Kluyveromyces marxianus INM3115 as well as preparation and application thereof

Abstract

The invention provides Kluyveromyces marxianus INM3115 as well as preparation and application thereof, the Kluyveromyces marxianus INM3115 is preserved in the Guangdong Microbial Culture Collection Center on August 21, 2024, the preservation number is GDMCC NO: 65038, and the preservation address is the 5th floor, No. 59 building, No. 100 Courtyard, Xianlie Middle Road, Guangzhou City, Guangdong Province. The method has the advantages that the polysaccharide content of the bread is increased, so that the nutritional ingredients of the baked product are more comprehensive; the baking product has the capability of generating a flavor substance trans-2-hexenol, so that the baking product is richer in flavor during the storage period; the method has the characteristics of improving the fragrance and taste of the product.

Description

Technical Field

[0001] The invention belongs to the technical field of industrial microorganisms and relates to a strain of Kluyveromyces marxii INM3115 and a preparation method and application thereof. Background Art

[0002] Kluyveromyces marxianus is widely found in nature and has been included in the European food additives book as a food safety yeast. The high sugar and low pH characteristics of grape juice provide good conditions for the growth and reproduction of yeast. After long-term natural selection and evolution, a group of superior wild yeast resources that adapt to environmental conditions and grape varieties have gradually formed and attached to the grape skin. During the fermentation process, yeast can produce a variety of aromatic substances, giving the product a unique flavor; it can also produce various enzymes, vitamins and other active ingredients, enriching the nutritional and probiotic properties of the product.

[0003] Polysaccharides are natural high molecular weight polymers formed by connecting aldose or ketose through glycosidic bonds. They are important biomacromolecules in organisms and one of the basic substances for maintaining the normal operation of life activities. They have biological activities, including immune regulation, anti-tumor, hypoglycemic, hypolipidemic, anti-radiation, antibacterial and antiviral, and liver protection. At the same time, plant polysaccharides have water absorption and high moisturizing properties, and have been widely used in cosmetics, food and other industries.

[0004] Trans-2-hexenol is a colorless oily liquid, insoluble in water, but soluble in organic solvents such as ethanol and propylene glycol. It has a strong green aroma, accompanied by fruity, vegetable and grassy aromas, and is found in fruits such as raspberries, oranges, apples, green tea, peaches, strawberries, tomatoes, kiwis, and mangoes. It is used to prepare edible flavors such as mint, pears, and berries, and is a food flavor approved for use in my country.

[0005] At present, the research directions of the application of polysaccharides in bread are diverse. Patent: A method for improving bread quality by in-situ fermentation of dough to produce high-molecular polysaccharides-CN115843848A, this invention discloses a method for preparing high-yield high-molecular polysaccharide dough, specifically using enteric mesenteroides, Weissella sinus, Lactobacillus sanfrancisco, etc. as sugar-producing strains, directly fermenting in the dough system to reduce costs. It does not involve the use of Kluyveromyces marx strains as sugar-producing strains. Patent: Grape polysaccharides and their extraction methods and applications-CN101104648, this invention discloses a technology for extracting grape polysaccharides from grapes or raisins using physical and chemical methods, and does not involve a method for producing polysaccharides by fermentation of strains. Patent: A polysaccharide anti-aging bread and its preparation method-CN112889877A, this invention discloses a polysaccharide anti-aging bread and its preparation method. The effect of polysaccharides on the texture of bread is described, but the improvement of taste is not involved. Patent: A method for synthesizing trans-2-hexenol - CN116003217A, this invention discloses a method for synthesizing trans-2-hexenol, belonging to the field of organic synthesis. It does not involve the application of trans-2-hexenol in the food field.

[0006] The above patents focus on product functionality, involving polysaccharide extraction, polysaccharide to improve noodle texture, anti-aging application during storage, and trans-2-hexenol preparation system. However, they ignore the fact that flavor strongly affects the acceptability of food, especially because lactic acid bacteria participate in dough fermentation, sour substances will be produced, which has a strong impact on the overall flavor structure of the product. Therefore, in terms of product development, taking both flavor and nutrition into consideration will be more in line with the market. Summary of the invention

[0007] In view of the above problems, the present invention provides a strain of Kluyveromyces marxii INM3115 and its preparation and application. The fermented grape juice is produced by fermenting grape juice with Kluyveromyces marxii INM3115, and a low pH environment is created. The fermented grape juice is rich in polysaccharides and added to the dough as an ingredient without adverse effects on gluten formation. The prepared bread has excellent sensory evaluation and stable polysaccharide content during storage. The internal organizational structure of the product is not affected, and the perfect combination of nutrition and sensory properties can be achieved.

[0008] The purpose of the invention is achieved through the following scheme: a strain of Kluyveromyces marxianus, Kluyveromyces marxianus INM3115, which was deposited in Guangdong Provincial Microbiological Culture Collection Center on August 21, 2024, with the deposit number: GDMCC NO: 65038, and the deposit address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province.

[0009] Furthermore, the colony characteristics of Kluyveromyces marxianus are as follows: after culturing on a PDA plate for 48 hours, colonies with a diameter of 1.0 to 5.0 mm, white color, oval shape, smooth and moist surface, neat edges, and raised areas are formed.

[0010] A method for preparing Kluyveromyces marxii.

[0011] Step 1: Isolation of Kluyveromyces marxianus:

[0012] Kluyveromyces marxianus was isolated and screened from raisin samples. The raisins were squeezed and cultured in an incubator at 28°C. The fermentation broth was diluted 10 1 -10 7 times, and evenly spread the fermentation broth of different dilution concentrations on the PDA medium, and culture it in an incubator at 28°C for 48 hours, and then select white colonies on the PDA medium for screening;

[0013] Step 2: Cultivation of Kluyveromyces marxianus:

[0014] The obtained Kluyveromyces marxianus was cultured to the logarithmic growth phase, and the final concentration of the strain was 1×10 7 CFU / mL, and then inoculated into grape juice at a 1% inoculation amount, and placed in a 28°C incubator for 48 hours to obtain the fermentation liquid.

[0015] An application of Kluyveromyces marxii, production application: according to the bread making process, adding fermentation liquid fermented by Kluyveromyces marxii for 48 hours, the added amount is 10% of the total amount of wheat, so as to increase the content of polysaccharides and trans-2-hexenol in the bread.

[0016] Application of Kluyveromyces marxii to improve the content of trans-2-hexenol in grape juice after fermentation.

[0017] Application of Kluyveromyces marxii to improve the polysaccharide content of bread after baking.

[0018] The invention discloses an application of Kluyveromyces marxii yeast in making meal packs.

[0019] An application of Kluyveromyces marxii yeast in making toast.

[0020] The invention discloses an application of Kluyveromyces marxii yeast in making European bread.

[0021] Advantages of the present invention: 1. The Kluyveromyces marxii strain of the present invention has the function of increasing the polysaccharide content of bread, thereby making the nutritional components of baked products more comprehensive.

[0022] 2. The Kluyveromyces marxii strain of the present invention has the ability to produce the flavor substance trans-2-hexenol, making the baked products more flavorful during storage.

[0023] 3. The Kluyveromyces marxii yeast of the present invention has the characteristics of improving the aroma and taste of the product. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 For 10 7 Total ion current of trans-2-hexenol in bread made with inoculum concentration.

[0025] Figure 2 This is a morphological diagram of the culture medium for Kluyveromyces marxianus.

[0026] Figure 3 This is a Gram staining microscopic examination of Kluyveromyces marxianus. DETAILED DESCRIPTION

[0027] The present invention will be further described below in conjunction with specific embodiments:

[0028] Unless otherwise specified, the experimental methods used in the following embodiments are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.

[0029] Example 1, see attached Figure 1-3 , a strain of Kluyveromyces marxianus, Kluyveromyces marxianus INM3115, which was deposited in Guangdong Provincial Microbiological Culture Collection Center on August 21, 2024, with the deposit number: GDMCC NO: 65038, and the deposit address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province.

[0030] The colony characteristics of a strain of Kluyveromyces marxianus are as follows: after culturing on a PDA plate for 48 hours, colonies with a diameter of 1.0 to 5.0 mm, white color, oval shape, smooth and moist surface, neat edges and raised areas are formed.

[0031] A method for preparing Kluyveromyces marxii.

[0032] Step 1: Isolation of Kluyveromyces marxianus:

[0033] Kluyveromyces marxianus was isolated and screened from raisin samples. The grape juice was squeezed and cultured in an incubator at 28°C. The fermentation broth was diluted 10 1 -10 7 The fermentation broth with different dilution concentrations was evenly spread on the PDA medium, placed in an incubator and cultured at 28°C for 48 hours, and then white colonies were selected on the PDA medium for screening.

[0034] Step 2: Cultivation of Kluyveromyces marxianus:

[0035] The obtained Kluyveromyces marxianus was cultured to the logarithmic growth phase, and the final concentration of the strain was 1×10 7 CFU / mL, and then inoculated into grape juice at a 1% inoculation amount, and placed in a 28°C incubator for 48 hours to obtain the fermentation liquid.

[0036] Application of Kluyveromyces marxii to improve the content of trans-2-hexenol in grape juice after fermentation.

[0037] Application of Kluyveromyces marxii to improve the polysaccharide content of bread after baking.

[0038] 1. Processing of raw materials

[0039] Take 10g of raisins, clean the dust on the surface, add them to 100g of grape juice, ferment at 28℃ for 48h, dilute the fermentation liquid by 10 1 -10 7 The bacterial solution was evenly spread on the PDA medium to observe the colony morphology. The colonies with different morphologies were picked out and further separated and purified on PDA, and numbered as PDA1-PDA15.

[0040] 2. Preliminary screening of bacterial strains

[0041] The 15 strains were inoculated into malt juice medium at 1% inoculum and cultured at 28°C for 48h. The final cell density reached 10 7 CFU / mL. Take bacterial solution from each tube, inoculate into grape juice at 1% inoculum, culture at 28℃ for 48h, centrifuge at 8000r / min for 10min, and obtain supernatant as sample for physical and chemical index detection. The results are shown in Table 1.

[0042] Polysaccharide content: Take 100 mL of the above supernatant sample, slowly add 4 times the volume of anhydrous ethanol, stir evenly, let stand at 4°C for 12 hours, centrifuge at 8000r / min for 20 minutes, collect the precipitate, wash it twice with anhydrous ethanol, collect the precipitate, freeze-dry it to obtain extracellular polysaccharide, weigh it and calculate the yield. The polysaccharide content was determined by the phenol-sulfuric acid method.

[0043] Trans-2-hexenol content: The extraction method uses 50 / 30um, DVB / CAR / PDMS, Stableflex solid phase microextraction head, takes 5g of sample into a 30mL headspace bottle, and extracts for 40min in a 60℃ water bath. For gas chromatography-mass spectrometry detection, HP-Innowax (30m×250μm, 0.25μm) capillary column is selected. GC conditions are: helium as carrier gas, carrier gas flow rate is set to 1mL / min, non-split injection, and injection port temperature is 250℃. MS conditions are: ion source temperature 230℃, MS quadrupole temperature 150℃, electron energy 70eV, mass spectrometry scanning range 45~500, scanning mode is full scan. The column box temperature program is: 50℃ for 1min, increase to 150℃ at 6℃ / min, and then increase to 240℃ at 8℃ / min, and maintain for 5min. The compounds were identified by mass spectrometry database method, and each peak was compared with the NIST Library mass spectrometry database by computer, and the qualitative basis was a material match greater than 800. Internal standard quantitative method: a certain amount of trans-2-hexenol standard was accurately added to the ethanol solution to form 0, 20, 40, 60, 80, 100 μg / 100g standard solutions, and the trans-2-hexenol content was calculated based on the peak area ratio.

[0044] Table 1 Analysis of polysaccharides and trans-2-hexenol produced by fermentation

[0045]

[0046]

[0047] Strains PDA2, PDA11, and PDA14 with lower pH and higher polysaccharide and trans-2-hexenol contents were selected for rescreening.

[0048] 3. Strain rescreening

[0049] The three yeast strains PDA2, PDA11 and PDA14 selected in the initial screening were reactivated and cultured. When the bacterial concentration reached 10 7 CFU / mL, it was inoculated into grape juice at 1% inoculation amount, fermented at 28℃ for 48h, and the fermented grape juice was added to the medium seed at 10% of the total amount of wheat. Bread was made according to the national standard GB / T14612-2008 and sensory evaluation and polysaccharide content test were carried out. The results are shown in Table 2.

[0050] Table 2 Sensory analysis and hardness of fermented bread

[0051] Species name Bread Appearance taste Average sensory score Polysaccharide content (%) PDA2 4.5 4.5 4.50 0.294±0.08 PDA11 4.0 4.5 4.25 0.283±0.03 PDA14 4.5 5.0 4.75 0.325±0.05

[0052] From the results in Table 2, we can see that the bread made from PDA14 has the highest average sensory score and the highest polysaccharide content. As the target strain, the morphology of this strain on the PDA plate medium is observed as follows: Figure 2 As shown, the colony diameter is 1.0 to 5.0 mm, white, oval, with a convex, smooth and moist surface and neat edges. After Gram staining, the results are as follows: Figure 3 shown.

[0053] The PDA14 obtained by the above screening was subjected to 16SrDNA sequencing and identification. After comparative analysis, the 16S region sequence obtained from the strain of the present invention is 100% similar to Kluyveromyces marxianus. It can be determined that the strain is a strain of Kluyveromyces marxianus, which can be used in the food fermentation industry. It is named Kluyveromyces marxianus INM3115, which was deposited in the Guangdong Provincial Microbiological Culture Collection Center on August 21, 2024, with a preservation number of CGMCC No65038. Therefore, in this application, Kluyveromyces marxianus INM3115 and PDA14 refer to the same strain. The PDA14 strain of the present invention has been genetically identified, and its gene sequence is as follows:

[0054] CCTGCGGAAGGATCATTAAAGATTATGAATGAATAGATTACTGGGGGAATCGTCTGAACAAGG

[0055] CCTGCGCTTAATTGCGCGGCCAGTTCTTGATTCTCTGCTATCAGTTTTCTATTTCTCATCCTA

[0056] AACACAATGGAGTTTTTTCTCTATGAACTTCCCTGGAGAGCTCGTCTCTCCAGTGGACAT

[0057] AAACACAAACAATATTTTGTATTATGAAAAACTATTATACTATAAAATTTAATATTCAAAACT

[0058] TTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATATGTATTG

[0059] TGAATTGCAGATTTTCGTGAATCATCAAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCA

[0060] GGGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTTGGGTTTGGTAGTGAGTGATAC

[0061] TCGTCTCGGGTTAACTTGAAAGTGGCTAGCCGTTGCCATCTGCGTGAGCAGGGCTGCGTGTCA

[0062] AGTCTATGGACTCGACTCTTGCACATCTACGTCTTAGGTTTGCGCCAATTCGTGGTAAGCTTG

[0063] GGTCATAGAGACTCATAGGTGTTATAAAGACTCGCTGGTGTTTGTCTCCTTGAGGCATACGGC

[0064] TTTAACCAAAACTCTCAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCAT

[0065] ATC

[0066] Example 2 Kluyveromyces marxianus INM3115

[0067] Genetic stability test

[0068] Kluyveromyces marxianus INM3115 in Example 1 was propagated on malt juice liquid medium for 10 generations, and the first, fifth and tenth generation strains were respectively propagated at a bacterial concentration of 10 7 CFU / mL, 1% inoculation amount was inoculated in grape juice, fermented at 28°C for 48h, and the fermented grape juice was added to the medium seed at 10% of the total amount of wheat. Bread was made according to the national standard GB / T14612-2008, and physical and chemical indexes were tested to detect polysaccharide content and trans-2-hexenol content. The method was referred to Example 1. Sensory evaluation was also carried out to determine its stability in passage, and the specific data are shown in Table 3.

[0069] Table 3 Results of the stability test for passage

[0070]

[0071] The results in Table 3 show that the fermentation performance of Kluyveromyces marxianus INM3115 strains of different generations is normal, the content of trans-2-hexenol and polysaccharide varies within 10%, the strain has good genetic stability and meets the requirements for production and use.

[0072] Example 3 Preparation of polysaccharide-rich bread using Kluyveromyces marxianus INM3115

[0073] Kluyveromyces marxianus INM3115 was inoculated at a concentration of 10 4 -10 8 CFU / mL, inoculated into grape juice at 1% inoculation amount, fermented at 28°C for 48h, and added the fermented grape juice into the medium seed at 10% of the total amount of wheat. Made bread according to the national standard GB / T 14612-2008 and tested for physical and chemical indicators, including polysaccharide content, trans-2-hexenol content, and bread hardness, with reference to Example 1. PDA1 was used as the control strain, and the results are shown in Tables 4 and 5.

[0074] Table 4 Polysaccharide and trans-2-hexenol content in bread

[0075]

[0076] Table 5 Bread sensory evaluation results

[0077]

[0078]

[0079] Note: Each item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0080] From the results in Tables 4 and 5, it can be seen that fermentation with Kluyveromyces marxianus INM3115 can significantly increase the content of trans-2-hexenol and polysaccharides in bread, and the more the inoculation amount, the higher the content of trans-2-hexenol and polysaccharides; however, too high or too low inoculation concentration of Kluyveromyces marxianus INM3115 will affect the sourness, sweetness and taste of bread. The most suitable inoculation concentration is 1.0×107 CFU / mL, this concentration can produce sufficient polysaccharide content and improve the flavor and taste of whole grain bread, such as Figure 1 , is the total ion current of trans-2-hexenol in bread made at this inoculation concentration.

[0081] Example 4: Making toast with Kluyveromyces marxianus INM3115

[0082] Kluyveromyces marxianus INM3115 was inoculated at a concentration of 10 7 CFU / mL, inoculated into grape juice at 1% inoculation amount, fermented at 28℃ for 48h, and added the fermented grape juice into the medium seed at 10% of the total amount of wheat. Toast was made according to the national standard GB / T 14612-2008. PDA1 was used as the control group and toast was made in the same way. After fermentation, the method in Example 1 was used to detect the trans-2-hexenol and polysaccharide content stored for 1, 4, and 7 days, and professional appraisers were invited to conduct sensory evaluation of the toast flavor. The results are recorded in Table 6.

[0083] Table 6 Polysaccharide, trans-2-hexenol detection and toast sensory evaluation results

[0084]

[0085] Note: Each sensory evaluation item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0086] From the results in Table 6, we can see that after 10 7 CFU / mL Kluyveromyces marxianus INM3115 can significantly increase the content of trans-2-hexenol and polysaccharides in toast; in addition, it can also improve the sensory evaluation of toast, increase the aroma of toast, and improve the flavor and taste of toast, making the toast fragrant, sweet and sour.

[0087] Example 5 Preparation of meal buns with Kluyveromyces marxianus INM3115

[0088] Kluyveromyces marxianus INM3115 was inoculated at a concentration of 10 7CFU / mL, inoculated into grape juice at 1% inoculation amount, fermented at 28℃ for 48h, and added the fermented grape juice into the medium seed at 10% of the total amount of wheat. Made into meal packs according to the national standard GB / T 14612-2008. PDA1 was used as the control group, and meal packs were made in the same way. After fermentation, the trans-2-hexenol, polysaccharide content, and hardness of the meal packs stored for 1, 4, and 7 days were tested according to the method in Example 1. At the same time, professional appraisers were invited to conduct sensory evaluation of the flavor of the meal packs, and the results are recorded in Table 7.

[0089] Table 7 Polysaccharide, trans-2-hexenol detection and sensory evaluation results of meal packs

[0090]

[0091] Note: Each sensory evaluation item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0092] From the results in Table 7, we can see that after 10 7 CFU / mL Kluyveromyces marxianus INM3115 can significantly increase the trans-2-hexenol and polysaccharide content of the fermented dough when making meal buns; in addition, it can also improve the sensory evaluation of the meal buns, increase the aroma, and enhance the flavor and taste.

[0093] Example 6: Production of European bread using Kluyveromyces marxianus INM3115

[0094] Kluyveromyces marxianus INM3115 was inoculated at a concentration of 10 7 CFU / mL, inoculated into grape juice at 1% inoculation amount, fermented at 28℃ for 48h, and added the fermented grape juice to the medium seed at 10% of the total amount of wheat. European bread was made according to the national standard GB / T 14612-2008. PDA1 was used as the control group, and European bread was made in the same way. After fermentation, the trans-2-hexenol, polysaccharide content, and hardness of the buns stored for 1, 4, and 7 days were tested according to the method in Example 1. At the same time, professional appraisers were invited to conduct sensory evaluation of the flavor of the buns, and the results are recorded in Table 8.

[0095] Table 8 Polysaccharide, trans-2-hexenol detection and sensory evaluation results of European bread

[0096]

[0097] Note: Each sensory evaluation item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0098] From the results in Table 8, we can see that after 10 7 CFU / mL Kluyveromyces marxianus INM3115 can significantly increase the content of polysaccharides and trans-2-hexenol in making European bread; in addition, it can also improve the flavor and taste of European bread.

[0099] Based on the results of the above embodiments, the Kluyveromyces marxianus INM3115 provided by the present invention is applied to the production of toast, dinner rolls, and European bread. On the basis of not changing the existing process, the polysaccharide and trans-2-hexenol content of the relevant products can be significantly increased, and the aroma and taste of the products can be improved, thereby significantly improving the product quality.

[0100] The above-mentioned embodiments only express several implementation methods of the present invention, and the description is relatively specific and detailed, but it cannot be understood as limiting the scope of the invention patent. It should be pointed out that for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present invention. Therefore, the protection scope of the patent of the present invention shall be based on the attached claims.

Claims

1. A strain of Kluyveromyces marxii, characterized in that: Kluyveromyces marxianus INM3115, the strain was deposited in Guangdong Provincial Microbiological Culture Collection Center on August 21, 2024, with the deposit number: GDMCC NO: 65038, and the deposit address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province.

2. The Kluyveromyces marxii strain according to claim 1, characterized in that: The colony characteristics of Kluyveromyces marxianus are as follows: after culturing on a PDA plate for 48 hours, colonies with a diameter of 1.0 to 5.0 mm, white color, oval shape, smooth and moist surface, neat edges and raised areas are formed.

3. A method for preparing Kluyveromyces marxii according to claim 1, characterized in that: Step 1: Isolation of Kluyveromyces marxianus: Kluyveromyces marxianus was isolated and screened from raisin samples. The grape juice was squeezed and cultured in an incubator at 28°C. The fermentation broth was diluted 10 1 -10 7 times, and evenly spread the fermentation broth of different dilution concentrations on the PDA medium, and culture it in an incubator at 28°C for 48 hours, and then select white colonies on the PDA medium for screening; Step 2: Screening of Kluyveromyces marxianus: The obtained Kluyveromyces marxianus was cultured to the logarithmic growth phase, and the final concentration of the strain was 1×10 7 CFU / mL, and then inoculated into grape juice at a 1% inoculation amount, and placed in a 28°C incubator for 48 hours to obtain the fermentation liquid.

4. A use of Kluyveromyces marxii according to claim 1, characterized in that: Production application: According to the bread-making process, add fermentation liquid that has been fermented by Marx Kluyveri for 48 hours, with the added amount being 10% of the total amount of wheat, to increase the content of polysaccharides and trans-2-hexenol in the bread.

5. Use of the Kluyveromyces marxii yeast according to claim 1 to increase the content of trans-2-hexenol in fermented grape juice.

6. Use of the Kluyveromyces marxii yeast according to claim 1 to increase the polysaccharide content of bread after baking.

7. Use of the Kluyveromyces marxii yeast according to claim 1 for making meal packs.

8. Use of the Kluyveromyces marxii yeast according to claim 1 for making toast.

9. Use of the Kluyveromyces marxii yeast according to claim 1 for making European bread.

Images