Universal induced pluripotent stem cell as well as preparation method and application thereof

Abstract

The invention provides a universal induced pluripotent stem cell in which an HLA-A gene, an HLA-B gene, a CIITA gene and a CD58 gene are knocked out as well as a preparation method and application of the universal induced pluripotent stem cell, a comprehensive immune escape mechanism is realized, the problem of dual attacks of T cells and NK cells in a transplantation process is solved, and the survival rate and clinical feasibility of transplanted cells are improved. The CRISPR-Cas9 system is introduced into the iPSCs by adopting a one-time electrotransfection technology, so that synchronous knockout of four genes is realized, the editing efficiency is greatly improved, and the success rate of simultaneous knockout of a plurality of genes is ensured. The method shortens the cell culture period, is suitable for large-scale application, and reduces the cost and complexity. The iPSCs can be further differentiated into various functional cells, such as mesenchymal stem cells and dopaminergic neurons, while low immunogenicity is kept, and the iPSCs are suitable for various scenes such as tissue engineering, cell drug preparation and transplantation drug preparation.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering and cell biology, and specifically relates to a universal iPSC and a preparation method thereof. Background Art

[0002] Since their discovery, induced pluripotent stem cells (iPSCs) have great application prospects in cell medicine and regenerative medicine due to their high self-renewal and differentiation potential. Somatic cells can be reprogrammed and further induced to differentiate into a variety of functional cells such as mesenchymal stem cells and dopaminergic neurons. This has led to widespread attention for iPSCs in the fields of cell transplantation, tissue engineering, disease models and drug screening.

[0003] However, despite the broad prospects of iPSC in clinical application, iPSC-derived cell products express donor-specific HLA antigens. In allogeneic transplantation, due to the HLA mismatch between the donor and the recipient, these antigens will be recognized as foreign by the recipient's immune system, leading to immune rejection. This immune rejection reaction hinders the widespread application of iPSC in allogeneic transplantation.

[0004] To solve this problem, researchers have explored a variety of immune escape strategies using gene editing technologies such as CRISPR-Cas9, mainly including the following methods: Gornalusse et al. knocked out the B2M gene, preventing the surface expression of HLA-I molecules, thereby avoiding CD8 + T cell immune response. In order to prevent the "missing self" reaction of NK cells triggered by the loss of HLA-I class molecules, the researchers introduced the HLA-E single-chain fusion protein into B2M knockout iPSCs through recombinant adeno-associated virus, allowing these cells to express HLA-E, thereby inhibiting NK cell killing. This method effectively avoids NK cell attacks while not activating T cell responses, and has significant advantages in immune escape. Nevertheless, this strategy is not effective for all NK cell subsets. Some NK cells are insensitive to these inhibitory signals, resulting in the failure of some immune escape strategies, which limits the coverage effect of Gornalusse et al.'s method in terms of immune escape. (Gornalusse, GG, et al., HLA-E- expressing pluripotent stem cells escape allogeneic responses and lysis by NK cells. Nature Biotechnology, 2017.35(8): p. 765-772.) Han et al. used CRISPR / Cas9 technology to knock out HLA-I class molecules (HLA-A, HLA-B, HLA-C) and HLA-II class molecules (by targeting the CIITA gene) in iPSCs to avoid immune rejection. In addition, in order to counteract the immune surveillance of NK cells and macrophages, the researchers introduced the immunomodulatory factors PD-L1, HLA-G and CD47 into iPSCs through the AAVS1 safety site. This strategy successfully reduced the immune response of T cells, NK cells and macrophages, and demonstrated good immune escape effects in in vitro and in vivo experiments. However, although the immune escape strategy of Han et al. is relatively comprehensive, the multi-step editing and overexpression strategy of immunosuppressive factors are not only complicated to operate, but also increase the risk of potential cytotoxicity and reduced immune tolerance. (Han, X., et al., Generation of hypoimmunogenic human pluripotent stem cells. Proceedings of the National Academy of Sciences, 2019.116(21): p.10441-10446.) Xu et al. proposed two HLA gene editing strategies to enhance the immune compatibility of iPSCs: one is to generate pseudo-pure iPSCs by allele-specific knockout of HLA-I molecules, reducing the difference in HLA alleles; the other is to suppress the immune response of NK cells by knocking out HLA-A and HLA-B genes while retaining the HLA-C gene, thereby retaining a certain antigen presentation ability. Studies have shown that these edited iPSCs can effectively avoid the immune response of T cells and NK cells, and this immune compatibility can cover more than 90% of the population, with broad clinical application potential. Although this strategy performs well in immune compatibility, the balance between immune escape and antigen presentation still needs to be further optimized. In particular, the retention of HLA-C may not completely prevent the attack of all NK cell subsets. (Xu, H., et al., Targeted Disruption of HLA Genes via CRISPR-Cas9 Generates iPSCs with Enhanced ImmuneCompatibility. Cell Stem Cell, 2019. 24(4): p. 566-578.e7.) Summary of the invention

[0005] The present invention aims to construct a universal induced pluripotent stem cell (iPSCs) suitable for allogeneic transplantation and regenerative medicine applications. By knocking out the HLA-A, HLA-B, CIITA and CD58 genes, a comprehensive immune escape mechanism is achieved to solve the common T cell and NK cell attack problems during transplantation, thereby improving the survival rate and clinical feasibility of transplanted cells.

[0006] One embodiment of the present invention provides a universal induced pluripotent stem cell, wherein: i.HLA-A gene and HLA-B gene are knocked out; ii. CIITA gene was knocked out; iii. CD58 gene is knocked out.

[0007] The universal induced pluripotent stem cell as described above, wherein the cell has low immunogenicity.

[0008] The universal induced pluripotent stem cells as described above, wherein the cells can be further differentiated into various functional cells such as mesenchymal stem cells and dopaminergic neurons.

[0009] Another embodiment of the present invention provides the use of the differentiated products of universal induced pluripotent stem cells in tissue engineering, preparation of cell medicines and preparation of transplantation medicines.

[0010] The differentiated products of the universal induced pluripotent stem cells as described above are used in tissue engineering, preparation of cell medicines and preparation of transplantation medicines, wherein the cells achieve immune escape from the host by regulating the expression of MHC class I, class II antigens and CD58.

[0011] Another embodiment of the present invention provides a method for preparing the universal induced pluripotent stem cells as described above, comprising the following steps: i. Using a one-time electroporation technique, the plasmid containing the CRISPR-Cas9 system is introduced into iPSC cells; ii. The system carries specific guide RNAs for targeting HLA-A, HLA-B, CIITA and CD58 genes to achieve knockout of these four genes simultaneously; iii. After gene editing is completed, iPSC cells with HLA-A, HLA-B, CIITA and CD58 genes knocked out are obtained through screening.

[0012] The method for preparing the universal induced pluripotent stem cells as described above comprises: The sgRNA for knocking out HLA-A is CCTGCGCTCTTGGACCGCGG; The sgRNA for knocking out HLA-B is CCTGCGCTCTTGGACCGCGG; The sgRNA for knocking out CIITA is ATAGAAGTGGTAGAGGCACA; The sgRNA for knocking out CD58 was ATGTTAAGTTGTAGATAGTG; Design two complementary oligonucleotides (oligo) for the selected sgRNA and form a double-stranded structure through annealing reaction; Annealing conditions: Dissolve the two oligos in Tris-HCl buffer in appropriate proportions, then heat to 95°C for 5 minutes, then gradually cool to 25°C to ensure complete annealing; The double-stranded sgRNA sequence was cut into the pX458 vector using the BbsI restriction enzyme, and the annealed sgRNA was ligated to the cutting site using T4 ligase. Beneficial Effects

[0013] The universal iPSC of the present invention has the following characteristics: Low immunogenicity: By knocking out class I and class II MHC antigens and reducing the expression of cell adhesion molecule CD58, immune escape from the host is achieved; Applicable to allogeneic transplantation: solve the limitation of HLA matching and reduce the immune rejection reaction after transplantation.

[0014] Another advantage of the present invention is that compared with the traditional viral vector system, the electroporation method adopted by the present invention is short in time and high in efficiency, and the expression or knockout effect of the target gene can be observed within 24 hours, thereby greatly shortening the culture cycle of iPSCs and reducing the risk of clinical transformation.

[0015] The universal iPSC of the present invention has broad application prospects in the following fields: Preparation of cell drugs: The prepared cell drugs are suitable for treating various genetic diseases and degenerative diseases; Tissue engineering drugs: drugs used to repair and rebuild damaged tissues and organs; Drug screening and disease models: provide an efficient and stable cell platform for drug development.

[0016] The innovation of the present invention lies in the simultaneous knockout of HLA-A, HLA-B, CIITA and CD58 genes to achieve a comprehensive immune escape mechanism, breaking through the limitations of traditional single gene knockout strategies and avoiding the dual attack of NK cells and T cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a map of Cas9 / gRNA vectors.

[0018] Figure 2 This is the HLA-A gene knockout strategy and effect diagram in iPSC.

[0019] Figure 3 This is the HLA-B gene knockout strategy and effect diagram in iPSC.

[0020] Figure 4 This is the strategy and effect diagram of CIITA gene knockout in iPSC.

[0021] Figure 5 This is the CD58 gene knockout strategy and effect diagram in iPSC.

[0022] Figure 6 The figure shows the result of NK cell proliferation.

[0023] Figure 7 This is a graph showing the results of cell death when universal iPSCs were co-cultured with NK cells.

[0024] Figure 8 The figure shows the results of T cell proliferation.

[0025] Fig. 9 This is a graph showing the results of cell death when universal iPSCs were co-cultured with T cells.

[0026] Fig.10 The figure shows the flow cytometry results showing that universal iPSCs can differentiate into mesenchymal stem cells.

[0027] Fig.11 The figure shows the flow cytometry results showing that universal iPSCs can differentiate into dopaminergic neural precursor cells. DETAILED DESCRIPTION

[0028] Example 1: Construction of gene knockout plasmid.

[0029] Figure 1 The sgRNA cloning vector is pX458. First, specific sgRNA sequences were designed in molecular biology software, and the target genes were HLA-A, HLA-B, CIITA and CD58.

[0030] Knockout of HLA-A: The knockout of HLA-A gene was completed by introducing the sg-HLA-A-pX458 plasmid into iPSCs. The plasmid contains Cas9 protein and sgRNA for targeting the HLA-A site, and the sequence is: CCTGCGCTCTTGGACCGCGG; Knockout of HLA-B: The HLA-B gene was knocked out by introducing the sg-HLA-B-pX458 plasmid into iPSCs. The plasmid contained the Cas9 protein and the sgRNA for targeting the HLA-B locus, and the sequence was CCTGCGCTCTTGGACCGCGG. Knockout of CIITA: The knockout of CIITA gene was completed by introducing the sg-CIITA-pX458 plasmid into iPSCs. The plasmid contained Cas9 protein and sgRNA for targeting CIITA site, with the sequence: ATAGAAGTGGTAGAGGCACA; Knockout of CD58: The CD58 gene was knocked out by introducing the sg-CD58-pX458 plasmid into iPSCs. The plasmid contained the Cas9 protein and the sgRNA for targeting the CD58 site, and the sequence was: ATGTTAAGTTGTAGATAGTG; For the selected sgRNA, two complementary oligonucleotides (oligo) are designed and annealed to form a double-stranded structure.

[0031] Annealing conditions: Dissolve the two oligos in Tris-HCl buffer in an appropriate ratio (usually 1:1), then heat to 95°C for 5 minutes, and then gradually cool to 25°C to ensure complete annealing.

[0032] The double-stranded sgRNA sequence was cut into the pX458 vector using the BbsI restriction enzyme, and the annealed sgRNA was ligated to the cutting site using T4 ligase.

[0033] After the reaction is completed, a transformation experiment is performed to transfer the plasmid into E. coli for amplification. Sequencing is performed to verify whether the inserted sgRNA sequence is correct.

[0034] Example 2: Electroporation of iPSC cell lines.

[0035] iPSCs were cultured using standard methods in an incubator containing 5% CO2 to maintain the cells in the exponential growth phase.

[0036] iPSCs were gently digested using cell digestion buffer, and then counted and adjusted to 1 × 10 6 Pieces / ml.

[0037] Take out 100w cells, take 0.5ug of each of the four plasmids mentioned above, add them together into the electroporation buffer, prepare a 20ul electroporation system and add it into the electroporation cup.

[0038] The electroporation cup was placed in the electroporator and electroporated at a voltage of 500 V. After the electroporation was completed, the electroporation cup was taken out.

[0039] After electroporation, the cells were transferred to a 6-well plate containing regular culture medium, and 3000 cells were seeded per well.

[0040] Cells should be cultured statically at 37°C, 5% CO2, and the medium should be changed after 48 hours to promote cell recovery.

[0041] The present invention adopts one-time electroporation technology to introduce the CRISPR-Cas9 system into iPSC cells and edit multiple genes at the same time, ensuring the high efficiency and synchronization of gene editing.

[0042] Example 3: Screening and verification of positive clones.

[0043] After the electroporated iPSC cells have grown for 7 days, a single clone cell cluster is selected and transferred to a new culture plate.

[0044] Each monoclonal cell cluster can be divided into two parts: one part is continued to be cultured, and the other part is used for genotype detection.

[0045] Extract genomic DNA from single cloned cells and lyse the cells using cell lysis buffer.

[0046] PCR amplification was performed and the target genes (HLA-A, HLA-B, CIITA, CD58) were detected using the following specific primers.

[0047]

[0048] After the electroporation is completed, the present invention uses screening technology to select positive clone cells that have successfully knocked out the HLA-A, HLA-B, CIITA and CD58 genes to obtain low-immunogenicity iPSCs.

[0049] The PCR products were subjected to agarose gel electrophoresis and DNA sequencing to verify whether the target gene was successfully knocked out.

[0050] Flow cytometry was used to further verify the effect of gene knockout. Specifically, primary antibodies against target antigens HLA-A, HLA-B, CIITA, and CD58 were used for labeling.

[0051] Flow cytometry was used to analyze whether the knockout strains lost the corresponding markers.

[0052] HLA-A detection: Extract genomic DNA of HLA-A knockout strain, perform PCR with specific primers, and verify by sequencing. Compare the sequencing sequence of the knockout strain with the original sequence. Figure 2 The knockout strategy of HLA-A is shown, and flow cytometry analysis results show that HLA-A is completely knocked out.

[0053] HLA-B detection: Extract genomic DNA of HLA-B knockout strains, perform PCR with specific primers, and sequence verification. Compare the sequencing sequence of the knockout strain with the original sequence. Figure 3 The knockout strategy of HLA-B is shown, and flow cytometry analysis results show that HLA-B is completely knocked out.

[0054] CIITA detection: Extract genomic DNA of the CIITA knockout strain, perform PCR with specific primers, and verify by sequencing. Compare the sequencing sequence of the knockout strain with the original sequence. Figure 4 The knockout strategy of CIITA is shown, and flow cytometry analysis results show that CIITA is completely knocked out.

[0055] CD58 detection: Extract genomic DNA of CD58 knockout strain, perform PCR with specific primers, and verify by sequencing. Compare the sequencing sequence of the knockout strain with the original sequence. Figure 5 The knockout strategy of CD58 is shown, and the flow cytometry analysis results show that CD58 is completely knocked out.

[0056] In summary, the sequencing and flow cytometry results showed that HLA-A, HLA-B, CIITA, and CD58 were all successfully knocked out, thereby constructing universal iPSCs.

[0057] Example 4: Results of universal iPSCs escaping NK cell killing.

[0058] Isolate NK cells from peripheral blood mononuclear cells (PBMC) using immunomagnetic beads. Use an NK cell isolation kit following the manufacturer's recommended procedures.

[0059] The isolated NK cells were cultured in RPMI 1640 medium containing 10% FBS and 50 U / mL IL-2.

[0060] The isolated NK cells were co-cultured with universal iPSCs at ratios of 1:1, 3:1, and 10:1, respectively.

[0061] The proliferation of NK cells was determined by CCK8 method. To this end, CCK8 reagent was added every day, and the absorbance signal at 450nm was measured with an ELISA reader after incubation for 30 minutes. The growth curve was drawn based on the absorbance. Figure 6 The results showed that the proliferation of NK cells co-cultured with universal iPSCs was not significantly different from that of NK cells cultured alone, proving that universal iPSCs do not activate NK cells.

[0062] Lactate dehydrogenase (LDH) release assay was used to detect iPSC cell death. To this end, the supernatant samples after co-culture were transferred to a 96-well plate, and then an equal volume of CytoTox 96® reagent was added to each well and incubated for 30 minutes. Stop solution was added and the absorbance signal at 490nm was measured using a microplate reader. The amount of LDH released was used to determine whether iPSC could effectively escape NK cell killing. Figure 7 The results showed that the amount of LDH released by universal iPSC cells co-cultured with NK cells was not significantly different from that of universal iPSC cells cultured alone, proving that universal iPSC cells can escape the killing of NK cells.

[0063] Example 5: Universal iPSCs are able to escape T cell killing.

[0064] Isolate T cells from peripheral blood mononuclear cells (PBMC) using immunomagnetic beads. Use a T cell isolation kit following the manufacturer's recommended procedures.

[0065] The isolated T cells were cultured in RPMI 1640 medium containing 10% FBS and 50 U / mL IL-2.

[0066] Isolated T cells were co-cultured with universal iPSCs at ratios of 1:1, 3:1, and 10:1, respectively.

[0067] The proliferation of T cells was determined by CCK8 method. To this end, CCK8 reagent was added every day, and the absorbance signal at 450nm was measured with an ELISA reader after incubation for 30 minutes. The growth curve was drawn based on the absorbance. Figure 8 The results showed that the proliferation of T cells co-cultured with universal iPSCs was not significantly different from that of T cells cultured alone, proving that universal iPSCs do not activate T cells.

[0068] LDH release assay was used to detect iPSC cell death. To this end, the supernatant samples after co-culture were transferred to a 96-well plate, and then an equal volume of CytoTox 96® reagent was added to each well and incubated for 30 minutes. Stop solution was added and the absorbance signal at 490nm was measured using a microplate reader. The amount of LDH released was used to determine whether iPSC could effectively escape T cell killing. Fig. 9 The results showed that the amount of LDH released by universal iPSC cells co-cultured with T cells was not significantly different from that of universal iPSC cells cultured alone, proving that universal iPSC cells can escape T cell killing.

[0069] Example 6: Universal iPSCs can differentiate into mesenchymal stem cells.

[0070] This article introduces the experimental method of differentiating iPSCs into mesenchymal stem cells in Chinese patent document 202311783752.5, and verifies the results of differentiating unedited iPSCs and edited universal iPSCs into mesenchymal stem cells. Fig.10 It showed that the edited universal iPSCs could differentiate into mesenchymal stem cells normally, and flow cytometry results showed that the purity of the differentiated mesenchymal stem cells was higher than 97%.

[0071] Example 7: Universal iPSCs can be differentiated into dopaminergic neural precursor cells.

[0072] This article introduces the experimental method of differentiating iPSCs into dopaminergic neural progenitor cells in Chinese patent document 202311783763.3, and verifies the results of differentiating unedited iPSCs and edited universal iPSCs into dopaminergic neural progenitor cells. Fig.11 It showed that the edited universal iPSCs could differentiate normally into dopaminergic neural progenitor cells, and flow cytometry results showed that the purity of the differentiated dopaminergic neural progenitor cells was higher than 95%.

[0073] The present invention is an innovative method for achieving comprehensive immune escape by knocking out HLA-A, HLA-B, CIITA and CD58 genes at one time, which has the following advantages: Dual immune escape effect: Knockout of HLA-A and HLA-B can significantly reduce the expression of MHC-I antigens and avoid CD8 + T cell attack; knocking out the CIITA gene can inhibit the expression of MHC-II and block CD4 + T cell recognition. At the same time, knocking out the CD58 gene reduced the expression of cell surface immune adhesion molecules, weakening the adhesion and aggressiveness of T cells and NK cells.

[0074] Simplified operation and efficient editing: The CRISPR-Cas9 system is introduced into iPSCs using one-time electroporation technology to achieve simultaneous knockout of four genes, greatly improving editing efficiency and ensuring the success rate of simultaneous knockout of multiple genes. This method shortens the cell culture cycle, is suitable for large-scale applications, and reduces costs and complexity.

[0075] Broad differentiation potential and application prospects: While maintaining low immunogenicity, the iPSCs of the present invention can be further differentiated into a variety of functional cells (such as mesenchymal stem cells, dopaminergic neurons, etc.), which are suitable for various scenarios such as tissue engineering, preparation of cell drugs and preparation of transplant drugs, and have broad application prospects.

[0076] It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above and that the invention can be implemented in other specific forms without departing from the spirit or essential features of the invention. Therefore, the embodiments should be considered exemplary and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations falling within the meaning and scope of the equivalent elements of the claims be included in the invention. Any reference numeral in a claim should not be considered as limiting the claim to which it relates.

Claims

1. Universal induced pluripotent stem cells, characterized in that: i.HLA-A gene and HLA-B gene are knocked out; ii. CIITA gene was knocked out; iii. CD58 gene is knocked out.

2. The universal induced pluripotent stem cell according to claim 1, characterized in that The cells have low immunogenicity.

3. The universal induced pluripotent stem cell according to claim 1, characterized in that The cells can be further differentiated into various functional cells such as mesenchymal stem cells and dopaminergic neurons.

4. Use of the differentiated products of the universal induced pluripotent stem cells as claimed in claim 3 in tissue engineering, preparation of cell medicines and preparation of transplantation medicines.

5. The use of the differentiated product of the universal induced pluripotent stem cell according to claim 4 in tissue engineering, preparation of cell medicine and preparation of transplant medicine, characterized in that: The cells achieve immune escape from the host by regulating the expression of MHC class I, class II antigens and CD58.

6. The method for preparing universal induced pluripotent stem cells according to claim 1, characterized in that: The following steps are included: i. Using a one-time electroporation technique, the plasmid containing the CRISPR-Cas9 system is introduced into iPSC cells; ii. The system carries specific guide RNAs for targeting HLA-A, HLA-B, CIITA and CD58 genes to achieve knockout of these four genes simultaneously; iii. After gene editing is completed, iPSC cells with HLA-A, HLA-B, CIITA and CD58 genes knocked out are obtained through screening.

7. The method for preparing universal induced pluripotent stem cells according to claim 6, characterized in that: Include: The sgRNA for knocking out HLA-A is CCTGCGCTCTTGGACCGCGG; The sgRNA for knocking out HLA-B is CCTGCGCTCTTGGACCGCGG; The sgRNA for knocking out CIITA is ATAGAAGTGGTAGAGGCACA; The sgRNA for knocking out CD58 was ATGTTAAGTTGTAGATAGTG; Design two complementary oligonucleotides (oligo) for the selected sgRNA and form a double-stranded structure through annealing reaction; Annealing conditions: Dissolve the two oligos in Tris-HCl buffer in appropriate proportions, then heat to 95°C for 5 minutes, then gradually cool to 25°C to ensure complete annealing; The double-stranded sgRNA sequence was cut into the pX458 vector using the BbsI restriction enzyme, and the annealed sgRNA was ligated to the cutting site using T4 ligase.

Images