Construction method and application of genetically engineered bacterium capable of producing violacein

Abstract

The invention belongs to the technical field of biology, and particularly relates to a construction method and application of genetically engineered bacteria for producing violacein. The invention provides a genetically engineered bacterium for producing violacein. The genetically engineered bacterium S.cerevisiae YSG50-vio-viC < + > is obtained by inserting a gene expression cassette related to a violacein synthetic route into Saccharomyces cerevisiae and performing overexpression on a vioC gene, and the genetically engineered bacterium is a genetically engineered bacterium S.cerevisiae YSG50-vio-viC < + >. The invention also provides a method for preparing violacein by using the genetically engineered bacterium, which comprises the following steps of: inoculating the genetically engineered bacterium S.cerevisiae YSG50-vio-viC + into a fermentation culture medium for fermentation culture, and collecting fermentation liquor which contains violacein.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a construction method and application of a genetically engineered bacterium producing violacein. Background Art

[0002] Violacein is a natural indole derivative produced during the metabolism of certain special microorganisms. It presents a beautiful blue-purple color and is a pure natural microbial pigment. Violacein has a variety of biological activities such as anti-tumor, antibacterial, antibiotic potential, antifungal, anti-algae, anti-cancer and antiviral. It can not only exert antibacterial and antimicrobial activity alone, but also work synergistically with other antibiotics to double the antibacterial activity. It has great application and development value in the field of biomedicine; and its unique blue-purple color is also widely used in cosmetics, textile printing and dyeing and other industries.

[0003] However, since the original strains producing violacein usually have disadvantages such as harsh culture conditions, slow growth, and unstable pigment production, the large-scale industrial production of violacein is limited. Therefore, research on constructing recombinant strains to increase violacein production through genetic engineering or synthetic biology has attracted much attention.

[0004] The yeast expression system can express proteins at high levels and has post-translational modification functions, making it a powerful tool for large-scale protein expression. When expressing genetically engineered products, compared with other microorganisms, Saccharomyces cerevisiae has the advantages of clear genetic background, simple and mature genetic operation system, high safety, and easy large-scale cultivation to reduce production costs. It is widely used in research related to the expression of exogenous proteins. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a construction method of a genetically engineered bacterium capable of producing violacein and the application of the biological method for producing violacein.

[0006] To solve the above technical problems, the present invention provides a genetically engineered bacterium producing violacein: after inserting a gene expression cassette related to the violacein synthesis pathway into Saccharomyces cerevisiae and overexpressing the vioC gene, the resulting genetically engineered bacterium S. cerevisiae YSG50-vio-vioC+ is obtained.

[0007] That is, the genetically engineered bacteria producing violacein are obtained by inserting a gene expression cassette related to the violacein synthesis pathway into strains of S. cerevisiae and its homologous families and genera and overexpressing the vioC gene.

[0008] Note: The chassis microorganism for constructing the violacein-producing gene cluster is not limited to Saccharomyces cerevisiae YSG50, and all microorganisms that can express the violacein-producing gene cluster can be used.

[0009] Improvements of the genetically engineered bacteria producing Violacein of the present invention:

[0010] The gene expression cassette related to the violacein synthesis pathway is:

[0011] vioA gene expression cassette (SEQ ID No.2), vioB gene expression cassette (SEQ ID No.3), vioC gene expression cassette (SEQ ID No.4), vioD gene expression cassette (SEQ ID No.5), vioE gene expression cassette (SEQ ID No.6).

[0012] As a further improvement of the genetically engineered bacteria producing Violacein of the present invention:

[0013] Also included are a URA gene expression cassette (SEQ ID No. 1) and a vioC overexpression gene expression cassette (SEQ ID No. 7).

[0014] That is, the nucleotide sequence of the gene expression cassette related to the violacein synthesis pathway is as described in SEQ ID No. 1 to SEQ ID No. 7. It also includes homologous and functional genes of SEQ ID No. 1 to SEQ ID No. 7.

[0015] As a further improvement of the genetically engineered bacteria producing Violacein of the present invention:

[0016] The violacein gene cluster originates from Duganella sp., but is not limited to this strain. The nucleotide sequence of the gene cluster that can synthesize violacein is similar to the sequence in this strain.

[0017] Description: The violacein gene cluster contains vioA, vioB, vioC, vioD, and vioE, which exist in Duganella sp. On this basis, a gene expression cassette was constructed.

[0018] The present invention also provides a method for preparing violacein using the above genetically engineered bacteria, comprising the following steps:

[0019] The genetically engineered bacteria S.cerevisiae YSG50-vio-vioC+ is inoculated into a fermentation medium for fermentation culture, and the fermentation liquid is collected, wherein the fermentation liquid contains violacein.

[0020] As an improvement of the preparation method of violacein of the present invention: the fermentation liquid is separated and purified to obtain violacein.

[0021] As a further improvement of the preparation method of purple bacteriocin of the present invention: the inoculation amount in the fermentation medium is 0.5% to 2.5% (volume %), the fermentation culture temperature is 30 to 40° C., and the fermentation culture time is 12 to 48 hours.

[0022] As a further improvement of the preparation method of violacein of the present invention: the fermentation medium contains glucose at a concentration of 10 g / L to 30 g / L.

[0023] That is, the fermentation medium ferments with glucose as a substrate to produce violacein.

[0024] As a further improvement of the preparation method of violacein of the present invention: the separation and purification method utilizes a rotary evaporator ethanol reconstitution method, and then violacein is prepared by a freeze-drying method.

[0025] The method for constructing genetically engineered bacteria of the present invention uses Saccharomyces cerevisiae as a starting strain, and utilizes a multi-copy syngeneic integration method on the chromosome of Saccharomyces cerevisiae to knock in an expression cassette related to the synthesis pathway of Bacillus violaceus. The specific knock-in process is detailed in Example 1.

[0026] The genetically engineered bacteria obtained by the method of the invention can produce violacein by fermentation under the conditions of using glucose as substrate, inoculation amount of 0.5% to 2.5%, adding exogenous tryptophan in an amount of 0g / L to 1.6g / L, and culturing at 30°C to 40°C for 12 to 60h.

[0027] The metabolites obtained by fermentation of the genetically engineered bacteria constructed by the present invention are used to obtain a crude extract of violacein (such as Fig.12 ), the specific process is detailed in Example 2.

[0028] The genetically engineered bacteria product obtained by the present invention is further subjected to a composition analysis of violacein, and is qualitatively characterized by UPLC-Q / TOF-MS. Masslynx V4.2 is used to process the total ion currents in positive and negative ion modes, and UNIFIPortal software is used to perform data analysis in combination with Mass value, retention time and molecular formula matching software to qualitatively detect violacein. The specific process is described in Example 3.

[0029] The genetically engineered bacteria obtained by the invention can produce 0.1-145.28 mg / L of violacein by fermentation under the conditions of glucose as substrate, inoculation amount of 0.5%-2.5%, and cultivation at 30-40°C for 12-60h, that is, 0.1-145.28 mg of violacein can be prepared per liter of fermentation liquid.

[0030] The beneficial effects of the present invention are mainly reflected in the following aspects: At present, the strains that produce violacein through biological fermentation are mainly concentrated in Bacillus violaceus and Dunaliella violaceum, and there are few reports in recent years on the research method of producing violacein using Saccharomyces cerevisiae. In addition, there is no report on the method of producing violacein by integrating gene expression cassettes related to the violacein synthesis metabolic pathway using δ and rDNA multi-copy sites. δ and rDNA multi-copy site integration is an extremely efficient chromosome integration method and Saccharomyces cerevisiae is the most widely used eukaryotic model organism. The method of the present invention provides producers with a new path for producing mannose through biosynthesis and broadens researchers' new ideas for studying biosynthetic violacein.

[0031] In summary, the present invention discloses a method for producing violacein by Saccharomyces cerevisiae by inserting a gene expression cassette related to the violacein synthesis pathway and its application. The starting strain of the invention is Saccharomyces cerevisiae, and the genetically engineered bacteria producing violacein is a violacein synthesis pathway related gene expression cassette inserted into Saccharomyces cerevisiae, wherein the gene violacein synthesis pathway related gene expression cassette is shown in SEQ ID No.1-SEQ ID No.7 in the sequence table. The construction method of the violacein-producing genetically engineered bacteria provided by the present invention obtains a genetically engineered bacteria, which can use glucose as a substrate to produce violacein during the fermentation process. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] The specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0033] Figure 1 Agarose gel electrophoresis diagram of the URA gene expression cassette;

[0034] Figure 2 Agarose gel electrophoresis of vioA expression cassette;

[0035] A: TDH3 promoter and terminator, B: vioA gene, C: PTDH3-vioA gene fragment, D: vioA gene expression cassette;

[0036] Figure 3 Agarose gel electrophoresis of vioB expression cassette;

[0037] A: TEF2 promoter and terminator, B: vioB gene, C: “PTEF2-vioB gene fragment”, D: vioB gene expression cassette;

[0038] Figure 4Agarose gel electrophoresis of the vioC expression cassette;

[0039] A: ADH3 promoter and terminator, B: vioC gene, C: "vioC-TADH3 gene fragment" D: vioC gene expression cassette;

[0040] Figure 5 Agarose gel electrophoresis of the vioD expression cassette;

[0041] A: TEF promoter and terminator, B: vioD gene, C: "vioD-TEF gene fragment" D: vioD gene expression cassette;

[0042] Figure 6 This is the agarose gel electrophoresis image of the vioE expression cassette;

[0043] A: TPI promoter terminator, vioE gene, δ2 sequence, B: "TTPI-δ2 gene fragment PTPI-vioE gene fragment", C: vioE gene expression cassette;

[0044] Figure 7 Construct gel electrophoresis plots for the vioC overexpression cassette;

[0045] A: TEF promoter terminator, vioC gene, rDNA1 sequence, rDNA2 sequence, LEU gene; B: gene linear fragment "rDNA2-LEU-PTE"; C: "vioC-TTEF-rDNA1"; D: vioC overexpression gene expression cassette;

[0046] Figure 8 This is the colony PCR and colony comparison of Saccharomyces cerevisiae positive transformants;

[0047] A: Colony PCR gel electrophoresis diagram B: Comparison diagram of each positive transformant colony C: Comparison diagram of wild-type S. cerevisiae YSG50 and recombinant S. cerevisiae YSG50-vio;

[0048] Fig. 9 This is the colony PCR and colony comparison of Saccharomyces cerevisiae positive transformants;

[0049] A: Colony PCR gel electrophoresis image B: Positive transformant colony spread image C: Comparison of wild-type Saccharomyces cerevisiae YSG50, recombinant Saccharomyces cerevisiae strain S.cerevisiae YSG50-vio and recombinant Saccharomyces cerevisiae strain S.cerevisiae YSG50-vio-vioC+.

[0050] Fig.10This is the UPLC-Q / TOF-MS positive ion mode purple bacteriocin detection diagram (A purple bacteriocin mass spectrum, B purple bacteriocin base peak ion current diagram);

[0051] Fig.11 This is the UPLC-Q / TOF-MS negative ion mode purple bacteriocin detection diagram (A purple bacteriocin mass spectrum, B purple bacteriocin base peak ion current diagram);

[0052] Fig.12 It is a crude extract of purple bacteriocin;

[0053] Fig.13 This is the sequence information of SEQ ID No.1 to SEQ ID No.31. DETAILED DESCRIPTION

[0054] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0055] The genome sequences of Duganella sp.B2, S.cerevisiae YSG50, E.coil pRS426, E.coil PGADT7, etc. are available on NCBI.

[0056] For example, Duganella sp.B2 comes from CGMCC1.6993 DSM19531, and is also reported in "Optimization of culture conditions for violacein production by a new strain of Duganella sp.B2"; S.cerevisiae YSG50 and E.coil pRS426 are reported in "Combined Assembly and Targeted Integration of Multigene for Nitrogenase S.Biosynthetic Pathway in Saccharomyces cerevisiae". PRS426 plasmid and PGADT7 plasmid can be purchased from Clontech, and are reported in "Combined Assembly and Targeted Integration of Multigene for Nitrogenase Biosynthetic Pathway in Saccharomyces cerevisiae".

[0057] Example 1: Reconstruction of the violacein synthesis pathway in Saccharomyces cerevisiae

[0058] 1. Reconstruction of the violacein biosynthesis pathway in Saccharomyces cerevisiae

[0059] (1) Construction of the gene expression cassette related to violacein

[0060] A single colony of Duganella sp. B2 was picked and cultured in R2A liquid medium at 18°C, 200 rpm overnight (about 12-14 hours). 1 mL of Duganella sp. B2 bacterial solution was taken and its genomic DNA was extracted using the Ezup column bacterial genomic DNA extraction kit (Shanghai Sangon Biotech Co., Ltd., Shanghai).

[0061] (2) A single colony of S. cerevisiae YSG50 was picked and cultured in YPD liquid medium at 30°C, 200 rpm overnight. 1 mL of S. cerevisiae YSG50 bacterial culture was taken and its genomic DNA was extracted using a fungal genomic DNA extraction kit (Xinjing Biological Reagent Development Co., Ltd., Hangzhou).

[0062] (3) Pick a single colony of E.coil pRS426 and culture it in LB liquid medium at 37°C, 200 rpm overnight. Take 1 mL of E.coil pRS426 bacterial solution and use a plasmid extraction kit (Xinjing Biological Reagent Development Co., Ltd., Hangzhou) to extract its plasmid pRS426.

[0063] (4) Pick a single colony of E.coil PGADT7 and culture it in LB liquid medium at 37°C, 200 rpm overnight. Take 1 mL of E.coil PGADT7 bacterial solution and use a plasmid extraction kit (Xinjing Biological Reagent Development Co., Ltd., Hangzhou) to extract its plasmid PGADT7.

[0064] 1) Using plasmid pRS426 DNA as template and URA-F and URA-R as upstream and downstream primers, amplify the URA sequence (SEQ ID No. 8, 2036 bp);

[0065] 2) Using S.cerevisiae YSG50 genomic DNA as template:

[0066] The promoter PTDH3 sequence (SEQ ID No. 9, 681 bp) was amplified using PTDH3-F and PTDH3-R as upstream and downstream primers respectively;

[0067] Using TTDH3-F and TTDH3-R as upstream and downstream primers, respectively, the terminator TTDH3 sequence (SEQ ID No. 10, 750 bp) was amplified;

[0068] The promoter PTEF2 sequence (SEQ ID No. 11, 560 bp) was amplified using PTEF2-F and PTEF2-R as upstream and downstream primers, respectively;

[0069] Using TTEF2-F and TTEF2-R as upstream and downstream primers, respectively, the terminator TTEF2 sequence (SEQ ID No. 12, 595 bp) was amplified;

[0070] The promoter PADH1 sequence (SEQ ID No. 13, 1446 bp) was amplified using PADH1-F and PADH1-R as upstream and downstream primers respectively;

[0071] Using TADH1-F and TADH1-R as upstream and downstream primers, respectively, the terminator TADH1 sequence (SEQ ID No. 14, 327 bp) was amplified;

[0072] The promoter PTEF sequence (SEQ ID No. 15, 614 bp) was amplified using PTEF-F and PTEF-R as upstream and downstream primers respectively;

[0073] Using TTEF-F and TTEF-R as upstream and downstream primers, respectively, the terminator TTEF sequence (SEQ ID No. 16, 539 bp) was amplified;

[0074] The promoter PTPI sequence (SEQ ID No. 17, 428 bp) was amplified using PTPI-F and PTPI-R as upstream and downstream primers, respectively;

[0075] Using TTPI-F and TTPI-R as upstream and downstream primers, respectively, the terminator TTPI sequence (SEQ ID No. 18, 394 bp) was amplified;

[0076] Using δ1-F and δ1-R as upstream and downstream primers, respectively, the δ1 sequence (SEQ ID No. 19, 206 bp) was amplified;

[0077] Using δ2-F and δ2-R as upstream and downstream primers, respectively, the δ2 ​​sequence (SEQ ID No. 20, 230 bp) was amplified.

[0078] Using rDNA1-F and rDNA1-R as upstream and downstream primers, respectively, the rDNA1 sequence (SEQ ID No. 21, 1001 bp) was amplified, and using rDNA2-F and rDNA2-R as upstream and downstream primers, respectively, the rDNA2 sequence (SEQ ID No. 22, 1240 bp) was amplified.

[0079] 3) Using the Duganella sp.B2 genome as a template,

[0080] Using VioA-F and VioA-R as upstream and downstream primers, respectively, the vioA sequence (SEQ ID No. 23, 1308 bp) was amplified;

[0081] Using VioB-F and VioB-R as upstream and downstream primers, respectively, the vioB sequence (SEQ ID No. 24, 3018 bp) was amplified;

[0082] Using VioC-F and VioC-R as upstream and downstream primers, respectively, the vioC sequence (SEQ ID No. 25, 1290 bp) was amplified;

[0083] Using VioD-F and VioD-R as upstream and downstream primers, respectively, the vioD sequence (SEQ ID No. 26, 1119 bp) was amplified;

[0084] Using VioE-F and VioE-R as upstream and downstream primers, respectively, the vioE sequence (SEQ ID No. 27, 576 bp) was amplified;

[0085] 4) Using plasmid PGADT7 DNA as template,

[0086] LEU sequence (SEQ ID No. 28, 1501 bp) was amplified using LEU-F and LEU-R as upstream and downstream primers, respectively;

[0087] 5) Using URA-F and δ1-R as primers, and URA (SEQ ID No.8, 2036 bp) and δ1 (SEQ ID No.19, 206 bp) as templates, overlap PCR was performed to amplify the linear fragment "URA-δ1", "URA-δ1" being the URA gene expression cassette (SEQ ID No.1, 2036 bp). The amplification system was 2×Phanta Max Master Mix (Dye Plus) 12.5 μL, URA-F 1 μL, δ1-R 1 μL, URA 1 μL, δ1 1 μL, and ddH2O 8.5 μL.

[0088] The amplification conditions were 95℃ for 3min; 95℃ for 45s, 57℃ for 1min, 72℃ for 2min, and 30 cycles. The PCR products were detected by agarose gel electrophoresis and the target bands with the same size as the URA gene expression cassette fragment were selected for gel tapping and recovery. Figure 1 shown.

[0089] 6) Using vioA-F, vioA-R, PADH3-F, and TADH3-R as primers, and PTADH3 (SEQ ID No.9, 681 bp), vioA (SEQ ID No.23, 1308 bp), and TADH3 (SEQ ID No.10, 750 bp) as templates, overlap PCR was performed to amplify the linear fragment "PTHD3-vioA-TTDH3". The linear fragment "PTHD3-vioA-TTDH3" was the vioA gene expression cassette (SEQ ID No.2, 2739 bp). The first amplification system was 2×Phanta Max Master Mix (Dye Plus) 12.5 μL, PTDH3-F 1 μL, vioA-R 1 μL, PTDH3 1 μL, vioA 1 μL, and ddH2O 8.5 μL. The second amplification system was 2×Phanta MaxMaster Mix (Dye Plus) 12.5 μL, PTDH3-F 1 μL, TTDH3-R 1 μL, the first amplification product 1 μL, TTDH3 1 μL, ddH2O 8.5 μL. The high-fidelity enzymes used above were all from Nanjing Novozyme Biotechnology Co., Ltd.

[0090] The first amplification conditions were 95°C for 3 min, 95°C for 45 s, 60°C for 1 min, 72°C for 2 min, 30 cycles, and 72°C for 5 min. The second amplification conditions were 95°C for 3 min, 95°C for 45 s, 63°C for 1 min, 72°C for 3 min, 30 cycles, and 72°C for 5 min. The PCR products were detected by agarose gel electrophoresis and the target band with the same size as the vioA gene expression cassette fragment was selected for gel tapping and recovery. The results are as follows Figure 2 shown.

[0091] 7) Using vioB-F, vioB-R, PTEF2-F, and TTEF2-R as primers, and PTEF2 (SEQ ID No.11, 560bp), vioB (SEQID No.24, 3018bp), and TTEF2 (SEQ ID No.12, 595bp) as templates, overlap PCR was performed to amplify the linear fragment "PTEF2-vioB-TTEF2". The linear fragment "PTEF2-vioB-TEF2" was the vioB gene expression cassette (SEQ IDNo.3, 4173bp). The first amplification system was 2×Phanta Max Master Mix (Dye Plus) 12.5μL, PTEF2-F 1μL, vioB-R 1μL, PTEF2 1μL, vioB 1μL, and ddH2O 8.5μL. The second amplification system was 2×Phanta MaxMaster Mix (Dye Plus) 12.5 μL, PTEF2-F 1 μL, TTEF2-R 1 μL, the first amplification product 1 μL, TTEF2 1 μL, ddH2O 8.5 μL. The high-fidelity enzymes used above were all from Nanjing Novozyme Biotechnology Co., Ltd.

[0092] The conditions for the first amplification were 95°C for 3 min, 95°C for 45 s, 57°C for 1 min, 72°C for 4 min, 30 cycles, and 72°C for 5 min. The conditions for the second amplification were 95°C for 3 min, 95°C for 45 s, 55°C for 1 min, 72°C for 5 min, 30 cycles, and 72°C for 5 min. The PCR products were detected by agarose gel electrophoresis and the target bands with the same size as the vioB gene expression cassette fragment were selected for gel tapping and recovery. The results are as follows Figure 3 shown.

[0093] 8) Using vioC-F, vioC-R, PADH1-F, and TADH1-R as primers, and PADH1 (SEQ ID No.13, 1446 bp), vioC (SEQ ID No.25, 1290 bp), and TADH1 (SEQ ID No.14, 327 bp) as templates, overlap PCR was performed to amplify the linear fragment "PADH1-vioC-TADH1". The linear fragment "PADH1-vioC-TADH1" was the vioC gene expression cassette (SEQ ID No.4, 3063 bp). The first amplification system was 2×Phanta Max Master Mix (Dye Plus) 12.5 μL, TADH1-R 1 μL, vioC-F 1 μL, PADH1 1 μL, vioC 1 μL, and ddH2O 8.5 μL. The second amplification system was 2×Phanta Max Master Mix (Dye Plus) 12.5 μL, PADH1-F 1 μL, TADH1-R 1 μL, the first amplification product 1 μL, TADH1 1 μL, ddH2O 8.5 μL. The high-fidelity enzymes used above were all from Nanjing Novozyme Biotechnology Co., Ltd.

[0094] The first amplification conditions were 95℃3min; 95℃45s, 50℃1min, 72℃3min, 30 cycles; 72℃5min; the second amplification conditions were 95℃3min; 95℃45s, 55℃1min, 72℃3min, 30 cycles; 72℃5min; the PCR product was detected by agarose gel electrophoresis and the target band with the same size as the vioC gene expression cassette fragment was selected for gel tapping and recovery. The results are as follows Figure 4 shown.

[0095] 9) Using vioD-F, vioD-R, PTEF-F, and TTEF-R as primers, and PTEF (SEQ ID No.15, 614 bp), vioD (SEQID No.26, 1119 bp), and TTEF (SEQ ID No.16, 539 bp) as templates, overlap PCR was performed to amplify the linear fragment "PTEF-vioD-TTEF". The linear fragment "PTEF-vioD-TTEF" was the viod gene expression cassette (SEQ ID No.5, 2272 bp). The first amplification system was 2×Phanta Max Master Mix (Dye Plus) 12.5 μL, TTEF-R 1 μL, vioD-F 1 μL, PTEF 1 μL, vioD 1 μL, and ddH2O 8.5 μL. The second amplification system was 2×Phanta Max MasterMix (Dye Plus) 12.5 μL, PTEF-F 1 μL, TTEF-R 1 μL, first amplification product 1 μL, TTEF 1 μL, ddH2O 8.5 μL. The high-fidelity enzymes used above were all from Nanjing Novozyme Biotechnology Co., Ltd.

[0096] The first amplification conditions were 95°C for 3 min, 95°C for 45 s, 50°C for 1 min, 72°C for 3 min, 30 cycles, and 72°C for 5 min. The second amplification conditions were 95°C for 3 min, 95°C for 45 s, 55°C for 1 min, 72°C for 3 min, 30 cycles, and 72°C for 5 min. The PCR products were detected by agarose gel electrophoresis and the target bands with the same size as the vioD gene expression cassette fragment were selected for gel tapping and recovery. The results are as follows Figure 5 shown.

[0097] 10) Using vioE-F, vioE-R, PTPI-F, and δ2-R as primers, and PTPI (SEQ ID No.17, 428 bp), vioE (SEQ IDNo.27, 576 bp), TTPI (SEQ ID No.18, 394 bp), and δ2 as templates, overlap PCR was performed to amplify the linear fragment "PTPI-vioE-TTPI". The linear fragment "PTPI-vioE-TTPI" was the vioE gene expression cassette (SEQ ID No.6, 1628 bp). The first amplification system was 2×Phanta MaxMaster Mix (Dye Plus) 12.5 μL, PTPI-F 1 μL, vioE-R 1 μL, PTPI 1 μL, vioE 1 μL, and ddH2O 8.5 μL. The second amplification system was 2×Phanta Max Master Mix (Dye Plus) 12.5 μL, TTPI-F 1 μL, δ2-R 1 μL, δ2 1 μL, TTPI 1 μL, ddH2O 8.5 μL. The third amplification system was 2×Phanta Max Master Mix (Dye Plus) 12.5 μL, TTPI-R 1 μL, PTPI-F 1 μL, first amplification product 1 μL, second amplification product 1 μL, ddH2O 8.5 μL. The high-fidelity enzymes used above were all from Nanjing Novozyme Biotechnology Co., Ltd.

[0098] The first amplification conditions were 95°C for 3 min, 95°C for 45 s, 55°C for 1 min, 72°C for 1 min, 30 cycles, and 72°C for 5 min. The second amplification conditions were 95°C for 3 min, 95°C for 45 s, 48°C for 1 min, 72°C for 3 min, 30 cycles, and 72°C for 5 min. The third amplification conditions were 95°C for 3 min, 95°C for 45 s, 48°C for 2 min, 72°C for 3 min, 30 cycles, and 72°C for 5 min. The PCR products were detected by agarose gel electrophoresis and the target bands with the same size as the vioE gene expression cassette fragment were selected for gel tapping and recovery. The results are as follows: Figure 6 shown.

[0099] 11) Using rDNA2-F, LEU-R, and O-PTEF-R as primers, and rDNA2 (SEQ ID No.22, 1240 bp), LEU (SEQ ID No.28, 1501 bp), and PTEF (SEQ ID No.15, 614 bp) as templates, overlap PCR was performed to amplify the linear fragment "rDNA2-LEI-O-PTEF" (SEQ ID No.29, 3190 bp). The first amplification system was 2×Phanta MaxMaster Mix (Dye Plus) 12.5 μL, rDNA2-F 1 μL, LEU-R 1 μL, rDNA 1 μL, LEU 1 μL, and ddH2O 8.5 μL. The second amplification system was 2×PhantaMax Master Mix (Dye Plus) 12.5 μL, rDNA2-F 1 μL, O-PTEF-R 1 μL, first amplification product 1 μL, PTEF 1 μL, ddH2O 8.5 μL. The high-fidelity enzymes used above were all from Nanjing Novozyme Biotechnology Co., Ltd.

[0100] The first amplification conditions were 95°C for 3 min, 95°C for 45 s, 57°C for 1 min, 72°C for 3 min, 30 cycles, and 72°C for 5 min. The second amplification conditions were 95°C for 3 min, 95°C for 45 s, 54°C for 1 min, 72°C for 3 min, 30 cycles, and 72°C for 5 min. The PCR products were detected by agarose gel electrophoresis and the target band with the same size as the "rDNA2-LEU-O-PTEF" fragment was selected for gel tapping and recovery.

[0101] 12) Using O-vioC-F, TTEF-R, and rDNA1-R as primers, and vioC (SEQ ID No.25, 1290 bp), TTEF (SEQ IDNo.16, 539 bp), and rDNA1 (SEQ ID No.21, 1001 bp) as templates, overlap PCR was performed to amplify the linear fragment "O-vioC-O-TTEF-rDNA1" (SEQ ID No.30, 2860 bp). The first amplification system was 2×Phanta MaxMaster Mix (Dye Plus) 12.5 μL, O-vioC-F 1 μL, O-TTEF-R 1 μL, O-vioC 1 μL, O-TTEF 1 μL, and ddH2O 8.5 μL. The second amplification system was 2×Phanta Max Master Mix (Dye Plus) 12.5 μL, O-vioC-F 1 μL, rDNA1-R 1 μL, first amplification product 1 μL, rDNA 11 μL, ddH2O 8.5 μL. The high-fidelity enzymes used above were all from Nanjing Novozyme Biotechnology Co., Ltd.

[0102] The conditions for the first amplification were 95℃ for 3 min; 95℃ for 45 s, 53℃ for 1 min, 72℃ for 2 min, 30 cycles; 72℃ for 5 min; the conditions for the second amplification were 95℃ for 3 min; 95℃ for 45 s, 55℃ for 1 min, 72℃ for 3 min, 30 cycles; 72℃ for 5 min; the PCR products were detected by agarose gel electrophoresis and the target band with the same size as the "vioC-TTEF-rDNA1" fragment was selected for gel cutting and recovery.

[0103] 13) Using rDNA2-F and rDNA1-R as primers, and using the linear fragment "rDNA2-LEI-O-PTEF" and the linear fragment "O-vioC-O-TTEF-rDNA1" as templates, overlap PCR was performed to amplify the linear fragment. The amplified fragment was the vioC overexpression gene expression cassette (SEQ ID No.7, 5997bp), and the amplification system was 2×Phanta Max Master Mix (Dye Plus) 12.5μL, rDNA2-F 1μL, rDNA1-R 1μL, "rDNA2-LEI-O-PTEF" 1μL, "O-vioC-O-TTEF-rDNA1" 1μL, and ddH2O 8.5μL. The high-fidelity enzymes used above were all from Nanjing Novozyme Biotechnology Co., Ltd.

[0104] The amplification conditions were 95°C for 3 min; 95°C for 45 s, 58°C for 1 min, 72°C for 6 min, 30 cycles; 72°C for 5 min. The PCR product was detected by agarose gel electrophoresis and the target band with the same size as the vioC overexpression gene expression cassette was selected for gel cutting and recovery. The results are as follows Figure 7 shown.

[0105] The primer sequences are as follows:

[0106] URA-F:AAACAGAAGAATGTGAGAAGGC

[0107] URA-R: CAGTATTGATAATGATAAACTCGAACTGAGAGTGCACCATACCACAGCTTTTCA

[0108] PTDH3-F:TGAAAAGCTGTGGTATGGTGCACTCTCAGTTCGAGTTTATCATTATCAATACTG

[0109] PTDH3-R: TATGCAAATGTCAGAATAATTTGTCATTTTGTTTGTTTATGTGTGTTTATTCG

[0110] VioA-F: CGAATAAACACACATAAACAAACAAAATGACAAATTATTCTGACATTTGCATA

[0111] VioA-R: TAAATGCAAGATTTAAAGTAAATTCATCATGCGCGCTCAGTAA

[0112] TTDH3-F:TTACTGAGCGCGCATGATGAATTTACTTTAAATCTTGCATTTA

[0113] TTDH3-R: CATCTACTATATGTAAGTATACGGCCCCCATAAACTGTATACTAGAAATTGGAC

[0114] PTEF2-F: GTCCAATTTCTAGTATACAGTTTATGGGGGCCGTATACTTACATATAGTAGATG

[0115] PTEF2-R:GGAAAGTCGAGAATGCTCATGTTTAGTTAATTATAGTTCGTTGACCGTATA

[0116] VioB-F:TATACGGTCAACGAACTATAATTAACTAAACATGAGCATTCTCGACTTTCC

[0117] VioB-R:ATATGGAAGCAATAATTATTACTCTCAGGCCTCTCTTGACATCTT

[0118] TTEF2-F:AAGATGTCAAGAGAGGCCTGAGAGTAATAATTATTGCTTCCATAT

[0119] TTEF2-R:GATTTCCTATTTCATTTACCCTTTGATGATCTTGAAATAGAAACT

[0120] PADH3-F:AGTTTCTATTTCAAGATCATCAAAGGGTAAATGAAATAGGAAATC

[0121] PADH3-R:CCCACGATGATGATTTTGTGCATGTATATGAGATAGTTGATTGTAT

[0122] VioC-F:ATACAATCAACTATCTCATATACATGCACAAAATCATCATCGTGGG

[0123] VioC-R:AACCTCTGGCGAAGAAGTCCAAAGCTTAGTTTACCCTTCCAAGTTTGTAC

[0124] TADH3-F:GTACAAACTTGGAAGGGTAAACTAAGCTTTGGACTTCTTCGCCAGAGGTT

[0125] TADH3-R:CAGCCAAAGTTGGGTGCATGCCGGTAGAGGTGTGGTCAAT

[0126] PTEF-F:ATTGACCACACCTCTACCGGCATGCACCCAACTTTGGCTG

[0127] PTEF-R:CTGATGGGTTCCTAGATATAGATAGTGAGTCAAGAGGCTTCTTCT

[0128] PTPI-F:AGAAGAAGCCTCTTGACTCACTATCTATATCTAGGAACCCATCAG

[0129] PTPI-R:GGTGGCGTGCGGTGGCATTTAGTTTATGTATGTGTTTTTTGTAGTTATATAG

[0130] VioE-F:CTATAACTACAAAAAACACATACATAAACTAAATGCCACCGCACGCCACC

[0131] VioE-R:GAAAAGAAGATAATATTTTTTATATAATTATTATTATTATTCCGACACGAAAACGCTGGCC

[0132] TTPI-F:GGCCAGCGTTTCGTGTCGGAATAATAATAATTATATAAAAAATATTATCTTCTTTTTC

[0133] TTPI-R:GTATACGGAATCATAGATGGGTATAACAGTTGAAATTTGGATAAG

[0134] δ2-F:CTTATCCAAATTTCAACTGTTATACCCATCTATGATTCCGTATAC

[0135] δ2-R:TGGAAAGTCATTAGGTGAG

[0136] δ1-F:CGACCTCGAGGGGGGGCCCAAACAGAAGAATGTGAGAAGGCT

[0137] δ1-R:CTCACTATAGGGCGAATTGGGTACCGTCCGTAAAATGACCAACCAGATG

[0138] rDNA1-F:AGAAGAAGCCTCTTGACTCACTATCGGTTGCGGCCATATCTACCAGAAAGC

[0139] rDNA1-R:CGTTGCAAAGATGGGTTGAAAGAG

[0140] LEU-F:CACCTGCGTTTCCGTTAAACTATCAACTGTGGGAATACTCAGGTATCGT

[0141] LEU-R: GAAGCTATGGTGTGTGGTTAAGCAAGGATTTTCTTAACTTCTTCG

[0142] O-PTEF-F:CGAAGAAGTTAAGAAAATCCTTGCTTAACCACACACCATAGCTTC

[0143] O-PTEF-R: CCCACGATGATGATTTTGTGCATCCCATTTTGTAATTAAAACTTAGATTAGAT

[0144] O-VioC-F:ATCTAATCTAAGTTTTAATTACAAAATGGGATGCACAAAATCATCATCGTGGG

[0145] O-VioC-R: GCAACTAGAAAAGTCTTATCAATCTCCTTAGTTTACCCTTCCAAGTTTGTAC

[0146] O-TTEF-F:GTACAAACTTGGAAGGGTAAACTAAGGAGATTGATAAGACTTTTCTAGTTGC

[0147] O-TTEF-R:GCTTTCTGGTAGATATGGCCGCAACCGATAGTGAGTCAAGAGGCTTCTTCT

[0148] rDNA2-F:GTACCTCCCAACTACTTTCCTCAC

[0149] rDNA2-R: ACGATACCTGAGTATTCCCACAGTTGATAGTTTAACGGAAACGCAGGTG

[0150] 2. Delta multi-copy site integration

[0151] 2.1) Activate the S.cerevisiae YSG50 strain on a YPD solid plate. Inoculate a single YSG50 colony in 4 mL YPD liquid medium and culture overnight at 30°C, 200 rpm. Inoculate the YSG50 strain at a 1% (v / v) inoculum in 50 mL YPD and culture at 30°C, 200 rpm for about 8-9 hours until the OD 600Around 0.8. Collect the culture solution in a clean and sterile 50mL centrifuge tube, centrifuge at 4000×g, 4℃ for 5min, and discard the supernatant. Wash the bacteria 2-3 times with pre-cooled (4℃) ddH2O, and discard the supernatant. Wash the bacteria once with pre-cooled 1M sorbitol solution, and discard the supernatant. Resuspend the bacteria with 250ul pre-cooled 1M sorbitol solution, and dispense 100uL into 1.5mL EP tubes, which are the electroporation competent state of Saccharomyces cerevisiae YSG50. The electroporation competent state is prepared and used immediately.

[0152] 2.2) Take 0.8uL of each of URA gene expression cassette, vioA gene expression cassette, vioB gene expression cassette, vioC gene expression cassette, vioD gene expression cassette, and vioE gene expression cassette (all concentrations are greater than 200ng / uL) on ice and mix them into DNAmix, and place on ice for 10min. Take 4.8uL of DNAmix fragment and add it to 100uL of yeast electroporation competent cells; then transfer it to a 2mm dry and clean electroporation cup. The electroporation instrument parameters are set to 1500V 5ms. Immediately after the electroporation, add 1mL of pre-cooled YPA medium and mix well, and transfer it to a 10mL sterile and clean centrifuge tube. Place it on a shaker at 160rpm and 30℃ for 1h to recover. Centrifuge at 3500×g and discard the supernatant. Wash the bacteria 3 times with 1M sorbitol solution and resuspend it in 1mL YPD medium. Take 50uL of bacterial solution and spread it on the yeast defective medium SD-Ura medium, and invert and culture it at 30℃ for 2-4d.

[0153] 2.3) Randomly pick the single colony transformants obtained from step 2.2) and number them 1-6. Pick the single colony transformants and add them to 50 μL of sterilized 20 mM NaOH solution and mix well; place the bacterial solution in a PCR instrument and follow the program: 99°C, 5 min; 4°C, 1 min for 3 cycles. Take out the bacterial solution, centrifuge it at 8000×g for 1 min, and take the supernatant as the PCR template.

[0154] 2.4) Perform colony PCR identification to amplify the vioA, vioB, vioC, vioD, and vioE gene sequences. The identification primers are:

[0155] vioA:

[0156] 5′-ATGACAAATTATTCTGACATTTGCATA-3′ (upstream primer) 5′-TCATGCGCGCTCAGTAAGAGA-3′ (downstream primer);

[0157] vioB:

[0158] 5′-ATGAGCATTCTCGACTTTCCCC-3′ (upstream primer) 5′-TCAGGCCTCTCTTGACATCTTT-3′ (downstream primer);

[0159] vioC:

[0160] 5′-ATGCACAAAATCATCATCGTGGG-3′ (upstream primer) 5′-TTAGTTTACCCTTCCAAGTTTGTAC-3′ (downstream primer);

[0161] vioD:

[0162] 5′-ATGAAAATCCTCGTCATCGGCG-3′ (upstream primer) 5′-TTAGCGGCCGAGGGCGTA-3′ (downstream primer);

[0163] vioE:

[0164] 5′-ATGCCACCGCACGCCACC-3′ (upstream primer) 5′-TTATTCCGACACGAAAACGCTG-3′ (downstream primer);

[0165] The reaction system was 2×Taq Plus Master Mix II 10 μL, upstream primer 1 μL, downstream primer 1 μL, ddH2O 8 μL, and the enzymes used were from Nanjing Novozyme Biotechnology Co., Ltd. The reaction conditions were 95°C for 3 min; 95°C for 45 s, 50°C for 1 min, 72°C for 3 min, 30 cycles; 72°C for 5 min; the results were as follows Figure 8 As shown in A: Among the transformants No. 1-6, only the transformant No. 5 has the bands corresponding to the vioABCDE genes (i.e., they have vioABCDE bands, respectively). Therefore, it is shown that the gene expression cassette related to the violacein synthesis pathway has been successfully integrated into the chromosome of the transformant No. 5, and the strain S.cerevisiae YSG50-vio has been successfully constructed. This strain is a transition strain for constructing the final target strain S.cerevisiae YSG50-vio-vioC+.

[0166] 2.5) Number transformants 1-6, spread them evenly on the nutrient-deficient solid medium SD-Ura with a pipette tip, and culture them in a 30°C incubator. Observe the colony status of transformants 1-6. The results are as follows: Figure 8 As shown in B: The colonies of transformants No. 1-5 are light green in color, and the colony of transformant No. 6 is white in color.

[0167] 2.6) Pick transformant No. 5 and spread it evenly with a pipette tip onto the gridded nutrient-deficient solid medium SD-Ura, place it in a 30°C incubator, and compare it with the bottom plate cell S.cerevisiae YSG50. The results are as follows Figure 8 As shown in C.

[0168] 3. Integration of multiple rDNA copies

[0169] 3.1) Activate the S.cerevisiae YSG50-vio strain obtained in step 2 on a YPD solid plate, inoculate a single colony of S.cerevisiae YSG50-vio in 4 mL YPD liquid medium, and culture overnight at 30°C, 200 rpm. Inoculate S.cerevisiae YSG50-vio strain at 1% (v / v) in 50 mL YPD, and culture at 30°C, 200 rpm for about 8-9 hours until OD 600 Around 0.8. Collect the culture medium in a clean and sterile 50mL centrifuge tube, centrifuge at 4000×g, 4℃ for 5min, and discard the supernatant. Wash the bacteria 2-3 times with pre-cooled ddH2O, and discard the supernatant. Wash the bacteria once with pre-cooled 1M sorbitol solution, and discard the supernatant. Resuspend the bacteria with 250ul pre-cooled 1M sorbitol solution, and dispense 100uL into 1.5mL EP tubes, which is the S.cerevisiae YSG50-vio electroporation competent state. The electroporation competent state is prepared and used immediately.

[0170] 3.2) Take 5uL of vioC gene overexpression cassette (concentration greater than 200ng / uL) on ice, put it in an ice bath for 10min, and add it to 100uL of yeast electroporation competent cells. Transfer the yeast competent cells to a 2mm dry and clean electroporation cup. Set the electroporation instrument parameters to 1500V 5ms. Immediately after electroporation, add 1mL of pre-cooled YPA medium and mix well, and transfer to a 10mL sterile and clean centrifuge tube. Place on a shaker at 160rpm and 30℃ for 1h to recover. Centrifuge at 3500×g and discard the supernatant. Wash the bacteria 3 times with 1M sorbitol solution and resuspend in 1mL YPD medium. Take 50uL of the bacterial solution and spread it on sd-ura-leu medium, and invert and culture at 30℃ for 2-4d.

[0171] 3.3) Randomly pick the single colony transformants obtained from step 3.2) and number them 1-32. Pick a single colony and add it to 50μL of sterilized 20mMNaOH solution and mix it evenly; use a pipette to spread the remaining single colonies evenly on the gridded nutrient-deficient solid culture medium and place it in a 30℃ incubator for culture; the picked transformants correspond to the bacterial numbers on the plate one by one. Place the bacterial solution in a PCR instrument and follow the program: 99℃, 5min; 4℃, 1min for 3 cycles. Take out the bacterial solution, centrifuge it at 8000×g for 1min, and take the supernatant as a PCR template.

[0172] 3.4) Perform colony PCR identification to amplify the vioC gene sequence. The identification primers are:

[0173] 5'-CCACACACCATAGCTTC-3' (upstream primer)

[0174] 5′-TTAGTTTACCCTTCCAAGTTTGTAC-3′ (downstream primer);

[0175] The reaction system was 2×Taq Plus Master Mix II 10 μL, upstream primer 1 μL, downstream primer 1 μL, ddH2O 8 μL, and the enzymes used were from Nanjing Novozyme Biotechnology Co., Ltd. The reaction conditions were 95°C for 3 min; 95°C for 45 s, 50°C for 1 min, 72°C for 3 min, 30 cycles; 72°C for 5 min. The results were as follows Fig. 9 As shown: transformants No. 1-32 all have PTEF-O-vioC+-TTEF (SEQ ID No. 31, 1716 bp) verification bands, indicating that the gene expression cassette related to the violacein synthesis pathway has been successfully integrated into the chromosome of Saccharomyces cerevisiae, and the strain S. cerevisiae YSG50-vio-vioC+ has been successfully constructed.

[0176] It should be emphasized in the present invention that: according to the method described in the above Example 1, as long as S.cerevisiae YSG50-vio-vioC+genomic DNA is used as a template, a 1716bp PCR product is amplified by PCR with identification primers and the product sequence is consistent with the vioC overexpression gene expression cassette sequence, then the genetically engineered bacteria obtained after the violaceous bacterium synthesis pathway-related gene expression cassette is inserted into Saccharomyces cerevisiae.

[0177] Note: The 1716bp sequence is the core sequence of S.cerevisiae YSG50-vio constructed into S.cerevisiae YSG50-vio-vioC+ strain. The construction of S.cerevisiae into S.cerevisiae YSG50-vio also requires five gene expression cassettes, vioABCDE. That is, the 1716bp sequence is part of the vioC overexpression gene expression cassette sequence; the vioC overexpression gene expression cassette sequence is rDNA2-LEU-PTEF-vioC+-TTEF-rDNA1, and the verification sequence is PTEF-vioC+-TTEF; therefore, there is consistency.

[0178] That is, the present invention has inevitable reproducibility.

[0179] Example 2: Fermentation of violacein using the recombinant strain S.cerevisiae YSG50-vio-vioC+

[0180] 1. Fermentation production of violacein

[0181] Pick one inoculation loop of a single colony of the YSG50-vio-vioC+ recombinant strain from the YPD solid culture medium and inoculate it into 50 mL of YPD liquid culture medium, and culture it at 30°C, 200 rpm for 24 hours to obtain seed liquid, and transfer it to a 250 mL conical flask containing 50 mL of YPD culture medium with an inoculation amount of 1% (volume %), and culture it at 30°C, 220 rpm for 48 hours to obtain fermentation liquid.

[0182] The formula of the YPD liquid culture medium is 10 g / L yeast extract, 20 g / L peptone, and 20 g / L glucose.

[0183] 2. Extraction of Viola serrata

[0184] 2.1) Collect the fermentation broth, incubate at 8000 rpm for 15 min, discard the supernatant, and collect the bacterial cells;

[0185] 2.2) Resuspend the collected cells with sterile water, centrifuge at 8000 rpm for 15 min, discard the supernatant, and collect the cells;

[0186] 2.3) Add 20 mL of anhydrous ethanol to the centrifuge tube and vortex thoroughly for extraction;

[0187] 2.4) The samples were subjected to ultrasonic disruption, with the ultrasonic cell disruptor having a disruption power of 325 W, a working time / interval time of 3 s / 3 s, and a disruption time of 30 min;

[0188] 2.5) 8000×g for 15 min, discard the precipitate and collect the supernatant;

[0189] 2.6) Take the supernatant and spin dry it using a rotary evaporator;

[0190] 2.7) Add 5 mL of chromatographic ethanol to re-dissolve, and filter the dissolved sample through a 0.22 μm filter membrane.

[0191] 3. The fermentation reconstituted solution obtained in step 2 is subjected to vacuum freeze drying (-80° C. drying for 24 hours) to obtain purple bacteriocin.

[0192] Example 3, Identification of Violet Bacterin

[0193] (1) Standard product configuration

[0194] Weigh 10 mg of violacein, dissolve it in deionized water, and dilute it to 100 ml in a volumetric flask to prepare a 100 μg / ml stock solution. Pipette 10 mL of the 100 μg / ml stock solution, dilute it to 100 mL, and prepare a 10 μg / ml working solution. Then perform gradient dilutions and load them into the injection bottle.

[0195] (2) Preparation of test sample solution

[0196] The extracellular polysaccharide containing violacein obtained in Example 2 was used as the sample to be tested.

[0197] Take a clean chromatographic bottle, accurately weigh 2 mg (± 0.05 mg) of the sample to be tested, add 2 ml of anhydrous ethanol, filter using a 0.22 μm syringe filter membrane, and transfer the obtained purple bacteriocin solution into the chromatographic bottle for testing.

[0198] (3) Chromatography-mass spectrometry method

[0199] UPLC detection conditions: Waters Acquity BEH C18 (2.1 mm × 100 mm, 1.7 μm) liquid chromatography column; mobile phase: ethanol (A)-10 mmol·L–1 aqueous solution (B); gradient elution: 0-1 min, 5% A; 1-6 min, 5%→24% A; 6-15 min, 24%→48% A; 15-30 min, 48%→78% A. Column temperature: 40 °C; flow rate: 0.3 mL·min–1; injection volume: 1 μL.

[0200] Mass spectrometry conditions: electrospray ionization (ESI); positive and negative ion modes were used

[0201] MSE scanning; desolvation temperature was 350℃, capillary voltage was 3.0kV, cone voltage was 40V, low collision voltage was 6V, high collision voltage was 40-60V, mass scanning range was m / z 100-1 200, scanning time was 0.3s, and leucine enkephalin was calibrated in real time.

[0202] Masslynx V4.2 was used to process the total ion currents in positive and negative ion modes, and UNIFIPortal software was used to analyze the data in combination with Mass value, retention time and molecular formula matching software. Fig.10 As shown, the chromatographic mass spectrum of purple bacteriocin in negative ion mode is as follows Fig.11 shown.

[0203] (4) Sample calculation results

[0204] The project uses external standard method for quantification, and prepares standard curves by preparing standard samples of different concentrations. The linear relationship information is as follows

[0205]

[0206] The UPLC-Q / TOF-MS test results are as follows:

[0207]

[0208] Note: Based on the standard product, the curve equation is Y = 4.2946-0.1359; where Y represents OD 570 Value, X represents the content of purple bacteriocin. 570 Substituting the value into the above curve equation, the violacein content of the sample to be tested (violacein obtained in Example 2) is obtained. The violacein yield is 117.32 mg / L.

[0209] Comparison: The original S.cerevisiae YSG50 was used instead of "YSG50-vio-vioC+" to conduct experiments according to the steps of extracting violacein in Example 2 and identification according to Experiment 3. The fermentation broth was extracted by a rotary evaporator and no pigment appeared.

[0210] The present invention was found in the process of invention that Duganella sp. B2, E.coil pRS426, and E.coil PGADT7 could not use the rDNA site and δ site of this experiment to construct violacein-producing strains.

[0211] Finally, it should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. A genetically engineered bacterium producing violacein, characterized in that: After inserting a gene expression cassette related to the violacein synthesis pathway into Saccharomyces cerevisiae and overexpressing the vioC gene, a genetically engineered bacterium S. cerevisiae YSG50-vio-vioC+ producing violacein was obtained.

2. The genetically engineered bacterium producing Violacein according to claim 1, characterized in that: The gene expression cassette related to the violacein synthesis pathway is: vioA gene expression cassette, vioB gene expression cassette, vioC gene expression cassette, vioD gene expression cassette, vioE gene expression cassette.

3. The genetically engineered bacterium producing Violacein according to claim 2, characterized in that: Also included are a URA gene expression cassette and a vioC overexpression gene expression cassette.

4. The genetically engineered bacterium producing violacein according to any one of claims 1 to 3, characterized in that: The violacein gene cluster originates from Duganella sp., but is not limited to this strain. The nucleotide sequence of the gene cluster that can synthesize violacein is similar to the sequence in this strain.

5. A method for preparing violacein using the genetically engineered bacteria according to any one of claims 1 to 4, characterized in that The following steps are involved: The genetically engineered bacteria S.cerevisiae YSG50-vio-vioC+ is inoculated into a fermentation medium for fermentation culture, and the fermentation liquid is collected, wherein the fermentation liquid contains violacein.

6. The method for preparing violacein according to claim 5, characterized in that: The fermentation broth is separated and purified to obtain purple bacteriocin.

7. The method for preparing violacein according to claim 5 or 6, characterized in that: The inoculation amount is 0.5% to 2.5%; The fermentation temperature is 30-40°C, and the fermentation time is 12-48 hours.

8. The method for preparing violacein according to claim 7, characterized in that: The fermentation medium contains glucose with a concentration of 10 g / L to 25 g / L.

9. The method for preparing violacein according to claim 8, characterized in that: The separation and purification method utilizes a rotary evaporator ethanol reconstitution method, and then a freeze-drying method is used to prepare purple bacteriocin.

Images