Plasmodiophora brassicae effector Pb78 and application thereof in prevention and treatment of Plasmodiophora brassicae infection

Abstract

The invention provides a plasmodiophora brassicae effector Pb78, and the nucleotide sequence of the plasmodiophora brassicae effector Pb78 is shown The invention also provides an application of host-induced silencing of the plasmodiophora brassicae effector Pb78 in prevention and treatment of plasmodiophora brassicae infection, and also provides a plasmodiophora brassicae prevention and treatment liquid and a preparation method of the plasmodiophora brassicae prevention and treatment liquid. The invention verifies that host-induced plasmodiophora brassicae effector Pb78 silencing can effectively inhibit plasmodiophora brassicae infection and symptom formation of cruciferae plants. The preparation and the treatment method disclosed by the invention are suitable for various cruciferae crops and vegetables which can be infected by plasmodiophora brassicae, and are wider in applicability; the inhibition efficiency on clubroot is higher than that of medicament treatment, and the compound has the advantage of no pesticide residue and is high in safety; due to the adoption of a seed treatment mode, the method is particularly suitable for preventing and treating clubroot susceptible seedlings.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology and plant disease control, in particular to a root knot fungus effector Pb78, and also to a method and application thereof for enhancing host resistance to root knot disease by inducing silencing of Pb78 under root knot fungus infection. Background Art

[0002] Brassica clubroot is a global plant disease that seriously harms the production of cruciferous crops. It is caused by the infection of the host plant roots by the Brassica clubroot fungus (Plasmodiophora brassicae Woronin).

[0003] How to effectively control the damage of clubroot is an important issue in the production of rapeseed and cruciferous vegetables. Crop rotation is a recommended management strategy, but in the absence of a host, dormant spores in the soil can remain active for many years, which means that severely infected fields are no longer suitable for growing cruciferous crops. At present, no single fungicide can effectively prevent and control clubroot. Because clubroot fungi are mixed with multiple subspecies and are prone to mutation, the disease-resistant varieties bred by traditional methods are limited in the prevention and control of clubroot. In addition, clubroot antigens are relatively scarce, and the cloning of disease-resistant genes and the breeding of disease-resistant varieties are slow. In addition, the hosts of clubroot fungi are cruciferous plants such as cabbage, greens, cauliflower, cabbage, and rapeseed, which are commonly grown in various parts of my country. Therefore, it is necessary to develop methods for clubroot prevention and control that are not dependent on crop genetic manipulation and are more suitable for various cruciferous plants.

[0004] In practice, gene editing provides more lasting resistance to pathogens that are prone to mutation. Based on the principle of RNA interference (RNAi), host plants produce siRNA that matches the genes of invading pathogens to silence the target genes of pathogens, which is called host-induced gene silencing (HIGS). The effect of HIGS silencing specific genes of pathogens depends on the cross-kingdom exchange of RNA between plants and interacting pathogens, as well as the response of different host-pathosystems. Given that rapeseed and cruciferous vegetables are hosts of root knot fungi, it is intended to create control technology that inhibits root knot fungi infection through the production of siRNA and cross-kingdom transmission characteristics of host plants. It is reported that control methods based on host-induced pathogen gene silencing have been established in crops such as wheat and rice to improve host resistance to wheat rust, rice false smut, etc., but there are no reports on root knot fungi. Summary of the invention

[0005] The purpose of the present invention is to overcome the current difficulties in the prevention and treatment of clubroot, chemical prevention and field management cannot fundamentally control the disease, the breeding of disease-resistant varieties is slow and difficult to meet the current situation of the cultivation of cruciferous crops and vegetables widely planted in my country, and provide a method for transiently expressing clubroot genes in cruciferous rape and cabbage. By using a palindromic sequence vector of the host transiently expressing the pathogenic gene of clubroot, the corresponding gene silencing under the infection of clubroot is induced, and among the various pathogenic factors of the screened clubroot, it is clear that Pb78 can significantly reduce the toxicity of the clubroot and improve the disease resistance of the host, which is a new technology suitable for the prevention and treatment of clubroot diseases of various cruciferous crops and vegetables.

[0006] In order to achieve the above object, the present invention provides a root-knot bacteria effector Pb78, the nucleic acid sequence of which is shown in SEQ ID NO.1.

[0007] The present invention also provides the use of the root-knot fungus effector Pb78 silencing induced by the host in preventing and controlling root-knot fungus infection.

[0008] In the present invention, the application is used to prevent and control cruciferous crops from being infected by root knot fungi, especially plants susceptible to brassica root knot fungi, including but not limited to rapeseed, cabbage, green vegetables, kale, radish and other cruciferous crops and vegetables.

[0009] On the other hand, the present invention also provides a plant expression vector containing the palindromic sequence of the root-knot fungus effector Pb78.

[0010] Furthermore, the present invention also provides a root-knot fungus control treatment liquid, wherein the treatment liquid contains an engineered strain of a plant expression vector of the above-mentioned root-knot fungus effector Pb78 palindromic sequence.

[0011] The present invention also provides a method for preparing a root knot fungus prevention and treatment liquid, the preparation method comprising the following steps:

[0012] (1) Construction of an engineering strain with a plant expression vector containing a Pb78 palindromic sequence

[0013] Using total RNA of root knot fungus and reverse transcribed full-length cDNA as template, the target fragments were amplified with forward and antisense primers containing restriction sites and purified and recovered. The effector sense and antisense chains were connected to the pKANNIBAL vector by restriction enzyme ligation, and the fragments containing the forward and reverse sequences of Pb78 were obtained. The purified fragments were constructed into the pBIB-BASTA-35S-GWR-GFP vector by restriction enzyme ligation, the correct positive bacteria were identified, the recombinant plasmids were extracted, and transformed into Agrobacterium GV3101.

[0014] (2) Preparation of host transient expression treatment solution

[0015] Take 50 μl of Agrobacterium GV3101 obtained in step (1) and inoculate it into 50 ml of LB liquid culture medium. Grow it in a shaker at 28°C and 180 r / min for 2 days until the absorbance at 600 nm reaches 0.8-1.0. Centrifuge the culture medium, discard the supernatant, and dilute the precipitate with MMA solution to obtain an OD 600 The MMA solution contained 8 mM / L 2-(N-morpholino)ethanesulfonic acid, 10 mM / L MgCl2·6H2O, and 180 μM / L acetosyringone.

[0016] In another aspect, the present invention provides use of the above-mentioned treatment solution in preventing and controlling root knot fungus infection in cruciferous plants.

[0017] As a preferred technical solution, the treatment liquid is immersed in the crucifer seeds, and the seeds are shaken at 28°C and 200 r / min for 20-30 hours until the seed coat breaks and the seeds germinate.

[0018] The present invention verifies through experiments that after the rapeseed is treated with a treatment solution containing an Agrobacterium-mediated Pb78 palindromic sequence vector, the treated rapeseed can be transiently expressed in the seedlings, leading to the silencing of Pb78 under the infection of root-knot fungi, thereby enhancing the inhibitory effect of the host on the infection and symptom formation of root-knot fungi. After the rapeseed is treated with the preparation of the present invention, it is sown in soil with root-knot fungi, or the root-knot fungi are inoculated at the 7th day of the seedling age, and the root-knot fungi infection is observed under a microscope 7-14 days after the inoculation of the root-knot fungi; on the 14th day after the inoculation of the root-knot fungi, the plant root system is taken, and the silencing effect of Pb78 is detected by fluorescent quantitative PCR; on the 30th day after the inoculation of the root-knot fungi, the plant root system is taken, and the incidence rate and disease index are counted, and compared with the plant inoculated with root-knot fungi treated with buffer solution, it is confirmed that the root-knot fungi effector and silencing treatment method selected by the present invention can significantly inhibit the infection and symptom formation of root-knot fungi, and enhance the host's resistance to root-knot disease.

[0019] Furthermore, rapeseed seeds treated with the preparation of the present invention can be directly planted in soil with dormant spores of root-knot fungi. Compared with rapeseed plants inoculated with root-knot fungi treated with buffer solution, the host disease incidence rate is reduced, the root tumors are reduced, and the host's resistance to root-knot disease is enhanced.

[0020] The present invention is based on RNAi technology, and utilizes host-induced root-knot fungus effector Pb78 silencing (Pb78-HIGS) to effectively inhibit the infection and symptom formation of cruciferous plants. Compared with the prior art, the preparation and treatment method of the present invention are applicable to various cruciferous crops and vegetables that can be infected by root-knot fungus, and have the advantage of wider application compared to disease-resistant breeding; the inhibition efficiency of root-knot disease is higher than that of chemical treatment, and has the advantage of no pesticide residue and high safety; due to the use of seed treatment, it is particularly suitable for the prevention and control of seedlings susceptible to root-knot disease.

[0021] The invention is a prevention and treatment technology with high efficiency, simple operation and high safety, and provides a new idea for the prevention and treatment of clubroot disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The fluorescence expression of Pb78 in the root system was observed under a microscope in Example 1. GFP represents the dark field under a fluorescence microscope, Bright filed represents the bright field under a fluorescence microscope, Merge represents the image of the dark field and bright field fusion, and Pb78-HIGS represents the transient expression of the palindromic sequence vector of Pb78 in the root system of rapeseed plants;

[0023] Figure 2 Real-time fluorescence quantitative PCR detection of the Pb78 gene expression level in the experimental group of Example 1;

[0024] Figure 3 The observation of root hair infection of the control group and the experimental group of Chinese cabbage by root knot fungus in Example 1, the left picture is the control group, and the right picture is the experimental group;

[0025] Figure 4 The symptoms of cabbage root tumors in the control group and the experimental group in Example 1;

[0026] Figure 5 The effects of different treatments of Example 2 on the formation of clubroot symptoms by inducing silencing of Pb78 in the host rapeseed include: buffer control treatment, soaking seeds for 20 hours, soaking seeds for 20 hours and root irrigation once at 7 days old, soaking seeds for 20 hours, root irrigation at 7 days old and leaf spraying once to show symptoms of clubroot in plants;

[0027] Figure 6 The fluorescence quantitative PCR detection of the silencing effect of different treatments on the root knot fungus effector Pb78 and the fluorescence quantitative PCR detection of different treatments on the accumulation of root knot fungus in the plant root system;

[0028] Figure 7 is the disease index of plants under different treatments;

[0029] Figure 8 The effect of Pb78-HIGS on the dormant spores of different root knotweed fungi concentrations (10 6 , 10 7 , 10 8 ) Symptoms of clubroot disease infecting the host rapeseed;

[0030] Fig. 9 It is the fluorescence quantitative PCR detection of the expression level of the root knot fungus gene actin;

[0031] Fig.10 This is a fluorescence quantitative PCR detection of the silencing level of Pb78 in root-knot bacteria. DETAILED DESCRIPTION

[0032] The following examples are used to explain the technical solutions of the present invention in a non-limiting manner.

[0033] In the present invention, unless otherwise specified, "%" used to explain concentration refers to mass percentage, and ":" refers to mass ratio.

[0034] The present invention relates to the following biological materials:

[0035] Agrobacterium GV3101: purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0036] pBIB-BASTA-35S-GWR-GFP plant expression vector: Construction process reference Jin et al., 2021, 111: 1017-028, Phytopathology.

[0037] Root swelling (infected with Physiological species 4 of Rhizoctonia solani): Treatment process reference Yang et al., 2022, 15: 1002976, Fronties in Microbiology.

[0038] Cabbage seeds: cabbage variety Early 5, purchased from Hangzhou Liuhe Seed Co., Ltd.; rapeseed seeds: rapeseed variety Youmanduo, purchased from Sichuan Fule Seed Co., Ltd.

[0039] The present invention relates to the following culture medium or composition:

[0040] LB solid medium: 5 g / L yeast extract, 10 g / L tryptone, 10 g / L sodium chloride; add 15 g / L agar. Sterilize at 121°C for 30 min.

[0041] LB liquid medium: 5 g / L yeast extract, 10 g / L tryptone, 10 g / L sodium chloride. Sterilize at 121°C for 30 min.

[0042] Example 1 Effects of transient expression of Pb78 palindromic sequence vector in host Chinese cabbage on infection and symptom formation of root knotweed fungi

[0043] 1. Construction of Pb78 palindrome sequence vector

[0044] (1) The target fragment of about 200 to 400 bp without restriction sites XhoⅠ, BsrGⅠ, EcoRⅠ, BamHⅠ, SacⅠ, and XbaⅠ was selected from the effector gene CDS sequence (PBRA_007830) through the website NCBI (National Center for Biotechnology Information) and the tool NEBcutter V2.0. The target fragment should be as close to the 5' end as possible. The primers of the sense chain and antisense chain were designed. The upper primer of the sense chain contained restriction sites XhoⅠ and BsrGⅠ, the lower primer of the sense chain contained restriction sites EcoRⅠ, the upper primer of the antisense chain contained restriction sites BamHⅠ and SacⅠ, and the lower primer of the antisense chain contained restriction sites XbaⅠ.

[0045] (2) Take the root system of the plant infected with root-knot fungus, extract total RNA, reverse transcribe it into cDNA, use the reverse transcribed full-length cDNA as template, amplify with the forward and antisense strand primers containing restriction sites in Table 1, and obtain the target fragment PCR product with a size of 348 bp. Purify and recover the target fragment, and cut the pKANNIBAL vector with restriction endonucleases XhoⅠ and EcoRⅠ, and purify and recover it.

[0046] Table 1 Primers used to construct Pb78 silencing vector

[0047]

[0048]

[0049] (3) Enzyme ligation (ligase purchased from The effector sense strand was connected to the pKANNIBAL vector (purchased from Newpro Biotechnology Co., Ltd.) using the enzyme digestion and ligation system shown in Table 2. After adding the sample and mixing well, the ligation was carried out at 16°C for 90 min.

[0050] Table 2 Enzyme Digestion and Ligation System

[0051]

[0052] (4) Transformation into Escherichia coli DH5α (using heat shock method)

[0053] ① Take 10 μL of the ligation reaction product and add it to 30 μL of E. coli competent DH5α, mix well and place on ice for 30 minutes;

[0054] ② Heat shock in a 42℃ water bath for 60s, then quickly transfer to ice and let stand for 5min;

[0055] ③ Add 700 μL of LB liquid medium without antibiotics and incubate at 37°C with shaking for 1 h (200 rpm / min);

[0056] ④ Take an appropriate amount of transformed E. coli competent cells and spread them on Kan + The LB solid culture medium plate was placed in a 37°C constant temperature incubator and inverted for 16 hours.

[0057] (5) DH5α single colony was screened and identified by PCR. After the positive single colony was amplified and cultured, 75 μL of the bacterial solution was taken and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing result was SEQ ID No. 1.

[0058] (6) The positive bacterial solution with correct sequencing was amplified and cultured using a plasmid extraction kit (spin column type) (purchased from Company) to extract the recombinant plasmid.

[0059] (7) The pKANNIBAL vector plasmid containing the positive strand was digested with restriction endonucleases XbaⅠ and BamHI, and purified and recovered.

[0060] (8) The antisense target fragment recovered by enzyme digestion was ligated to the pKANNIBAL vector of the positive sense target fragment recovered by enzyme digestion by restriction ligation.

[0061] (9) The ligation product was transferred to Escherichia coli DH5α, and the positive clones with correct sequencing were picked out to extract the recombinant plasmid.

[0062] (10) The pKANNIBAL vector plasmid containing the positive and negative strands with the correct sequencing results was cut with restriction endonucleases BsrGⅠ and SacⅠ. The resulting digestion products were subjected to electrophoresis on 1% agarose gel. A single target band was cut out under ultraviolet light and purified and recovered using a universal DNA purification and recovery kit.

[0063] (11) The pBIB-BASTA-35S-GWR-GFP vector (35S-GFP) was digested with restriction endonucleases BsrGⅠ and SacⅠ and purified and recovered.

[0064] (12) Enzyme ligation method: ligate the target fragment containing the positive and antisense strands recovered by enzyme digestion and the 35S-GFP vector.

[0065] (13) The ligation product was transformed into Escherichia coli DH5α, and the positive clones were picked out. PCR detection was performed using 35S-F and the effector positive chain downstream primer + Pb78R or the effector negative chain upstream primer - Pb78F and GFP-R. The primer sequence of 35S-F was CAAACGAATCTCAAGCAA TC, and the primer sequence of GFP-R was TTGTAGTTCCCGTCGTCCTT. Positive bacteria with the correct size were amplified, and the recombinant plasmid was extracted and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0066] (14) Transformation of the recombinant plasmid into Agrobacterium GV3101 (using heat shock method)

[0067] ① Take 30 μL of competent cells melted in an ice bath, add 5 μL of the recombinant plasmid constructed above, use a pipette to stir the bottom of the tube to mix, place on ice for 10 minutes, liquid nitrogen for 5 minutes, 37°C water bath for 5 minutes, and quickly place on ice for 5 minutes;

[0068] ② Add 900 μL of LB liquid medium without antibiotics and culture at 28°C with shaking for 2 to 3 hours;

[0069] ③ Centrifuge at 6000rpm / min for 1min, remove the excess supernatant, keep 100μL of supernatant, mix well and apply on Kan + Plate the LB solid medium and incubate it upside down at 28°C for 2-3 days. Pick a single colony and perform PCR screening with the primers in Table 1 to identify the positive clone.

[0070] (15) The correctly transformed GV3101 bacterial suspension was stored in a -80°C ultra-low temperature freezer with 25% glycerol.

[0071] 2. Preparation of dormant spore suspension of Brassica rapa and contaminated soil

[0072] The swollen roots (Physiological subspecies 4 of the root-knot fungus) were thawed, soaked in 70% ethanol for 5 minutes, and soaked in distilled water for 5 minutes; then the swollen roots were cut into pieces, put into a juicer and blended with distilled water for 2-3 times; filtered into a beaker with eight layers of gauze, the filtrate in the beaker was poured into a 50 mL centrifuge tube, 500 rpm / min, 10 minutes, and the supernatant was retained and continued to be centrifuged at 3100 rpm / min for 15 minutes; the supernatant was removed, and the root-knot fungus precipitate was resuspended with distilled water to prepare a root-knot fungus dormant spore suspension with a concentration of 1×10 7 ~10 8 spores / ml, mixed in soil, to make the root knotweed bacteria in the soil 1×10 7 Spores / g.

[0073] 3. Agrobacterium-mediated transient expression of Pb78 hairpin sequence vector in host cabbage

[0074] Take out the GV3101 bacterial solution obtained in step 1 from the -80℃ ultra-low temperature refrigerator, activate it on the LB solid medium plate containing kanamycin, take 100μL of the activated bacterial solution to a 50mL centrifuge tube containing 20mL LB liquid medium, and culture it overnight at 28℃ with shaking until the bacterial solution becomes turbid. Centrifuge at 5000rpm / min for 5min, discard the supernatant, add an appropriate amount of pre-cooled MMA (8mM / L 2-(N-morpholine)ethanesulfonic acid, 10mM / L MgCl2·6H2O, 180μM / L acetosyringone) to resuspend the bacterial solution, and adjust the OD of the resuspended solution.600 is between 0.5 and 0.6, and a treatment solution is obtained, and the treatment solution is used to soak cabbage seeds. 5 g of cabbage seeds are soaked in 30 mL of the treatment solution, and placed in a shaking table with a rotation speed of 200 rpm / min, and treated at 28° C. for 20-30 hours until the seeds crack and germinate.

[0075] The processed cabbage seeds are sown in the soil containing dormant spores of root knotweed fungus in step (2), with 9 seeds per hole.

[0076] The MMA solution prepared with Agrobacterium GV3101 without the Pb78 hairpin structure sequence vector was subjected to the same treatment as the blank control treatment.

[0077] The roots of 3-day-old plants were taken and the green fluorescence in the root cells was observed under a fluorescence microscope. Figure 1 As shown, the fluorescence results showed that the exogenous gene was successfully expressed in the plant roots.

[0078] IV. Detection of silencing level of the root knotweed effector Pb78 and the impact of root knotweed infection

[0079] When the seedlings were 21 days old, the gene expression level of Pb78 in the cabbage of step (3) was detected. RNA was extracted from the sample and reverse transcribed into cDNA. PbActin was used as the internal reference gene, and its upstream primer sequence was GGGACATCACCGACTACCTG, and its downstream primer sequence was ACTGCTCCGAGTTGGACATC. The upstream primer sequence for Pb78 detection was ACGGCGTGCCCCGCGAACCA, and the downstream primer sequence was GATGTCGTTGGCCAGGTCGA. SsoAdvanced TM RT-qPCR was performed using Green Supermix (Bio-Rad, Hercules, CA, USA). Three biological replicates were performed for each sample. -ΔΔCt The relative expression of genes was calculated.

[0080] The results are as follows Figure 2 As shown in the figure, Agrobacterium-mediated transient expression of a hairpin sequence vector in cabbage can silence the Pb78 gene under root-knot fungus infection. To clarify the effect of gene silencing on root-knot fungus infection, the roots of cabbage were stained with fluorescent pink B and observed under a ZEISS fluorescence microscope at 40×. The results are shown in the figure. Figure 3 shown.

[0081] It can be found that in the control group, there were a large number of primary zoosporangia in the root hairs, and zoospores were released to form empty sporangia, while in the experimental group of Pb78 silencing-treated plants, the number of root hairs infected by root-knot fungi was significantly reduced.

[0082] On the 30th day after inoculation of root-knot bacteria, the roots of the cabbage were taken and cleaned with water, and the root swelling of the cabbage under different treatments was observed and counted. A large number of root swellings formed on the roots of the cabbage in the control group, while after the Pb78 silencing treatment in the experimental group, the occurrence of root swellings in the cabbage was significantly reduced, and the root swellings that appeared were also smaller than those in the control treatment. Figure 4 shown.

[0083] Example 2 Effects of different treatments on host rapeseed inducing transient expression of Pb78-HIGS on root knot fungus infection of the host

[0084] The effects of different treatments on the expression level of Pb78 under infection with root knot fungi were investigated: (1) the rapeseed seeds were soaked for 20 hours using the method and treatment solution of Example 1; (2) the seeds were soaked for 20 hours and the roots were irrigated once at 7 days of age, and the Agrobacterium GV3101 containing the Pb78 hairpin structure sequence vector was resuspended in MMA (8 mM / L 2-(N-morpholine)ethanesulfonic acid, 10 mM / L MgCl2·6H2O, 180 μM / L acetosyringone), and the OD of the resuspended solution was adjusted. 600 The concentration of the treatment solution is between 0.5 and 0.6, and the treatment solution is obtained. The seeds are treated according to the method of Example 1. For root irrigation, 500 μL of the treatment solution is taken at 7 days old and dripped on the stem base of each seedling. (3) The seeds are soaked for 20 hours, and the roots are irrigated and the leaves are sprayed once at 7 days old. The rapeseed seeds are soaked in the treatment solution according to the method of Example 1, and the roots are irrigated according to the method of (2) in Example 2. At the same time, the prepared treatment solution is evenly sprayed on the leaves, 2-5 mL per plant, until the surface is wet. (4) The MMA solution prepared with Agrobacterium GV3101 without the Pb78 hairpin structure sequence vector is treated in the same way as a blank control.

[0085] Rapeseed seeds were planted in soil, and the inoculation concentration was 1×10 7 ~10 8 / ml dormant spores of R. rufipogonidum were used, and 300 μl was inoculated on each seedling. The fluorescence quantitative PCR method was used to detect the silencing effect of the R. rufipogonidum effector Pb78 under different treatments.

[0086] First, extract the total RNA of the roots of each plant, take 1μg RNA, use Oligo (dT) as a primer for reverse transcription, put it in a water bath at 72℃ for 5min, and quickly put it on ice for 5min. Then add the subsequent reaction reagents (5×RT Buffer 4μL, dNTPMixture 1μL, RRI 0.5μL, M-MLV 0.5μL), and finally make up to 20μL with water, put it in a water bath at 42℃ for 1h, and then denature at 72℃ for 10min. The obtained reverse transcription product is diluted to 40μL with water.

[0087] The above cDNAs were used as templates, the PbActin and Pb78 primer sequences in Example 1 were used, and PbActin was used as the internal reference gene. Fluorescence quantitative PCR was used to detect the transcription level of Pb78. The results of fluorescence quantitative PCR detection are shown in Figure 2. Figure 6-7 The results showed that the Pb78 gene could be silenced under several treatments, and the difference was significant compared with the control treatment. Fluorescence quantitative PCR detection of the actin gene of root knot fungus showed that the content of root knot fungus was reduced compared with the control treatment and the difference was significant.

[0088] On the 30th day after inoculation with root-knot bacteria, the roots of rapeseed were taken and cleaned with water. The root-knot formation of cabbage with different treatments was observed and counted. The representative plants with the size of root tumor formation were as follows: Figure 5 .

[0089] The results showed that the nodules of Pb78-silenced plants became smaller and the disease index was lower than that of the control. There were significant differences between the three treatments and the control.

[0090] The above results all indicate that seed treatment is the key method, and silencing of Pb78 can weaken the pathogenicity of root knot fungi and enhance the host's resistance to root knot disease.

[0091] Example 3 Effect of host-induced Pb78 gene silencing on infection of host rapeseed with dormant spores of different concentrations of root knotweed

[0092] The effect of Pb78 gene silencing on the resistance of host rapeseed to root-knot fungi under different levels of root-knot fungi infection was investigated: the seeds were soaked in the treatment solution using the same preparation method and experimental method as the treatment solution in Example 1, placed in a shaking table at 200 rpm / min, and treated at 28°C for 20-30 h, and the broken and germinated seeds were planted in the soil. The seedlings were 7 days old and inoculated with root-knot fungi dormant spores at a concentration of 1×10 6 , 1×10 7 and 1×10 8 / ml suspension, and 300μl was inoculated into each rapeseed seedling.

[0093] Planting was carried out in the same manner as in Example 2, and the results are as follows Figure 8 As shown in the figure, Pb78 gene silencing can reduce the host symptoms under infection with different concentrations of root-knot fungus.

[0094] The silencing effect of the root knot fungus effector Pb78 was further tested. Figure 9-10 As shown in the figure, under infection with different concentrations of dormant spores of Rhizoctonia solani, the host plants could obviously silence Pb78. The actin gene of Rhizoctonia solani was detected by fluorescence quantitative PCR. 6 / ml of dormant spores can better inhibit root-knot fungus infection than the other two concentrations, indicating that Pb78 gene silencing can enhance the host's resistance to root-knot fungus infection, but the inhibitory effect is weakened at high concentrations of root-knot fungus infection.

Claims

1. The root-knot bacteria effector Pb78, the nucleic acid sequence of which is shown in SEQ ID NO.

1.

2. Host-induced silencing of the root-knot fungus effector Pb78 according to claim 1 in preventing and controlling root-knot fungus infection.

3. The use according to claim 2, characterized in that The application is used for preventing and controlling cruciferous crops from being infected by root knot fungi.

4. A plant expression vector containing the palindromic sequence of the root-knot fungus effector Pb78 according to claim 1.

5. A treatment liquid for preventing and controlling root knotweed, the treatment liquid contains an engineered strain having a plant expression vector having the palindromic sequence of the root knotweed effector Pb78 according to claim 1.

6. A method for preparing a root knot fungus control treatment liquid, the preparation method comprising the following steps: (1) Construction of an engineering strain with a plant expression vector having a Pb78 palindromic sequence Using total RNA of root knot fungus and reverse transcribed full-length cDNA as template, the target fragments were amplified with forward and antisense primers containing restriction sites and purified and recovered. The effector sense and antisense chains were connected to the pKANNIBAL vector by restriction enzyme ligation, and the fragments containing the forward and reverse sequences of Pb78 were obtained. The purified fragments were constructed into the pBIB-BASTA-35S-GWR-GFP vector by restriction enzyme ligation, the correct positive bacteria were identified, the recombinant plasmids were extracted, and transformed into Agrobacterium GV3101. (2) Preparation of host transient expression treatment solution Take 50 μl of Agrobacterium GV3101 obtained in step (1) and inoculate it into 50 ml of LB liquid culture medium. Grow it in a shaker at 28°C and 180 r / min for 2 days until the absorbance at 600 nm reaches 0.8-1.

0. Centrifuge the culture medium, discard the supernatant, and dilute the precipitate with MMA solution to obtain an OD 600 The MMA solution contained 8 mM / L 2-(N-morpholino)ethanesulfonic acid, 10 mM / L MgCl2·6H2O, and 180 μM / L acetosyringone.

7. Use of the treatment solution according to claim 5 in preventing and controlling root knot fungus infection in cruciferous plants.

8. The use according to claim 7, characterized in that The crucifer seeds are immersed in the treatment solution and shaken at 28° C. for 20-30 hours until the seed coat breaks and the seeds germinate.

Images