Application of NLD gene in regulation and control of included angle of corn leaves

Abstract

The invention discloses application of an NLD gene in regulation and control of an included angle of corn leaves. According to the invention, a corn mutant el20 with a reduced leaf angle is obtained through mutant screening, and a gene NLD causing a mutant phenotype is positioned through a map-based cloning technology. The overexpression of the NLD gene can restore the leaf upright phenotype of el20. The NLD gene is edited by using a gene editing technology, so that rapid creation of the compact plant type corn is realized. The invention provides a novel method and a molecular module for cultivating compact plant type corn suitable for close planting.

Description

Technical Field

[0001] The invention belongs to the field of agricultural biotechnology and relates to the application of NLD gene in regulating the angle of corn leaves. Background Art

[0002] Corn is not only an important source of livestock and poultry feed, but also an important raw material for edible oil and starch. In addition, corn can also be used to ferment and produce ethanol, which can be used as a clean energy to reduce air pollution. Improving the yield per unit area has always been an important proposition in corn breeding. An important reason for limiting corn yield is planting density. The leaf angle is the main factor limiting the density tolerance of corn. If the leaf angle is too large, different plants will be in direct and close contact, which is not conducive to ventilation and aggravates the occurrence and spread of pests and diseases. In addition, if the leaf angle is too large, the upper leaves of corn will block the light from the lower leaves, which is not conducive to the photosynthesis of the whole corn plant, thus affecting the yield. Therefore, an important task of corn density tolerance breeding is to identify new genetic materials for upright leaves, clone the key genes that control the angle of corn leaves, analyze the molecular mechanism of the formation of the angle of corn leaves, and apply it to molecular design breeding.

[0003] CRISPR / Cas9 (Clustered Regularly Interspaced Short PalindromicRepeats) is a genome editing technology that has developed rapidly in recent years. The guide RNA guides the Cas9 nuclease to cut the target gene according to the principle of base complementarity. Next, the DNA repair system in the cell repairs the double-strand break through homologous recombination or non-homologous end joining, and in the process causes base mismatches, insertions, and deletions, thereby achieving site-specific editing of the target gene. This technology has been widely used in many fields such as agriculture, biotechnology, and biomedicine, and has played a very important role in the functional data of important agricultural genes and molecular design breeding. Summary of the invention

[0004] The purpose of the present invention is to provide an application of NLD gene in regulating the angle of corn leaves in order to solve the problems of low planting density and low yield caused by the large angle of corn leaves. The nucleotide sequence of the NLD gene is shown in SEQ ID NO.1.

[0005] Another object of the present invention is to provide a method for rapidly creating genetic material of corn with upright leaves using gene editing technology to increase planting density.

[0006] The purpose of the present invention can be achieved through the following technical solutions:

[0007] The application of NLD gene in regulating the angle of corn leaves, the nucleotide sequence of the NLD gene is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2.

[0008] Through screening and phenotypic analysis of the M2 generation strains of the maize EMS chemical mutagenesis mutant library, a stably inherited leaf erect mutant erect leaf 20 (el20) was identified.

[0009] The F2 gene mapping population of el20 and maize inbred line 178 was prepared, and the candidate gene was located between 15.66M-15.73M of chromosome 5 by map-based cloning technology. In this interval, there are only two expressed coding genes Zm00001d0136120 and Zm00001d0136122 (Narrow Leaf and Dwarfism, NLD). Overexpression of the NLD gene in the el20 background can restore the upright leaf phenotype of el20, confirming that the loss of NLD can cause the angle of maize leaves to decrease.

[0010] As a preferred embodiment of the present invention, the deletion or mutation of the NLD gene can reduce the angle of corn leaves. The use according to claim 1 is characterized in that the mutation type of the NLD gene includes one or more of base substitution, frameshift mutation, deletion mutation or insertion mutation.

[0011] As a preferred embodiment of the present invention, the mutation of the NLD gene is achieved by using CRISPR / Cas9 gene editing technology.

[0012] Application of the CRISPR / Cas9 gene editing system of the NLD gene in creating corn materials with reduced leaf angles.

[0013] As a preferred embodiment of the present invention, the sgRNA sequence targeting the NLD gene in the CRISPR / Cas9 gene editing system of the NLD gene is shown in SEQ ID NO.3.

[0014] A method for rapidly obtaining leaf erect corn materials based on CRISPR / Cas9 technology, the method comprising designing a target sequence for editing an sgRNA recognition site of an NLD gene, constructing a CRISPR / Cas9-NLD gene editing vector, and transforming the vector into corn to obtain leaf erect corn.

[0015] As a preferred embodiment of the present invention, the sgRNA sequence is shown as SEQ ID NO.3.

[0016] As a preferred embodiment of the present invention, the primer sequence for constructing the CRISPR / Cas9-NLD gene editing vector pCBX053-NLD is:

[0017] NLD-gRNAF:GGTCTCTATTGGAGGTGCTTCTTACATCATGGGTTTTAGAGCTAGAA (SEQ IDNO.4),

[0018] NLD-gRNAR:GGTCTCTAAACCCATGACCAGGAGAATTCACCCAATTCGGTGCTTGCG (SEQ ID NO. 5).

[0019] Application of NLD gene in breeding compact corn.

[0020] The beneficial effects of the present invention are:

[0021] The present invention uses genetic means to find that NLD gene deletion or mutation can effectively reduce the angle of corn leaves and produce a compact plant type. Editing the NLD gene through gene editing technology can quickly create corn genetic materials with a compact plant type. The present invention provides new molecular modules and technical means for the regulation of corn leaf angles and molecular design breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 : Phenotypes of the maize mutant el20. A, Whole plant phenotypes of the wild type (QW) and mutant el20. BC, Side views of the pulvinus structures of the wild type (QW) and mutant el20. DE, Cross-sectional views of the pulvinus structures of the wild type (QW) and mutant el20

[0023] Figure 2 :Map-based cloning of the NLD gene. A, The leaf erection trait of el20 is linked to the molecular markers 5D-16 and 5D-22 on chromosome 5. B, Fine mapping of the NLD gene. C, The expression levels of the two candidate genes in the wild type and mutant in the fine mapping interval.

[0024] Figure 3:NLD-GFP overexpression restores the upright leaf phenotype of el20. A, plasmid map of pZ005-Ubi::NLD-GFP. B, PCR identification of NLD-GFP inserts in wild-type KN5585 and three NLD-GFP transgenic lines. C, relative expression levels of NLD genes in wild-type KN5585 and three NLD-GFP transgenic lines. D, PCR detection of NLD-GFP inserts and endogenous NLD genes in wild-type QW, mutant el20 and el20NLD-GFP lines. EG, phenotypes of wild-type QW, mutant el20 and el20 NLD-GFP lines.

[0025] Figure 4 :Identification and phenotypic observation of NLD-cri gene-edited strains. A, Sequence alignment of NLD gene in NLD-cri edited strains and wild-type KN5585. B, Sequencing map of NLD gene in NLD-cri edited strains and wild-type KN5585. C, Upright phenotype of NLD-cri edited strains. DETAILED DESCRIPTION

[0026] Example 1

[0027] A corn EMS chemical mutagenesis mutant library was phenotypically screened at the teaching and research base of Nanjing Agricultural University in Baima Town, Lishui District, Nanjing. The mutagenic population of the M1 generation was planted at a density of 65 cm in row spacing and 30 cm in plant spacing, and seeds were collected from each individual plant to produce M2 generation materials. 20 seeds were randomly selected from each strain of the M2 generation material for sowing, and the leaf angles of the growing individual plants were observed. The strains that produced at least two upright leaf plants were selected as possible candidate strains for inheritance, and the upright leaf plants were selected for self-pollination to produce the M3 generation. 20 seeds of the M3 generation were randomly selected for sowing, and all strains with upright leaf phenotypes were selected as mutants for further study.

[0028] After the above screening, we obtained a mutant with extremely upright leaves and named it erect leaf 20 (el20). Compared with the wild-type inbred line (QW), the leaves of el20 are upright, with almost no bending between the sheath and the leaf, showing an upright leaf phenotype ( Figure 1 A). Cutting the leaf blade and leaf sheath in the middle revealed that the el20 mutant almost lacked the structure of the auricle and ligule, which resulted in the inability to form a bend between the leaf blade and the leaf sheath, resulting in an upright leaf phenotype ( Figure 1 BC,DE).

[0029] Example 2

[0030] We hybridized the el20 mutant with the maize inbred line 178, which has a normal leaf angle. All F1 plants showed normal leaf angles, indicating that the erect leaf phenotype caused by the mutant gene is a recessive trait. The F2 population was planted, and among more than 2,300 F2 plants, 486 mutant plants with erect leaves and phenotypes consistent with el20 were found. We collected leaves from these mutant plants and extracted DNA. Using the base differences in the genomes of the two inbred lines QW and 178, we selected a set of insertion and deletion molecular markers (InDel) evenly distributed on the 10 chromosomes of maize, amplified them using the DNA of these plants as templates, and identified the recombination of these markers in the 486 mutant plants. The results showed that the molecular markers 5D-16 and 5D-22 from chromosome 5 were consistent with the el20 mutant in most of these individuals, indicating that these two markers were linked to the mutant gene. Therefore, we preliminarily located the candidate gene between the molecular markers 5D-16 and 5D-22 on chromosome 5 ( Figure 2 A). We then developed more molecular markers on chromosome 5 (Table 1) and used linkage analysis to fine-tune the candidate gene to a 75 kb interval between 5H-12 (physical position 15.66M) and 5H-7 (physical position 15.73M). Figure 2 C). After further designing primers in this interval, no amplification products were obtained in the mutant plant, indicating that the mutant had a base deletion in this interval. After comparing the sequence of this interval with the maize reference genome, it was found that there were only two expressed coding genes in this interval, namely Zm00001d013620 and Zm00001d013624, of which Zm00001d013622 encodes Narrow Leaf and Dwarfism (NLD) protein ( Figure 2 C). These two genes were expressed at high levels in the leaves of wild-type QW and B73, but were barely expressed in the el20 mutant, further confirming that these two genes were missing in the mutant ( Figure 2 C) To identify the key gene that determines the leaf angle in the two, we first edited the Zm00001d013624 gene and obtained an edited offspring with frameshift and premature termination, but no developmental defect phenotype, indicating that this gene is not the cause of the upright leaves of el20. Therefore, we speculate that NLD loss is the direct factor leading to upright leaves.

[0031] Table 1 Primers for fine mapping of NLD gene

[0032] Primer name sequence 5-1-D-1F AGGCTTGCTTGGGCCT 5-1-D-1R CTCAACATCTGCACTCTCGATCA 5H-7F GTGAACAGCAGTTGCGTT 5H-7R TACTTTGGCGGCTCGTTCA 5D-22F CAGATTGGTGTCTCTTACTTTCC 5D-22R TGACTGCGATGGAACTCTTCT 5H-12F ACGCCAACTGCCATATCTG 5H-12R AACCAATGCAGCGATATCGAGG 5G-2F AGCTTGTAAGAAAGAAAGGCAG 5G-2R GAGCCGAAGCCGAGCG 5D-16F ACTGTGTCTGAGAGGC 5D-16R GACACGTCTAGTGACTATATTG

[0033] Example 3: Transgenic verification of NLD gene deletion leading to reduced angle of corn leaves

[0034] According to the coding sequence of the NLD gene provided in the maize genome database (www.maizegdb.org) (SEQID NO 1), we commissioned Shanghai Shenggong Biotechnology Co., Ltd. to synthesize the full-length coding sequence of the gene from scratch. Next, we used the synthesized sequence as a template to synthesize amplification primers NLD F1 and NLD R1 for PCR amplification. The primer sequences are:

[0035] NLD F1: AACAGGTCTCAGGCTATGGATCCGGAGCAGACGT

[0036] NLD R1: AACAGGTCTCACTGATGTCACCTGATCATTCCAT

[0037] The PCR product was recovered and purified using a gel recovery kit and digested with BsaI. The pGreenGate cloning vector pGGC000 (Lampropoulos, A., Sutikovic, Z., Wenzl, C., Maegele, I., Lohmann, JU, and Forner, J. (2013). GreenGate-a novel, versatile, and efficient cloning system for plant transgenesis. PLoS One 8, e83043) was digested and recovered using BasaI. The digested PCR product was ligated to the vector at 16°C overnight using T4 DNA ligase, and then transformed into E. coli DH5α competent cells, and the correct pGGC-NLD clone was selected by colony PCR and plasmid sequencing. According to the cloning strategy of the pGreenGate system, 1 μL of pGGC-NLD, pGGA-Ubi, pGGB003, pGGD001, pGGE001, pGGF002 intermediate vector plasmids and 1.5 μL of final vector plasmid Z005 were mixed in equal amounts, and then 1.5 μL of CutSmart buffer, 1.5 μL of ATP (10 mM), 1 μL of T4 DNA ligase (30 u / mL) and 1 μL of BsaI-HF were added, and placed in a PCR instrument for enzyme digestion and ligation reactions. The reaction conditions were: 37°C for 5 minutes, 16°C for 5 minutes, and 50 cycles. Finally, incubate at 50°C for 5 minutes and 80°C for 5 minutes. The ligation product was transformed into Escherichia coli DH5α competent cells by heat shock method, and the correct pZ005-Ubi::NLD-GFP clone ( was selected by colony PCR and plasmid sequencing) was selected. Figure 3 A).

[0038] The pZ005-Ubi::NLD-GFP plasmid was transformed into Bacillus pyogenes EHA105, infected the callus of maize inbred line KN5585, and selected and regenerated by Basta to produce NLD-GFP overexpression strains. Forward and reverse primers were designed according to the NLD and GFP sequences, respectively, and the genotypes of three transgenic strains were detected.

[0039] The detection primers are:

[0040] NLD gtF:CTACCAGGAGCCAGCAAGAG

[0041] GRF gtR:GATGAACTTCAGGGTCAGCTTG

[0042] The results showed that the target product could not be amplified in the negative control KN5855, and strong and specific amplification products were detected in the three NLD-GFP overexpression strains, indicating that the pZ005-Ubi::NLD-GFP insert fragment was indeed integrated into the genome of these strains ( Figure 3 B). Next, we designed specific fluorescent quantitative PCR primers based on the NLD transcript, extracted RNA from leaves of wild-type and NLD-GFP overexpressing strains, and performed reverse transcription and fluorescent quantitative PCR.

[0043] The primer sequences for fluorescent quantitative PCR are:

[0044] qNLD F:CAGATGCCCTATTGGTTCAGG

[0045] qNLD R:GGGTACTTCCAGCTCGCTGA

[0046] The results showed that compared with the wild-type KN5585, the expression levels of NLD in the three transgenic lines were significantly increased by 30-50 times ( Figure 3 C).

[0047] To confirm that NLD is the real cause of the el20 mutant phenotype, we crossed the NLD-GFP overexpressing strain with the el20 mutant, identified the NLD-GFP overexpressing plants in the F2 population using primers NLD gtF and GFP gtR, and then tested whether these plants were in the nl20 background using primers qNLD F and qNLD R. As a result, we identified a strain that contained both the endogenous NLD gene deletion (el20 mutant) and NLD-GFP overexpression ( Figure 3 D) Phenotypic analysis of these plants showed that the leaf angle of NLD-GFP el20 plants was restored to the same extent as the wild type ( Figure 3 EG), which fully proves that NLD is indeed the cause of the upright leaves of el20.

[0048] Example 4

[0049] The ccdB between the ZmU6 promoter and the sgRNA scaffold in the pCBX053-Cas9 vector was removed using the restriction endonuclease BsaI and replaced with the target sequence containing the gRNA (Liu, HJ, Jian, L., Xu, J., Zhang, Q., Zhang, M., Jin, M., Peng, Y., Yan, J., Han, B., Liu, J., Gao, F., Liu, X., Huang, L., Wei, W., Ding, Y., Yang, X., Li, Z., Zhang, M., Sun, J., Bai, M., Song, W., Chen, H., Sun, X., Li, W., Lu, Y., Liu, Y., Zhao, J., Qian, Y., Jackson, D., Fernie, A. R., and Yan, J. (2020). High-Throughput CRISPR / Cas9 Mutagenesis Streamlines Trait Gene Identification in Maize. Plant Cell 32, 1397-1413). Guide RNA design was performed using the online tool CRISPR-P 2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ). Two complementary sequences were synthesized, annealed, and connected to the pCBX053-Cas9 linearized vector after BsaI digestion. Escherichia coli DH5α competent cells were transformed by heat shock method, and the correct pCBX053-NLD clone was selected by colony PCR and plasmid sequencing.

[0050] The synthetic sequence for constructing the pCBX053-NLD plasmid is:

[0051] NLD-gRNAF:GGTCTCTATTGGAGGTGCTTCTTACATCATGGGTTTTAGAGCTAGAA(SEQ IDNO.4)

[0052] NLD-gRNAR:GGTCTCTAAACCCATGACCAGGAGAATTCACCCAATTCGGTGCTTGCG (SEQ IDNO.5)

[0053] The gRNA sequence matching the NLD gene is: CAGAGGTGCTTCTTACATCA (SEQ ID NO.3)

[0054] The plasmid with the correct sequencing was transformed into Bacillus pyogenes, infecting the callus of the maize inbred line KN5585, and was screened and regenerated by Basta to produce a transgenic strain transformed with pCBX053-NLD. DNA was extracted from these individual plants, and primers were designed according to the positions corresponding to the NLD gene sequence and gRNA. The amplified products were sequenced and compared with the wild-type sequence, and a gene-edited strain with a 7bp deletion in the third exon of the NLD gene was identified. We named this mutant strain NLD-cri( Figure 4 AB). The wild-type NLD gene encodes 644 amino acids, but in the NLD-cri mutant, the 7-base deletion leads to a frameshift and a premature stop codon. The edited NLD gene only encodes 102 amino acids, so NLD-cri is a loss-of-function mutant. The leaves of NLD-cri plants are upright, showing a mutant phenotype similar to el20 ( Figure 4 C). The primer sequences for identifying the NLD gene-edited strains are:

[0055] NLD-cri F: CTCGTCCTCGAGTACCTCTAC NLD-cri R: TTGTCCCTTTCCAAGTTCT.

Claims

1. Application of NLD gene in regulating the angle of corn leaves, the nucleotide sequence of the NLD gene is shown in SEQ ID NO.1, and the amino acid sequence of the NLD protein is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that: NLD gene deletion or mutation can reduce the angle of corn leaves.

3. The use according to claim 1, characterized in that: The mutation types of the NLD gene include one or more of base substitution, frameshift mutation, deletion mutation or insertion mutation.

4. The use according to claim 1, characterized in that: The mutation of the NLD gene is achieved by using CRISPR / Cas9 gene editing technology.

5. Application of the CRISPR / Cas9 gene editing system of the NLD gene in creating corn materials with reduced leaf angles.

6. The use according to claim 5, characterized in that The sgRNA sequence targeting the NLD gene in the CRISPR / Cas9 gene editing system of the NLD gene is shown in SEQ ID NO.

3.

7. A method for rapidly obtaining corn materials with upright leaves based on CRISPR / Cas9 technology, characterized in that: The method comprises designing a target sequence of an sgRNA recognition site for editing the NLD gene, constructing a CRISPR / Cas9-NLD gene editing vector, and transforming the vector into corn to obtain corn with upright leaves.

8. The method according to claim 7, characterized in that The sgRNA sequence is shown in SEQ ID NO.

3.

9. The method according to claim 7, characterized in that: Primer sequences for constructing CRISPR / Cas9-NLD gene editing vector pCBX053-NLD: NLD-gRNAF: SEQ ID NO.4, NLD-gRNAR:SEQ ID NO.

5.

10. Application of NLD gene in breeding compact corn.

Images