaced with 4-trifluoromethylbenzoic acid, and compound HJ039 was obtained after column chromatography purification with a yield of 76%: 1H NMR (500MHz, CDCl3) δ7.95–7.89(m,2H),7.63(dd,J=4.0,2.1Hz,6H),7.54–7.48(m,1H),7.39–7.34(m,1H),6.51(t,J=5.7Hz,1H),4.53( td,J=6.7,2.1Hz,2H),3.54–3.46(m,2H),2.91(qd,J=7.6,2.1Hz,2H),2.12–2.06(m,2H),1.67–1.59(m,2H),1.45(q,J=7.7,2.1Hz,3H).

[0176] Example 1-40, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-phenyl-1-1H-1,2,4-triazolyl)benzamide

[0177] A method similar to that for preparing compound HJ009 was used to replace benzoic acid with 4-methoxybenzoic acid, and compound HJ040 was obtained after column chromatography purification with a yield of 47%: 1H NMR (500MHz, CDCl3) δ7.91–7.86 (m, 1H), 7.84 (dd, J = 1.7 Hz, 1H), 7.63 (d, J = 1.2 Hz, 2H), 7.53–7.33 (m, 7H), 6.42 (s, 1H), 4.52 (dd, J = 6.7, 1.2 Hz, 2H), 3.53–3.43 (m, 2H), 2.91 (q, J = 7.6, 1.2 Hz, 2H), 2.11–2.02 (m, 2H), 1.61 (dd, J = 7.3 Hz, 2H), 1.49–1.40 (m, 3H).

[0178] Example 1-41, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(p-tolyl)-1-1H-1,2,4-triazolyl)benzamide

[0179] Using a method similar to that used to prepare compound HJ009, 4-methoxybenzoic acid was replaced with 4-methylbenzoic acid, and compound HJ041 was obtained after column chromatography purification with a yield of 58%: 1H NMR (500MHz, CDCl3) δ7.93–7.83(m,2H),7.63(s,2H),7.51–7.44(m,1H),7.42–7.34(m,3H),7.16(d,J=7.9Hz,2H),6.44(s,1H),4.53(t,J =6.7Hz,2H),3.49(dd,J=6.7Hz,2H),2.90(q,J=7.6Hz,2H),2.37(s,3H),2.08(dq,J=9.1,6.9Hz,2H),1.62(dd,J=7.0Hz,2H),1.44(t,3H).

[0180] Example 1-42, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(p-tolyl)-1-1H-1,2,4-triazolyl)benzamide

[0181] Using a method similar to that used to prepare compound HJ009, 4-methoxybenzoic acid was replaced with 4-ethylbenzoic acid, and compound HJ042 was obtained after column chromatography purification with a yield of 53%: 1H NMR(500MHz, CDCl3)δ7.94–7.83(m,2H),7.63(d,J=1.2Hz,2H),7.53–7.44(m, 1H),7.43–7.34(m,3H),7.18(d,J=7.9Hz,2H),6.45(s,1H),4.53(t,J=6.7Hz, 2H),3.48(dd,J=6.5Hz,2H),2.90(q,J=7.6Hz,2H),2.67(dd,J=7.6Hz,2H),2. 12–2.02(m,2H),1.62(dd,J=7.3Hz,2H),1.48–1.41(m,3H),1.27–1.21(m,3H).

[0182] Example 1-43, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-propylphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0183] Using a method similar to that used to prepare compound HJ009, 4-methoxybenzoic acid was replaced with 4-propylbenzoic acid, and compound HJ043 was obtained after column chromatography purification with a yield of 70%: 1H NMR(500MHz, CDCl3)δ7.94–7.86(m,2H),7.63(d,J=1.2Hz,2H),7.52–7.45(m,1 H),7.44–7.37(m,3H),7.17(d,J=7.8Hz,2H),6.48(s,1H),4.57–4.47(m,2H),3 .53–3.43(m,2H),2.91(q,J=7.7Hz,2H),2.60(dd,J=7.7Hz,2H),2.13–2.02(m, 2H),1.68–1.59(m,4H),1.44(t,J=7.6,1.3Hz,3H),0.93(t,J=7.3,1.2Hz,3H).

[0184] Example 1-44, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(5-methoxy-2-pyridyl)-1-1H-1,2,4-triazolyl)benzamide

[0185] Using a method similar to that used to prepare compound HJ009, 4-methoxybenzoic acid was replaced with 5-methoxypicolinic acid, and compound HJ044 was obtained after column chromatography purification with a yield of 85%: 1H NMR(500MHz, CDCl3)δ8.15–8.09(m,1H),8.05(s,1H),7.91–7.85(m,2H),7. 62(d,J=2.0Hz,2H),7.53–7.44(m,2H),7.28–7.25(m,1H),6.50(s,1H),4.57 –4.48(m,2H),3.89(d,J=2.0Hz,3H),3.49(qd,J=6.9,2.0Hz,2H),2.99–2.89 (m,2H),2.12–2.06(m,2H),1.63(dd,J=15.1,1.9Hz,2H),1.52–1.41(m,3H).

[0186] Example 1-45, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(6-methoxy-3-pyridyl)-1-1H-1,2,4-triazolyl)benzamide

[0187] A method similar to that for preparing compound HJ009 was used to replace 4-methoxybenzoic acid with 6-methoxynicotinic acid, and compound HJ045 was obtained after column chromatography purification with a yield of 67%: 1H NMR (500 MHz, CDCl3) δ8.29–8.24 (m, 1H), 7.93–7.85 (m, 2H), 7.75–7.68 (m, 1H), 7.63 (d, J = 1.6 Hz, 2H), 7.55–7.49 (m, 1H), 7.44–7.40 (m, 1H), 6.74 (dd, J = 8.7, 1.5 Hz, 1H), 6.52 ( s, 1H), 4.53 (td, J = 6.7, 1.5 Hz, 2H), 3.95 (s, 3H), 3.49 (dt, J = 7.3, 5.6 Hz, 2H), 2.95–2.85 (m, 2H), 1.63 (dq, J = 14.0, 6.7, 6.3 Hz, 2H), 1.47–1.40 (m, 3H). Example 2: The compounds of the present invention inhibit the proliferation of various tumor cells

[0188] 1. Cell culture

[0189] The cells used in the experiment were purchased from the American type culture collection (ATCC) and the Chinese Academy of Sciences. 10% FBS and 1% penicillin-streptomycin were added to the cell culture medium, and the culture medium was based on the culture requirements given when the cells were purchased. The cells were cultured in a 37°C incubator with a 5% CO2 concentration.

[0190] 2. SRB (sulforhodamine) method for measuring cell proliferation

[0191] Each strain of tumor cells that highly express MYOF was inoculated into a 96-well plate (Corning) at an appropriate density. After culturing at 37°C for 24 hours, a certain concentration of the compound prepared in Example 1 of the present invention was diluted to each well, so that the final concentrations were 0.01μM, 0.05μM, 0.1μM, 0.5μM, and 1.0μM, respectively. The control group added an equal amount of DMSO, and each group had 3 secondary wells. After continuing to culture for 48 hours, 25μl / well of pre-cooled TCA (trichloroacetic acid, 50%, w / V) was added and gently mixed. Incubate at 4°C for 1 hour to fix the cells, rinse gently with distilled water 5 times, and air dry. Add 50μl SRB dye solution (4%, w / V) to each well and incubate at room temperature for 30min for staining. Aspirate the dye solution and quickly rinse with 1% acetic acid several times to remove unbound dye. After air drying, add 100μl of 10mmol / L Tris solution to each well and shake to dissolve the bound SRB dye. The 96-well plate was placed in a microplate reader (SPECTRAMAX 190) and the OD value was measured at a wavelength of 515 nm. GraphPad Prism 7 was used to analyze the statistical data and the effect of the drug on the cell proliferation level. The cell survival rate was calculated according to the following formula, and the effect of the compound prepared in Example 1 of the present invention on cell proliferation was statistically analyzed.

[0192]

[0193] In addition, the compound prepared in Example 1 of the present invention was subjected to proliferation inhibition experiments on a variety of tumor cells including other liver cancer cells, lung cancer cells, prostate cancer cells, skin cancer cells, colon cancer cells, pancreatic cancer cells, breast cancer cells, leukemia cells, ovarian cancer cells, gastric cancer cells, bladder cancer cells, kidney cancer cells and oral cancer cells, and similar significant inhibitory effects were achieved.

[0194] The experimental results are as attached Figure 1 As shown in Table 2: The compound HJ001 prepared in Example 1 of the present invention can significantly inhibit the proliferation of tumor cells with high MYOF expression at a low nanomolar concentration, while basically losing the inhibitory effect on tumor cells or normal cells with low MYOF expression. This also preliminarily indicates that the compound HJ001 prepared in Example 1 of the present invention has a certain selectivity for tumor cells with high MYOF expression.

[0195] Table 2. In vitro anti-tumor proliferation activity test results of compounds HJ001-HJ045 of the present invention

[0196]

[0197]

[0198] Example 3: Clone formation experiment

[0199] After digestion, gastric cancer cells were inoculated in a 6-well plate at an appropriate density. After the cells were cultured for 24 hours and adhered to the wall, different concentrations of the compound HJ001 prepared in Example 1 of the present invention were added, and the same amount of DMSO was added to the control group. After 7-14 days of culture, the cells were fixed with 4% paraformaldehyde for 30 minutes, stained with 0.2% crystal violet for 10 minutes, washed with PBS until all unbound crystal violet dye was removed, air-dried at room temperature, and the number of clones in each group was counted after taking pictures with a camera. Figure 2 As shown in Figure A, the compound HJ001 prepared in Example 1 of the present invention can significantly inhibit the colony formation of gastric cancer cells at a concentration of 50 nanomoles per liter and 100 nanomoles per liter. Figure 2 As shown in the bar chart of B, the inhibitory effect of the compound HJ001 prepared in Example 1 of the present invention on the colony formation of gastric cancer cells is concentration-dependent. In addition, similar experiments also show that other compounds of the present invention have similar effects of inhibiting the colony formation of cancer cells.

[0200] Example 4: Transwell migration assay

[0201] 1. Pre-treat gastric cancer cells with 10 μg / mL mitomycin C for 2 h to eliminate the interference of proliferation during cell migration. Resuspend in serum-free medium after digestion and centrifugation.

[0202] 2. Use tweezers to pick up the Transwell chamber and place it flat in the center of the 24-well plate (upper chamber). Add 300 μL of serum-free culture medium containing an appropriate amount of cells to the upper chamber, and add 600 μL of complete culture medium containing 10% serum to the lower chamber of each well of the 24-well plate to induce cell migration;

[0203] 3. Add different concentrations of the compound HJ001 prepared in Example 1 of the present invention to the upper and lower chambers of the Transwell simultaneously, with 3 replicate wells for each concentration;

[0204] 4. After incubating the 24-well plate in a 37°C incubator for 12-36 hours, take it out and fix it with 4% paraformaldehyde for 30 minutes

[0205] 5. Carefully wipe off the remaining unmigrated cells on the surface of the Transwell upper chamber with moistened cotton;

[0206] 6. Immerse the Transwell chamber in 0.2% crystal violet stain for 5 minutes, wash off the excess stain with water and wipe carefully with cotton;

[0207] 7. Collect cell migration data in multiple different fields of view under an inverted microscope.

[0208] The experimental results are as attached Figure 3 As shown, the compound HJ001 prepared in Example 1 of the present invention can significantly inhibit the migration of gastric cancer cells with high expression of MYOF in a concentration-dependent manner under low concentration conditions. Figure 3 As shown in Figure A, the compound HJ001 prepared in Example 1 of the present invention can significantly inhibit the migration of gastric cancer cells at concentrations of 62.5 nanomoles per liter, 125 nanomoles per liter, and 250 nanomoles per liter. Figure 3 As shown in the bar chart of B, the inhibitory effect of the compound HJ001 prepared in Example 1 of the present invention on the migration of gastric cancer cells is concentration-dependent. In addition, similar experiments also show that other compounds of the present invention have similar effects of inhibiting the migration of cancer cells.

[0209] Example 5: Testing method for saturated solubility of the compound of the present invention in water

[0210] In the present invention, the determination method is the saturated shake flask method to determine the thermodynamic solubility. Thermodynamic solubility refers to how much the compound dissolves in the solution.

[0211] 1. Determine the chromatographic conditions

[0212] 2. Preparation of standard curve

[0213] Weigh 1 mg of the compound to be tested accurately, add methanol solution to make a 10 mM clear solution (DMSO can be used instead of methanol for poorly soluble compounds), and dilute with methanol to make 100 μL series of reference solutions of 200, 100, 50, 25, 12.5, 6.25, 3.125, 1.5625 μM. Accurately pipette 20 μL of each series of reference solutions into the high performance liquid chromatograph, record the peak area, measure each concentration twice, and calculate the average peak area. Perform linear regression with mass concentration as the horizontal axis and peak area (A) as the vertical axis to obtain the linear regression equation.

[0214] 3. Prepare phosphate buffer solutions with different pH

[0215] Prepare PBS solutions with pH values ​​of 2.0, 7.4, and 9.0.

[0216] Buffer: 50 mM phosphate buffer, pH 2.0: 1.44 g H3PO4, dissolved in about 240 mL water in a flask. Then adjust pH to 2.0 with 5N NaOH, then transfer to a 250 mL volumetric flask and add water to the final level.

[0217] Buffer: 50 mM phosphate buffer, pH 7.4: 0.78 g NaH2PO4·2H2O, 2.805 g Na2HPO4, dissolved in about 240 mL water in a flask, then mixed thoroughly and adjusted pH to 7.4 with 5N NaOH, then transferred to a 500 mL volumetric flask and filled with water to the final level. Buffer: 50 mM phosphate.

[0218] Buffer, 50 mM phosphate buffer, pH 9.0: 0.78 g NaH2PO4·2H2O, 2.805 g Na2HPO4, dissolved in about 240 mL water in a flask, then mixed thoroughly and adjusted pH to 9.0 with 5N NaOH, then transferred to a 500 mL volumetric flask and finally filled with water to the final level.

[0219] 4. Determination of Thermodynamic Solubility

[0220] Weigh the sample powders into EP tubes respectively. Add 450 μL of pH 2, pH 7.4, and pH 9.0 buffers to the above EP tubes to obtain supersaturated suspensions. Vortex the solubility sample for at least 2 minutes. Oscillate the EP tube on an oscillator at 800 rpm for 24 hours at room temperature. Centrifuge for 20 minutes (e.g., 12,000 rpm). Filter the supernatant with a 0.45 μm filter membrane, inject into the HPLC system, and calculate the concentration using the standard curve. See attached. Figure 4 As shown, compared with the reported MYOF inhibitor 6y, the solubility of multiple compounds in the present invention, such as compounds HJ001, HJ002, HJ003, HJ009, HJ010, HJ011 and HJ032, in water under multiple pH conditions (2.0, 7.4 and 9.0) was significantly improved.

[0221] Example 6: Cellular thermal shift analysis experiment was used to determine the binding of the compound of the present invention to MYOF.

[0222] 1. MKN45 cells were seeded into 10 cm culture dishes at an appropriate density. After culturing in a 37°C incubator for 24 h, test compounds with final concentrations of 50 and 100 μM were added to treat the cells for 1 h. The same volume of DMSO was added to the control group.

[0223] 2. Digest the cells with trypsin, transfer to a 15 ml centrifuge tube, centrifuge, wash the cells three times with PBS, and then resuspend the cells with 1 ml of PBS containing protease inhibitors.

[0224] 3. Add the cell suspension in a volume of 100ul into a 0.2ml PCR tube, place the sample on a PC (Eppendorf), set different temperatures and incubate for 3min, then incubate the cells at room temperature for 3min, and then freeze and thaw repeatedly in liquid nitrogen at 37°C for 3 times.

[0225] 4. Centrifuge at 4°C and take the supernatant for Western Blot analysis.

[0226] MKN45 cells were collected with PBS containing protease inhibitors and placed in different 0.2 ml PCR tubes (about 1 million cells per tube). The samples were placed on a PCR instrument (Eppendorf), set at different temperatures and incubated for 3 min, then repeatedly frozen and thawed 3 times in liquid nitrogen at 37°C, and after centrifugation, the supernatant was taken for Western Blot analysis.

[0227] The experimental results are as attached Figure 5 As shown, when the temperature of MYOF protein is gradually heated to 51.9°C, the protein stability is destroyed and the protein gradually degrades. After adding the compound HJ001 (50 and 100 micromoles per liter) prepared in Example 1 of the present invention, under the same experimental conditions, the stability of MYOF protein is improved and the temperature tolerance is significantly improved, indicating that the compound HJ001 prepared in Example 1 of the present invention and MYOF are effectively combined. In addition, similar experiments also show that other compounds of the present invention have similar effects of combining with MYOF.

[0228] Example 7: Experiment on knocking down MYOF in gastric cancer cells.

[0229] 1. Virus packaging: 293T cells were inoculated in 10cm medium. When the cell density reached 60-70%, shMYOF-1#, shMYOF-2#, shNC and packaging plasmids psPAX2 and pMD2.G were transfected into 293T cells with PEI at a ratio of 2:2:1. After 6 hours, the medium was changed and 12 mL of culture medium was added to continue the culture.

[0230] 2. 72 hours after transfection, collect the supernatant, centrifuge at 1200 rpm for 5 min, and then filter the supernatant using a 0.45 μm filter.

[0231] 3. Place the MKN45 cells to be knocked out in a 6-well plate and infect the target cells with the harvested lentivirus. After 24 hours, replace the culture medium with fresh one and continue culturing for another 24 hours.

[0232] 4. Add puromycin to screen for stable MYOF knockout cells. Western blot was used to detect gene knockout efficiency.

[0233] 5. The results of shRNA are as follows: shMYOF-1#: 5'AGCTGATATTGATGGACAGTA 3' (SEQ ID NO.1)

[0234] shMYOF-2#:5'AATGGTTGCCTTGCTCAACAA 3'(SEQ ID NO.2)

[0235] The results are attached Figure 6 As shown in A, after knocking down the MYOF gene, the expression level of MYOF protein was significantly reduced. Figure 6 As shown in B, the growth of cancer cells was significantly inhibited after MYOF knockdown. Figure 6 As shown in Figure C, the sensitivity of compound HJ001 to MYOF knockdown cancer cells is significantly reduced, which indicates that MYOF is the main target for compound HJ001 prepared in Example 1 of the present invention to exert anti-proliferation and anti-migration effects.

[0236] Example 8: The compounds of the present invention inhibit the growth of gastric cancer in vivo without obvious toxic side effects.

[0237] Experimental Method: Gastric Cancer Subcutaneous Tumor Growth Model (Experimental Procedures)

[0238] 1. Expand the culture of gastric cancer cells to a sufficient number of subcutaneous tumor-bearing cells;

[0239] 2. After the cells grow to a suitable state, digest and centrifuge the cells, wash them twice with PBS, and resuspend them in pre-cooled PBS;

[0240] 3. Count and adjust the cell density to 3-5x10 6 / 100μL, dispense into EP tubes and place on ice;

[0241] 4. Inject gastric cancer cells into the back of 6-8 week old BALB / c-nude male mice subcutaneously, 100 μL per mouse;

[0242] 5. After several days of observation, the length (L) and width (W) of the mouse tumor were initially measured according to the formula V = L x W 2 x 0.52 to calculate the tumor volume. When the tumor volume reaches about 100 mm 3 Mice were divided into groups;

[0243] 6. The mice were randomly divided into 5 groups: Control group, 5-Fu uracil group (15 mg / kg / d), 6y group (30 mg / kg / d), low-dose group of compound HJ001 prepared in Example 1 of the present invention (15 mg / kg / d), and high-dose group of compound HJ001 prepared in Example 1 of the present invention (30 mg / kg / d), with 7 mice in each group;

[0244] 7. Every day, 100 μL of the compound HJ001 prepared in Example 1 of the present invention was intraperitoneally administered to each mouse in the low-dose group, and 50 μL of the compound HJ001 prepared in Example 1 of the present invention and the positive control group (5-Fu) and the positive control group (6y) were intraperitoneally administered to each mouse. The weight of mice in each group and the length and width of the tumor were measured regularly according to the experimental plan, and the volume was calculated;

[0245] 8. After the experiment, the mice were killed by cervical dislocation, and then the tumors of each group of mice were removed, photographed, recorded, and weighed using sterilized surgical scissors;

[0246] 9. Preserve the removed tumor pieces and internal organs in an appropriate manner, such as freezing in liquid nitrogen or fixing in 4% paraformaldehyde, for use in subsequent experiments. Figure 7 As shown, attached Figure 7 A is a solid picture of the tumor after all experimental mice were killed, the tumor tissue was peeled off and photographed. Figure 7 B. According to the mouse tumor growth volume curve, compared with the control group, the first-line treatment drug 5-Fu for gastric cancer was administered at a dose of 15 mg / kg / day. After 21 days, the tumor inhibition rate was 39.2%, and the tumor inhibition rate of the reported MYOF inhibitor 6y (30 mg / kg / day) group was 52.2%. When the compound HJ001 prepared in Example 1 of the present invention was administered at a dose of 15 mg / kg / day and 30 mg / kg / day, the tumor inhibition rates were 52.2% and 68.5%, respectively, showing a better in vivo gastric cancer inhibition effect. As shown in the attached Figure 7 As shown in Figure C, after all experimental mice were killed, the tumor tissues were peeled off and weighed. The results showed that compared with the control group, the first-line treatment drug for gastric cancer 5-Fu group and the reported MYOF inhibitor 6y group, the tumor weight was significantly reduced when the compound HJ001 prepared in Example 1 of the present invention was administered at a dose of 15 mg / kg / day and 30 mg / kg / day, showing a better in vivo gastric cancer inhibition effect. As shown in Figure 3 Figure 7 As shown in Figure D, when the compound HJ001 prepared in Example 1 of the present invention was administered at a dose of 15 mg / kg / day and 30 mg / kg / day, it had no significant effect on the body weight of mice. In addition, similar mouse animal experiments also showed that other compounds of the present invention also had similar effects of inhibiting tumor growth, and there was no significant difference in body weight compared with the normal control group.

[0247] The protection content of the present invention is not limited to the above embodiments. Without departing from the spirit and scope of the present invention, changes and advantages that can be thought of by those skilled in the art are included in the present invention and are protected by the attached claims.

Claims

1. A 1,5-diaryl 1,2,4-triazole compound or a pharmaceutically acceptable salt thereof, characterized in that: It is represented by the following structural formula I: Wherein, Ar2 is a nitrogen-containing five-membered heterocyclic ring, and Ar1 and Ar3 are aromatic rings or aromatic heterocyclic rings; n is 0-6; A, B, D, and E are each independently selected from C or N atoms, and A, B, and E are not C atoms at the same time; A, B, D, and E are not N atoms at the same time; F and G are each independently selected from C or N; Ar1 and Ar3 are one of the following aromatic rings or aromatic heterocyclic rings: benzene ring, pyridine ring or pyrimidine ring; R1 is independently selected from one or more of the following groups: hydrogen, hydroxy, C1-C3 alkoxy, halogen, C1-C3 alkyl, fluoroalkoxy, fluoroalkyl, carbonyl, cyano, nitro, and deuterated hydrogen in alkoxy; R2 is independently selected from one or more of the following groups: hydrogen, hydroxy, C1-C3 alkoxy, halogen, C1-C3 alkyl, nitro, aldehyde.

2. The 1,5-diaryl 1,2,4-triazole compound or a pharmaceutically acceptable salt thereof according to claim 1, characterized in that: When Ar2 is a nitrogen-containing five-membered heterocyclic ring and Ar3 is a benzene ring, it is represented by the following structural formula II: n is 0-6; A, B, D, and E are each independently selected from C or N atoms, and A, B, and E are not C atoms at the same time; A, B, D, and E are not N atoms at the same time; Ar1 is a benzene ring or one of the following heterocyclic rings: pyridine ring, pyrimidine ring; R1 is independently selected from one or more of the following groups: hydrogen, hydroxy, C1-C3 alkoxy, halogen, C1-C3 alkyl, fluoroalkoxy, fluoroalkyl, carbonyl, cyano, nitro, and deuterated hydrogen in alkoxy; R2 is independently selected from one or more of the following groups: hydrogen, hydroxy, C1-C3 alkoxy, halogen, C1-C3 alkyl, nitro, aldehyde.

3. The 1,5-diaryl 1,2,4-triazole compound or a pharmaceutically acceptable salt thereof according to claim 1, characterized in that: The pharmaceutically acceptable salt is an acid addition salt formed by a 1,5-diaryl 1,2,4-triazole compound and an acid; wherein the acid includes hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, acetic acid, tartaric acid, salicylic acid, citric acid, methanesulfonic acid, p-toluenesulfonic acid, lactic acid, pyruvic acid, maleic acid, and succinic acid.

4. The 1,5-diaryl 1,2,4-triazole compound or a pharmaceutically acceptable salt thereof according to claim 1, characterized in that: It is: N-(4-(1-1H-pyrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(1-1H-pyrazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide; N-(4-(1-1H-pyrazolyl)butyl)-3-(3-ethyl-5-(5-methoxy-2-pyrimidinyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(1-1H-pyrazolyl)butyl)-3-(3-ethyl-5-(4-methyl-2-pyridyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(1-1H-pyrazolyl)butyl)-3-(5-(4-chloro-2-pyridinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide; 3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)-N-(4-(4-fluoro-1-1H-pyrazolyl)butyl)benzamide; 3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)-N-(4-(4-fluoro-1-1H-pyrazolyl)butyl)benzamide; N-(4-(4-bromo-1-1H-pyrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(5-methoxy-2-pyrimidinyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-(methoxy-d3)phenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(4-bromo-2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(4,5-dibromo-2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(1-1H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(1-1H-1,2,3-triazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide; N-(4-(4-bromo-1-1H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(1-1H-1,2,4-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(1-1H-1,2,4-triazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-tetrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-tetrazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-tetrazolyl)butyl)-3-(3-ethyl-5-(5-methoxy-2-pyrimidinyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(1-1H-tetrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(6-(2-2H-1,2,3-triazolyl)hexyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(5-(2-2H-1,2,3-triazolyl)pentyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(3-(2-2H-1,2,3-triazolyl)propyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(2-(2-2H-1,2,3-triazolyl)ethyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(2-(1-1H-pyrazolyl)ethyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(2-(1-1H-pyrazolyl)ethyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(2-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(3-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-hydroxyphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-nitrophenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-(trifluoromethoxy)phenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(5-(4-aminophenyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-fluorophenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(5-(4-chlorophenyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(5-(4-bromophenyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-(trifluoromethyl)phenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-phenyl-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(p-tolyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-ethylphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-propylphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(5-methoxy-2-pyridinyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(6-methoxy-3-pyridinyl)-1-1H-1,2,4-triazolyl)benzamide.

5. A pharmaceutical composition, characterized in that It contains the 1,5-diaryl-1,2,4-triazole compound according to any one of claims 1 to 4 and / or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier.

6. A MYOF inhibitor, characterized in that It comprises the 1,5-diaryl-1,2,4-triazole compound or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 4 or the pharmaceutical composition according to claim 5.

7. Use of the 1,5-diaryl-1,2,4-triazole compound or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 4, the pharmaceutical composition according to claim 5, and the MYOF inhibitor according to claim 6 in the preparation of a drug for inhibiting or binding to myoferlin protein, in the preparation of a drug for treating tumor cell proliferation, growth, migration and infiltration, in the preparation of a drug for treating malignant tumors, and / or in the preparation of a drug for treating metastasis and recurrence of malignant tumors.

8. The use according to claim 7, characterized in that The tumor cells include melanoma cells, liver cancer cells, lung cancer cells, prostate cancer cells, breast cancer cells, skin cancer cells, colon cancer cells, pancreatic cancer cells, leukemia cells, ovarian cancer cells, gastric cancer cells, bladder cancer cells, kidney cancer cells and oral cancer cells, myeloma, esophageal cancer, head and neck squamous cell carcinoma.

9. The use according to claim 7, characterized in that The 1,5-diaryl-1,2,4-triazole compound or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 4, the pharmaceutical composition according to claim 5, and the MYOF inhibitor according to claim 6 are formulated into injectable fluids, aerosols, creams, gels, pills, capsules, syrups, transdermal patches or excipients.

10. A method for synthesizing a 1,5-diaryl-1,2,4-triazole compound as shown in Formula I or Formula II, characterized in that: n is 0-6; A, B, D, E are each independently selected from C or N atoms, and A, B, E are not C atoms at the same time, and A, B, D, E are not N atoms at the same time; F, G are each independently selected from C or N atoms; Ar1 ​​and Ar3 are one of the following aromatic rings or aromatic heterocycles: benzene ring, pyridine ring, pyrimidine ring; R1 is independently selected from one or more of the following groups: hydrogen, hydroxyl, C1-C3 alkoxy, halogen, C1-C3 alkyl, fluoroalkoxy, fluoroalkyl, carbonyl, cyano, nitro, and alkoxy in which hydrogen is deuterated by its isotope; R2 is independently selected from one or more of the following groups: hydrogen, hydroxyl, C1-C3 alkoxy, halogen, C1-C3 alkyl, nitro, aldehyde group. When the compound is HJ001-HJ034, HJ036-HJ045, the synthesis method is: Reagents and reaction conditions: (a) N,N-dimethylformamide, N,N-diisopropylethylamine, 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate, room temperature; (b) thionyl chloride, methanol, 80°C; (c) acetic acid, 80°C; (d) methanol / water, lithium aluminum hydride, room temperature; (e) potassium carbonate, dimethyl sulfoxide, 60°C; (f) hydrazine monohydrate, ethanol, 40°C; or, When the compound is HJ035, the synthesis method is: Reagents and reaction conditions: methanol, palladium on carbon, hydrogen, room temperature.

Images