Light-operated nucleic acid probe, telomerase activity detection method and application

Abstract

The invention relates to a light-operated nucleic acid probe, a telomerase activity detection method and application, and relates to the technical field of gene detection. The light-operated nucleic acid probe comprises a primer and a spacer molecule, the spacer molecule is modified with a PC linker and a marker, and the PC linker is located between the spacer molecule and the primer. Telomerase can recognize primers in the light-operated nucleic acid probe and form a telomerase extension product, due to the steric hindrance effect of the telomerase extension product with few spacer molecules, the probe-modified marker enables the telomerase extension product to be captured and enriched on a carrier, and then PC linker is broken through light irradiation, so that the light-operated nucleic acid probe is obtained. A telomerase extension product part in the probe is released into a solution from the surface of the carrier, and then the telomerase extension product part can be transferred into a subsequent amplification reaction system for amplification under the condition that the carrier or impurities are not carried, so that the influence of impurity components in a telomerase sample on a detection reaction is eliminated; the sensitivity of telomerase activity detection on a complex sample is ensured.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a light-controlled nucleic acid probe, a telomerase activity detection method and an application thereof. Background Art

[0002] Malignant tumors are one of the major diseases that endanger human life and health in today's society, and the mortality rate has remained high for a long time. Although major breakthroughs have been made in the research and development of new drugs in recent years, the prevention and control of tumors is still not optimistic. In recent years, with the further improvement of industrialization, the destruction of the ecological environment, and the impact of food pollution, the incidence and mortality of malignant tumors in my country have shown an upward trend and are higher than the world average. Factors that may lead to tumors, such as the gradual aging of the population, obesity, lack of exercise, smoking, environmental deterioration, and unbalanced dietary structure, exist to varying degrees in both developed and developing countries. Therefore, the situation facing in vitro diagnosis of tumors is extremely severe.

[0003] Telomerase is a ribonucleoprotein complex, also known as telomere terminal transferase. Telomerase consists of two parts: 451 base-length telomerase RNA (hTR) and telomerase reverse transcriptase (hTERT). Telomerase is responsible for the progressive synthesis of telomeric DNA repeat sequences (TTAGGG) at the 3' end of linear chromosomes, reversing the loss of DNA in each round of replication, thereby compensating for the gradual shortening of telomeres caused by end replication problems. This enzyme is inactive in most somatic cells and seems to be limited to certain types of cells, such as proliferating cells in the germ line and self-renewing tissues. A common feature of cancer is indefinite cell division associated with the activation of telomere maintenance mechanisms. Researchers have found that telomerase is widely overexpressed in cancer cells, and telomerase reactivation can be observed in most (about 90%) cancer cell lines, while it is lowly expressed or inactive in normal cells. Today, a large number of research results clearly show that telomerase is a biomarker that can reflect the early occurrence of tumors. Telomerase can not only be used as a target for designing anti-tumor drugs, but also as a universal molecular marker and potential therapeutic target for early diagnosis, prognosis and treatment of tumors. Telomerase activity detection samples can be derived from cells, tissues and body fluids, including pleural effusion, ascites, urine, pancreatic duct washing fluid, secretions taken from cotton swabs, etc. Therefore, telomerase can be used as an ideal molecular marker for non-invasive in vitro diagnosis of cancer.

[0004] However, existing mainstream technical methods are unable to solve several problems in telomerase activity detection at the principle level. One of the most important is the problem of limited detection sensitivity, which limits the further application of telomerase as a tumor marker in medical diagnosis. Summary of the invention

[0005] In view of the above technical problems, the present invention provides a light-controlled nucleic acid probe, in which telomerase can recognize the primer and form a telomerase extension product, while the spacer molecule has a less steric hindrance effect on the telomerase extension product. The marker modified by the probe enables the telomerase extension product to be captured and enriched on the carrier, and then the PC linker is broken by light irradiation. The telomerase extension product in the probe is partially released from the surface of the carrier into the solution, and then can be transferred to a subsequent amplification reaction system for amplification without carrying the carrier or impurities, thereby eliminating the influence of impurity components in the telomerase sample on the detection reaction and ensuring the sensitivity of telomerase activity detection in complex samples.

[0006] The present invention provides a light-controlled nucleic acid probe, comprising a primer and a spacer molecule, wherein the spacer molecule is modified with a PC linker and a marker, and the PC linker is located between the spacer molecule and the primer; telomerase can recognize the primer and form a telomerase extension product.

[0007] The inventors found in the process of studying the above technical problems that the existing detection technology cannot eliminate the adverse effects of impurities in telomerase samples (cleavage products) on the detection reaction, such as the inhibition of telomerase extension process by nucleases, and the inhibition of detection reaction by cell contents such as enzymes, ions, and peptides. It is specifically embodied in the following aspects: First, in complex clinical specimens (especially in the early stages of cancer), the proportion of tumor cells is very low, which will cause the telomerase activity in the obtained telomerase samples to be difficult to detect. In order to avoid this situation, it is necessary to use a larger amount of biological samples with a higher concentration to prevent telomerase from being missed, which in turn will cause a significant increase in the concentration of impurities in the telomerase sample, and the detection reaction will have a significant inhibitory effect. Secondly, it is the degradation effect of DNA enzymes in telomerase samples on telomerase extension products. The above factors will affect the sensitivity of telomerase activity detection technology, limiting the further application of telomerase as a tumor marker in medical diagnosis. At the same time, some of the currently known telomerase detection technologies mostly use modified magnetic beads or microspheres and other carriers to capture telomerase or related products, but after capture, because it is not possible to release them well, the carriers can only be sent to the subsequent detection system together with the telomerase or related products. The large amount of carriers introduced means that the subsequent detection system can only use high-cost methods such as fluorescence detection, which is difficult to adapt to convenient and cost-effective methods such as DNA amplification systems. If the influence of impurities in telomerase samples on the detection reaction is to be eliminated, the sensitivity of telomerase activity detection for complex samples is to be guaranteed, and it is also necessary to adapt to DNA amplification systems, etc., it is necessary to allow telomerase to form telomerase extension products first, and be able to independently separate the telomerase extension products from the complex samples, and enter the subsequent amplification system and detection reaction system without carrying carriers or impurities. Therefore, the inventors proposed the above-mentioned light-controlled nucleic acid probe, in which telomerase can recognize the primer in the light-controlled nucleic acid probe and form telomerase extension products, and the marker modified by the probe enables the telomerase extension products to be captured and enriched on the carrier, and then the PClinker is broken by light irradiation, and the telomerase extension product in the probe is partially released from the surface of the separation carrier into the solution, and then can be transferred to the subsequent amplification reaction system for amplification without carrying the carrier or impurities, thereby eliminating the influence of impurity components in the telomerase sample on the detection reaction, and ensuring the sensitivity of telomerase activity detection in complex samples. The above-mentioned spacer molecule is used to reduce the steric hindrance effect between the telomerase extension product and other functional groups of the probe.

[0008] In one embodiment, the sequence of the primer is AATCCGTCGACGAGAGTTA.

[0009] In one embodiment, the label comprises at least one of biotin, fluorescein isothiocyanate or digoxigenin.

[0010] In one embodiment, the spacer molecule is used to reduce the steric hindrance effect of the telomerase extension product.

[0011] In one embodiment, the spacer molecule comprises at least one of a biological molecule or a chemical molecule.

[0012] It can be understood that since the spacer molecule is used to reduce the steric hindrance effect between the telomerase extension product and other functional groups of the probe, the spacer molecule can be a biological molecule (such as a nucleic acid fragment, a protein fragment, etc.) or a chemical molecule (such as a polymer molecule, etc.), so that the telomerase extension product and other functional groups of the probe are separated by a certain spatial distance, and the length of the spacer molecule can meet the requirement of reducing the steric hindrance effect.

[0013] In one embodiment, the biological molecule comprises 8-50 bases; and the chemical molecule comprises a polymer molecule.

[0014] In one embodiment, the biomolecule is a base sequence.

[0015] In one embodiment, the base sequence is a Poly tail structure.

[0016] In one embodiment, the sequence of the Poly tail structure is 8-10 bases.

[0017] In one embodiment, the polymer molecule comprises PEG.

[0018] The present invention also provides a kit for detecting telomerase activity, comprising a separation system and a detection system, wherein the separation system comprises a carrier modified with a binder and an extension reaction system, wherein the binder specifically binds to the marker, and the extension reaction system comprises the light-controlled nucleic acid probe.

[0019] A carrier made of light-transmitting material can be selected. After the carrier modified with the binding substance captures the probe modified with the marker, light is transmitted through the carrier to illuminate the probe, thereby breaking the PC linker. Alternatively, a carrier made of non-light-transmitting material can be selected. By removing the light-shielding material of the carrier, the probe is exposed to light, thereby breaking the PC linker.

[0020] In one of the embodiments, the carrier is mainly made of light-transmitting material.

[0021] In one embodiment, the conjugate comprises at least one of streptavidin, anti-fluorescein isothiocyanate antibody or anti-digoxigenin antibody.

[0022] In one embodiment, the detection system includes an amplification system and a detection reaction system.

[0023] In one embodiment, the amplification system is an AS-TRAP amplification system, and the detection reaction system is a CRISPR-Cas detection system.

[0024] The present invention also provides a method for detecting telomerase activity for non-diagnostic purposes, comprising the following steps: preparing telomerase extension products, amplifying and detecting the telomerase extension products;

[0025] The preparation of the telomerase extension product comprises: mixing the sample to be tested with the extension reaction system of the kit, performing a telomerase extension reaction, obtaining a light-controlled nucleic acid probe having the telomerase extension product, using the carrier to capture the light-controlled nucleic acid probe having the telomerase extension product, enriching the light-controlled nucleic acid probe having the telomerase extension product in the carrier, breaking the PC linker by light irradiation, and obtaining the telomerase extension product.

[0026] In one embodiment, the amplification and detection include: amplifying the telomerase extension product using an amplification system to obtain an amplification product, and detecting the amplification product using a detection reaction system.

[0027] In one embodiment, the capturing is achieved by specific binding of the label to the binder.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] The present invention discloses a light-controlled nucleic acid probe, a telomerase activity detection method and application. The light-controlled nucleic acid probe comprises a primer, a spacer molecule, the spacer molecule is modified with a PC linker, and a marker, and the PC linker is located between the spacer molecule and the primer. Telomerase can recognize the primer in the light-controlled nucleic acid probe and form a telomerase extension product, while the spacer molecule has a less steric hindrance effect of the telomerase extension product. The marker modified by the probe enables the telomerase extension product to be captured and enriched on a carrier, and then the PC linker is broken by light irradiation, and the telomerase extension product in the probe is partially released from the carrier surface into the solution, and then can be transferred to a subsequent amplification reaction system for amplification without carrying a carrier or impurities, thereby eliminating the influence of impurity components in the telomerase sample on the detection reaction, and ensuring the sensitivity of telomerase activity detection for complex samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Schematic diagram of the design and evaluation of LbacrRNA for detecting telomerase extension products in Example 1, wherein: Figure 1 A is a schematic diagram of the complementary relationship between the partial region of the ACX primer and the telomeric DNA repeat sequence in the traditional TRAP reaction. Figure 1B is a schematic diagram of the design of LbacrRNA targeting telomeric DNA repeat sequences. Figure 1 C is a graph showing the results of a CRISPR-Cas12a fluorescence reaction kinetic experiment based on the LbacrRNA designed in Figure B to detect telomeric DNA repeat sequences in single-stranded and double-stranded states;

[0031] Figure 2 The schematic diagram of the construction of the AS-TRAP method in Example 2, wherein: Figure 2 A is the result of Exo I digestion of single-stranded DNA amplicons in traditional TRAP and AS-TRAP reaction products. Figure 2 B is the result of using Cas12a / crRNA1 to detect the amplification products of traditional TRAP and AS-TRAP reactions, Figure 2 C is a graph showing the screening results of TS and ACX primers in the AS-TRAP reaction;

[0032] Figure 3 Schematic diagram of the design and construction of the light-triggered telomerase extension product separation system in Example 3, wherein: Figure 3 A is a schematic diagram of the designed structure of the Bio-PCTS probe. Figure 3 B is a schematic diagram of the design of the light-triggered purification and separation strategy of telomerase extension products based on the Bio-PCTS probe. Figure 3 C is a schematic diagram of the feasibility verification results of the light-controlled purification and separation strategy of telomerase extension products triggered by the Bio-PCTS probe. Figure 3 D is the result of optimizing the 365nm UV irradiation time. Figure 3 E is a diagram showing the functional verification result of the separation system based on the Bio-PCTS probe for eliminating the degradation effect of nuclease (DNase I) in telomerase samples;

[0033] Figure 4 Schematic diagram of the analytical performance evaluation of the Lit-Telo system in Example 3, wherein: Figure 4 A is the test result of Lit-Telo system for samples with different concentrations of telomerase. Figure 4 B is a schematic diagram of the linear detection range of the Lit-Telo system for telomerase samples with different concentrations. Figure 4 C is a diagram showing the validation results of the Lit-Telo system for telomerase detection specificity;

[0034] Figure 5 This is a diagram showing the clinical detection performance verification and evaluation results of the Lit-Telo system in Example 3, wherein: Figure 5 A is the result of detecting telomerase activity in bladder tissue specimens using the Lit-Telo system. Figure 5B is the ROC analysis result of the data of telomerase activity detection of bladder tissue specimens by Lit-Telo system;

[0035] Figure 6 Schematic diagram of the detection principle of the Lit-Telo platform in Example 3. DETAILED DESCRIPTION

[0036] In order to facilitate the understanding of the present invention, the present invention will be described more fully below with reference to the relevant drawings. The preferred embodiments of the present invention are given in the drawings. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0038] source:

[0039] Unless otherwise specified, the reagents, materials, and equipment used in this example are all commercially available; the experimental methods are all conventional experimental methods in the art unless otherwise specified.

[0040] Example 1

[0041] Design and construction of a CRISPR-Cas12a system for detecting telomerase extension products.

[0042] 1. crRNA preparation method:

[0043] According to the crRNA sequence design above, order single-stranded DNA template for RNA in vitro transcription (Table 1) and use T7 High Yield RNA Synthesis Kit was used for RNA transcription according to the kit instructions. The specific reaction system was as follows: 1 μL single-stranded DNA template for crRNA transcription (10 μM), 1 μL T7 promoter sequence (10 μM), 1.5 μL 10× reaction buffer, 1.5 μL ATP, 1.5 μL UTP, 1.5 μL GTP, 1.5 μL CTP, 1 μL DTT (0.1 M), 1.5 μL T7 RNA polymerase Mix, 1.5 μL T7 RNA polymerase Mix, after transcription at 37 ° C for 12 h, crRNA was purified using an RNA purification kit, and finally the RNA concentration was determined using NanoDrop, and then adjusted to 1 μM concentration before use or frozen at -20 ° C for later use.

[0044] Table 1. Single-stranded DNA sequences used for in vitro transcription of RNA

[0045]

[0046] 2. Preparation method of simulated telomerase extension product:

[0047] The DNA sequence designed to simulate the telomerase extension product after amplification is shown in Table 2. The telomeric DNA repeat sequence (TTAGGG) is added to the 3' end of the TS primer in the traditional TRAP reaction to simulate the telomerase extension product, and then its complementary sequence is designed. The two single-stranded DNA sequences are annealed to prepare double-stranded DNA for simulating the telomerase extension product after amplification. The preparation reaction system and method are as follows: the following components are added to a 200 μL PCR tube: 20 μL Mimic TEP (10 μM), 20 μL Mimic TEP-R (10 μM), 5 μL 10×PCR buffer, and 5 μL nuclease-free water. After incubation at 95°C for 10 minutes, the mixture is naturally cooled to room temperature and diluted to the required concentration before use.

[0048] Table 2. DNA sequences used to simulate telomerase extension products

[0049]

[0050] 3. Detection method based on CRISPR-Cas12a:

[0051] The detection efficiency of the designed crRNA was evaluated using the CRISPR-Cas12a fluorescence reaction kinetics experiment. The CRISPR-Cas12a reaction system consisted of: 2μL 10×NEB buffer 2.1, 1.5μL crRNA (1μM), 1μLLbaCas12a (1μM), 1μL FQ-DNA reporter (10μM, FAM-CCCCCC-BHQ1), 12.5μL DEPC water, and 2μL target to be tested. In the CRISPR fluorescence kinetics experiment, the CRISPR reaction solution was placed in a fluorescence quantitative PCR instrument, and the fluorescence value was measured every 1min under incubation conditions at 37°C. In the CRISPR-based lateral flow experiment, the CRISPR reaction solution was placed in a PCR instrument and incubated at 37°C for 45min, and the reaction product was dripped onto the sample pad area of ​​the lateral flow test paper, the results were observed, and photos were taken to collect data.

[0052] This detection platform mainly consists of two parts, namely the light-triggered telomerase extension product separation system and the subsequent detection system, in which the detection system consists of DNA amplification and CRISPR-Cas12a detection reaction. Figure 1 As shown in A, the complementary strand of the telomeric DNA sequence in the dsDNA amplicon has a high similarity with the ACX primer sequence, so we can only choose the telomeric DNA sequence in the dsDNA amplicon as the targeting strand of CRISPR-Cas12a to design crRNA. Figure 1 As shown in Figure B, since telomeric DNA is a repetitive sequence composed of 6 bases (TTAGGG), only 6 different crRNAs can be designed using this as a target. It is worth noting that the PAM sequences corresponding to all crRNAs are not the classic TTTN (or TTN), so the detection efficiency of these crRNAs for dsDNA amplicons of telomeric repeat sequences is unclear. Firstly, evaluating and screening the crRNA detection efficiency is reasonable and necessary for the construction of the detection system.

[0053] like Figure 1 As shown in Figure C, the six designed crRNAs showed significantly different detection efficiencies for synthetic dsDNA targets, among which crRNA3 was also relatively inefficient when detecting high-concentration synthetic targets. We noticed that the PAM sequence composition corresponding to crRNA3 was the most unfavorable for the activation of Cas12a, which is consistent with previous reports. On the other hand, we also tested the activation efficiency of these crRNAs with single-stranded DNA targets (telomeric DNA repeat sequences) at the same concentration as the synthetic double-stranded DNA targets. Figure 1As shown in Figure C, due to the restrictions of PAM sequence recognition and double-stranded DNA unwinding process, the detection efficiency of Cas12a / crRNA for ssDNA targets is significantly better than that for double-stranded DNA targets. Among them, crRNA1 showed the best detection efficiency for single-stranded DNA targets, so we selected crRNA1 as the optimal crRNA for subsequent experiments. Based on this phenomenon, when we choose the telomerase extension product amplification method, we will mainly explore technical solutions that can produce single-stranded DNA amplification products to maximize the working efficiency of the CRISPR-Cas12a detection system.

[0054] Example 2

[0055] Establishment and optimization of AS-TRAP.

[0056] 1. Preparation method of telomerase:

[0057] Extraction of telomerase from cell samples. After the cultured prostate cancer cells DU145 are digested and dispersed into a cell suspension, the cell suspension is counted using a cell counting plate to calculate the cell concentration. After the DU145 cells are centrifuged at 4°C 3000rpm for 10 minutes, the cell pellet is washed once with ice PBS, and the cells are collected again, resuspended with NP-40 buffer, and placed in an ice bath for 30 minutes to completely lyse the cells. After the lysate is centrifuged at 4°C 14000rpm for 30 minutes, the supernatant is collected, which is the telomerase extract of the cell sample, the cell number equivalent corresponding to the telomerase is calculated, and it is diluted to the required concentration for use.

[0058] Telomerase extraction from clinical samples. Bladder tissue samples were obtained by cystoscopy. Some samples were used for pathological tissue detection, and about 20-50 mg of tissue was taken from each sample for telomerase extraction. The tissue was transferred to a 1.5 mL centrifuge tube, 100 μL of NP-40 buffer was added, and the tissue was slightly ground with a grinding rod and placed in an ice bath for 30 minutes to completely lyse the cells. After the lysate was centrifuged at 4°C and 14000 rpm for 30 minutes, the supernatant was collected, which was the telomerase extract of the bladder tissue sample. The cell number equivalent corresponding to telomerase was calculated and diluted to the required concentration for use.

[0059] 2. TRAP and AS-TRAP methods:

[0060] The TRAP reaction system was prepared in a 200 μL PCR tube: 5 μL 10×TRAP buffer, 1 μL dNTP (10 mM), 1 μL TS primer (16.88 μM, AAT CCG TCG ACG AGA GTT A), 1 μL ACX primer (11.1 μM, GCGCGGCTTACCCTTACCCTTACCCTAACC), 1.5 μL BSA (20 mg / mL), 0.5 μL Taq DNA polymerase (5 U / μL), 5 μL telomerase extract, and DEPC water was added to a final volume of 50 μL. The TRAP reaction tube was placed in a PCR instrument, incubated at 37°C for 30 min to complete the telomerase extension reaction, and then the PCR amplification reaction was performed according to the following program: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 5 min. In the AS-TRAP experiment, compared with the TRAP experiment, the concentrations of TS primer and ACX primer were adjusted, while other reaction components and reaction procedures remained unchanged.

[0061] Taking into account the above special situation, that is, when detecting telomerase extension products, Cas12a / crRNA has significantly better detection efficiency for ssDNA targets than for double-stranded DNA targets, in order to maximize the working efficiency of the CRISPR-Cas12a detection system, we have modified the classic TRAP method. By adjusting the primer ratio, the PCR reaction used in the TRAP method is adjusted to an asymmetric PCR reaction, which greatly increases the proportion of single-stranded DNA amplicons in the nucleic acid amplification product, and maximizes the working efficiency of the CRISPR-Cas12a-based detection system. Figure 2 As shown in A, we first carried out an asymmetric TRAP (TRAP based on asymmetric-PCR) reaction (TS:ACX=1μM:0.04μM). After incubating the AS-TRAP product with ExoI enzyme (ssDNA-specific nuclease), we found that the amplified product band was significantly reduced. This result shows that the AS-TRAP product is mainly composed of ssDNA. We used the screened crRNA1 to detect TRAP and AS-TRAP products respectively, and the results showed (as shown in Figure 2 B), Cas12a / crRNA1 combined with AS-TRAP detection strategy obviously showed better detection efficiency. We finally chose this strategy for subsequent detection system construction. On this basis, we optimized and screened the AS-TRAP system. We tested different concentrations of TS primers (1-2μM) and ACX primers (0.01-0.2μM) and the results showed that (such as Figure 2C), different TS / ACX primer concentrations and ratios did not lead to significantly different detection results, but we noticed that when low concentrations of ACX primers were used, the detection background signal was lower, among which TS:ACX=2μM:0.01μM showed the best signal-to-noise ratio. We finally chose this primer concentration combination for subsequent experiments.

[0062] Example 3

[0063] Design and construction of Lit-Telo technology based on light-triggered separation system.

[0064] 1. During the research process, the inventors found that the existing technology for detecting telomerase activity mostly uses modified magnetic beads or microspheres and other carriers to capture telomerase or related products, but after capture, because it is not possible to achieve release well, the carrier can only be sent to the subsequent detection system together with telomerase or related products. The large-scale introduction of the carrier results in that the subsequent detection system can only use high-cost methods such as fluorescence detection, which is difficult to adapt to convenient and cost-effective methods such as DNA amplification systems. Therefore, under the premise of the optimal selection of AS-TRAP and Cas12a / crRNA1, we carried out the design and evaluation of the light-triggered telomerase extension product separation system.

[0065] First, we constructed a photoresponsive probe Bio-PCTS probe. Figure 3 As shown in A, we added a biotin tag and 8 cytosine deoxyribonucleotides to the 5' end of the traditional TS primer in the AS-TRAP reaction, so that the telomerase extension product can be captured and enriched, and modified the PC linker between ploy C and the TS primer to enable it to have a light-responsive cleavage function, thereby constructing a functional Bio-PCTS probe.

[0066] like Figure 3 As shown in B, telomerase can recognize the TS primer at the 3' end of the Bio-PCTS probe, and continuously add the telomeric DNA repeat sequence (TTAGGG) to its 3' end. After the telomerase extension reaction solution is transferred to a 96-well plate with streptavidin embedded at the bottom, the telomerase extension product is captured to the bottom of the well plate by the interaction between streptavidin, Bio-PCTS probe and biotin. At this time, the telomerase extension reaction solution is discarded and the well plate is washed to remove impurities. Finally, 365nm ultraviolet light is used to irradiate the well plate to break the PC-linker in the Bio-PCTS probe, so that the TS sequence at the end of the probe and the telomerase extension product are separated and released from the bottom of the well plate into the solution, and then subsequent amplification and detection reactions are carried out.

[0067] We first verified whether the designed Bio-PCTS probe functioned normally, and the results showed that ( Figure 3 C), in the detection reaction with telomerase, the 365nm light irradiation group has a very obvious detection signal, while the reaction without 365nm UV irradiation has only a weak detection signal. In addition, we explored the time of UV irradiation ( Figure 3 D), and found that only 5 seconds of short illumination was needed to achieve the photocontrolled breakage and release of the Bio-PCTS probe captured at the bottom of the microplate. We can also notice that if the UV illumination time is too long, after 90 seconds, the detection signal is significantly reduced, which may be caused by excessive UV irradiation dose causing DNA chain breakage. We further explored whether this photocontrolled separation strategy can effectively eliminate the adverse effects of impurity molecules in high-concentration telomerase samples on detection, and the results showed that ( Figure 3 E), shorter amplification bands can be observed in the TRAP products under the traditional detection mode, which is consistent with the report by Yaku et al., because a large amount of DNase in the high-concentration telomerase sample partially degrades the telomerase extension product, resulting in a large number of 44bp amplicons in the amplification product. At the same time, no short amplification products were observed in the TRAP products based on the light-responsive separation strategy using the Bio-PCTS probe, indicating that the light-controlled separation strategy can effectively eliminate the inhibitory effect of impurities (such as DNase I) on the detection reaction by removing impurities (such as DNase I) in the telomerase sample (whole cell protein extract), thereby avoiding false negative results that may occur when detecting complex telomerase samples. Based on the above results, we integrated the telomerase extension product separation system based on the Bio-PCTS probe, the AS-TRAP system, and the screened CRISPR-Cas12a / crRNA1 system to construct a new method for telomerase detection with high accuracy, and named it the Lit-Telo system.

[0068] 2. Experimental method for detecting telomerase activity based on Bio-PCTS probe:

[0069] First, prepare the telomerase extension reaction solution in a 200 μL PCR tube: 2 μL 10×TRAP buffer, 0.4 μL dNTP (10 mM), Bio-PCTS probe (Biotin-CCCCCCCC / PClinker / AATCCGTCGACGAGAGTTA,) the above probe is modified from SEQ NO.10: CCCCCCCCAATCCGTCGACGAGAGTTA, 4 μL lamda DNA (0.2 mg / mL), 2 μL telomerase extract, add DEPC water to a final volume of 20 μL. Place the reaction tube in a PCR instrument and incubate at 37°C for 60 minutes to complete the telomerase extension reaction. After mixing the above reaction solution with 20 μL capture reaction solution (10 mM Tris-HCl (pH 7.5), 2M KCl), transfer it to a 96-well plate modified with streptavidin, shake it at 850 rpm for 15 min at room temperature, discard the supernatant, wash the microwells twice with 50 μL washing buffer, add 20 μL 1TRAP buffer, irradiate the 96-well plate with 365 nm UV for 5 to 90 seconds, break the Bio-PCTS probe and release it into the solution, transfer the solution to a reaction tube, add reagents until the final concentration of each component is the same as TRAP or AS-TRAP, and place the reaction solution on a PCR instrument to complete the corresponding reaction. Take 2 μL of the reaction product and add it to the CRISPR reaction solution to complete the final detection.

[0070] 3. Performance evaluation of the Lit-Telo system.

[0071] First, we evaluated the detection sensitivity of the developed Lit-Telo system. We used Lit-Telo to detect telomerase extracts with different cell equivalents (1, 2, 4, 8, 20, 40, 100, 1000, 2000, 4000, 8000 Hela cells). Figure 4 As shown in A, as the number of telomerase increases, the detection signal intensity gradually increases. When the number of telomerase reaches 4000 Hela cell equivalents, the detection signal intensity reaches a plateau, indicating that the telomerase extension product has reached the detection capacity of the Lit-Telo technology. The data also show ( Figure 4 A), Lit-Telo single reaction can effectively detect telomerase extracts as low as 8 Hela cell equivalents, and in the range of 200-4000 Hela cells ( Figure 4 B), the detection signal and the logarithm of the cell number showed a very good linear relationship (R 2=0.9955). This detection sensitivity is close to the sensitivity of the most sensitive detection method available. We further verified the specificity of the detection by testing Lit-Telo on telomerase, heat-inactivated telomerase, and telomerase treated with RNase. The results showed that Lit-Telo has good detection specificity ( Figure 4 C).

[0072] In order to clarify the clinical application value of Lit-Telo technology, we finally tested its detection performance on clinical samples. Bladder cancer is one of the most common malignant tumors of the urinary system. The diagnosis of bladder cancer requires the use of a cystoscope to obtain bladder tissue for pathological testing. The pathological testing process is complicated and time-consuming. In addition, regular microscopic examinations are often required after bladder cancer surgery to monitor recurrence. Therefore, bladder cancer detection technology that is simpler and faster than pathological testing has important clinical value in the diagnosis and treatment of bladder cancer. Figure 5 As shown in the figure, we collected 15 bladder cancer and 2 non-cancerous cystoscopic tissues and used Lit-Telo technology for testing. The results showed that Lit-Telo successfully detected 14 of the 15 bladder cancer tissues, while the 2 non-bladder cancer tissues (urothelial inverted papilloma) were negative. The sensitivity and specificity of clinical specimen detection reached 93.33% and 100% respectively. The ROC curve analysis results based on the test data showed that the AUC value reached 96.67%, indicating that the detection method has a high degree of detection accuracy for clinical samples and shows great potential for clinical application.

[0073] In summary, the present invention designs a light-controlled nucleic acid probe as a substrate for telomerase extension. Telomerase extends the telomeric DNA repeat sequence at the end of the probe (taking the human telomeric DNA repeat sequence as an example: TTAGGG). The light-responsive functional nucleic acid probe is captured by a separation vector, so that the probe is enriched on the surface of the separation vector, and the impurities (cell contents, enzymes, nucleic acids, proteins, small molecules, ions, etc.) introduced into the reaction solution with the telomerase sample are removed, so that the telomerase extension product is purified. The surface of the separation vector is irradiated with 365nm ultraviolet light to break the PC linker inside the light-responsive functional nucleic acid probe, and the telomerase extension product in the probe is partially released from the surface of the separation vector into the solution, and then transferred to the subsequent amplification reaction system for amplification, and finally the detection reaction is completed using the CRISPR-Cas12a system. The above-mentioned detection system constructed based on the light-responsive functional nucleic acid probe is named the Lit-Telo platform, and its specific principles are as follows:

[0074] The detection principle of the Lit-Telo platform is as follows Figure 6As shown, after the collected samples (cells or tissues, etc.) are processed, a telomerase sample is obtained. This telomerase sample is a crude extract, which contains not only telomerase but also a large amount of cell contents, such as proteins, peptides, organic matter, ions, etc. The 5'-end biotinylated PCTS (Bio-PCTS) probe is co-incubated with the telomerase sample. Telomerase recognizes the telomerase substrate sequence at the 3' end of the Bio-PCTS probe and continuously adds the telomeric DNA repeat sequence (TTAGGG) at its end to generate telomerase extension products. Next, a matrix modified with streptavidin is used to capture the telomerase extension product by utilizing the affinity between streptavidin and the biotin at the end of the Bio-PCTS probe. Considering the subsequent UV-triggered release step, in order to avoid the adverse effect of the insufficient transmittance of the streptavidin matrix itself on the light-triggered effect (such as streptavidin-modified magnetic beads and polystyrene microspheres), we selected a 96-well plate modified with streptavidin with high transmittance as the substrate of the light-triggered separation system. The streptavidin modified with the 96-well plate captures the Bio-PCTS probe, thereby enriching the telomerase extension products to the bottom of the well plate, so that the cell impurities in the reaction system can be easily removed. Next, a brief irradiation with 365nm UV is used to break the PC-linker in the Bio-PCTS probe, triggering the release of the telomerase extension product portion of the probe from the substrate into the solution, thereby completing the light-triggered telomerase extension product separation process. Next, the single-stranded telomerase extension product obtained by light-triggered separation is amplified by the AS-TRAP reaction to generate a large number of nucleic acid amplification products in the single-stranded DNA state, reducing the subsequent CRISPR-Cas12a detection system from being restricted by the PAM site in the detection target, improving the detection sensitivity, and based on the Cas12a system, two different detection modes based on fluorescence and LFA were developed.

[0075] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0076] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A light-controlled nucleic acid probe, characterized in that: It comprises a primer and a spacer molecule, wherein the spacer molecule is modified with a PC linker and a marker, and the PC linker is located between the spacer molecule and the primer; telomerase can recognize the primer and form a telomerase extension product.

2. The light-controlled nucleic acid probe according to claim 1, characterized in that: The sequence of the primer is AATCCGTCGACGAGAGTTA.

3. The light-controlled nucleic acid probe according to claim 1, characterized in that: The label includes at least one of biotin, fluorescein isothiocyanate or digoxigenin.

4. The light-controlled nucleic acid probe according to claim 1, characterized in that: The spacer molecule includes at least one of a biological molecule or a chemical molecule.

5. The light-controlled nucleic acid probe according to claim 4, characterized in that: The biological molecule includes 8-50 bases; the chemical molecule includes a polymer molecule.

6. A kit for detecting telomerase activity, characterized in that: It comprises a separation system and a detection system. The separation system comprises a carrier modified with a binder and an extension reaction system. The binder specifically binds to the marker. The extension reaction system comprises the light-controlled nucleic acid probe according to any one of claims 1 to 5.

7. The kit according to claim 6, characterized in that The conjugate includes at least one of streptavidin, anti-fluorescein isothiocyanate antibody or anti-digoxigenin antibody.

8. The kit according to claim 6, characterized in that The detection system includes an amplification system and a detection reaction system.

9. A method for detecting telomerase activity for non-diagnostic purposes, characterized in that: The following steps are involved: preparing telomerase extension products, amplifying and detecting the telomerase extension products; The preparation of the telomerase extension product comprises: mixing the sample to be tested with the extension reaction system of the kit according to any one of claims 6 to 8, performing a telomerase extension reaction to obtain a light-controlled nucleic acid probe having a telomerase extension product, using the carrier to capture the light-controlled nucleic acid probe having a telomerase extension product, enriching the light-controlled nucleic acid probe having a telomerase extension product in the carrier, and breaking the PC linker by light irradiation to obtain the telomerase extension product.

10. The method for detecting telomerase activity according to claim 9, characterized in that: The capture is achieved through the specific binding of the label to the binder.

Images