Application of CCHC type zinc finger protein PbrZFP719 gene in promoting growth of pear pollen tube

Abstract

The invention discloses application of a CCHC type zinc finger protein PbrZFP719 gene in promoting growth of pear pollen tubes, and belongs to the technical field of plant genetic engineering. According to the invention, the gene PbrZFP719 is cloned from 'Huanghua pear' pollen by using a plant gene cloning technology, and the nucleotide sequence of the gene PbrZFP719 is shown as SEQ ID No.1; the amino acid sequence coded by the gene is SEQ ID No.2 in the sequence table. Researches show that the PbrZFP719 gene can promote the growth of a pear pollen tube, the change of PbrZFP719 gene expression is related to the change of ROS level and cellulose content at the top end of the pollen tube, and meanwhile, the PbrZFP719 gene also participates in a regulation mechanism of a self-incompatible reaction. The pollen magnetic transfection technology is adopted to research the function of the gene in the pollen tube, and a wide application prospect is provided for improving the pollination efficiency.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and specifically relates to the application of CCHC type zinc finger protein (ZFP) PbrZFP719 gene in promoting the growth of pear pollen tube. The present invention clones the CCHC type ZFP PbrZFP719 gene from 'Huanghuali' pollen, and the gene is highly expressed in pollen grains and pollen tubes. The PbrZFP719 gene is transiently knocked down or stably overexpressed in pear pollen tubes by antisense oligonucleotide transfection (ODN) and pollen magnetic transfection, and the results show that overexpression of the PbrZFP719 gene can promote the growth of pear pollen tubes. Further analysis shows that changes in the expression of the PbrZFP719 gene are related to changes in the level of reactive oxygen species (ROS) and cellulose content at the top of the pollen tube. At the same time, the PbrZFP719 gene also participates in the self-incompatibility reaction of pears by responding to self-S-RNase. Background Art

[0002] Self-incompatibility (SI) is a reproductive strategy that prevents selfing and promotes outcrossing to improve species diversity. Rosaceae fruit trees, such as pear and apple, exhibit gametophytic self-incompatibility (GSI). GSI is controlled by the S-site containing the female-determining factor S-RNase and the male-determining factors SLFs / SFBs (Franklin et al. 2008; Kao et al. 2004; Chen et al. 2018; Ushijima K et al. 2003). When pollen from the same S-site falls on the stigma, S-RNase becomes toxic and damages cell structures, such as destroying cell wall structure and affecting ROS levels, ultimately leading to fertilization failure (Wang et al. 2010; Chen et al. 2018; Wu et al. 2023a). On the contrary, when pollen from different S-sites is fertilized, the SLFs / SFBs genes of the Skp1-Culin1-F-box (SCF) complex can neutralize S-RNase and promote the elongation of pollen tubes (Hua et al. 2006). At present, factors outside the S-site related to SI reaction have also been found, including leucine-rich repeat extension protein (LRX; Wu et al. 2023a), GPI anchor protein (COBRA; Wu et al. 2023b), inositol oxygenase (MIOX3; Xu et al. 2024), pectin methylesterase (PME44; Tang et al. 2023), self-incompatibility pollen protein (SIPP; GarciaValencia et al. 2017), and soluble inorganic pyrophosphatase (PPa; Li et al. 2018).

[0003] Zinc finger proteins (ZFPs) contain at least one zinc finger motif, including C4HC3, C3H, C3HC4, CCHC, C2H2, C2HC5, C8, C4 and C6 types (Berg and Shi 1996). CCHC-type ZFPs contain the conserved amino acid sequence characteristics of Cys-X2-Cys-X4-His-X4-Cys. These proteins have RNA or single-stranded DNA binding activity and participate in protein-protein interactions (Liew et al. 2000). Therefore, CCHC-type ZFPs may play a role in transcriptional regulation, translational regulation and pre-mRNA splicing. However, whether CCHC-type ZFPs are involved in pollen tube growth and self-incompatibility response remains to be explored.

[0004] Pear is a fruit that is deeply loved by the people, and successful pollination and fertilization are the key to ensuring the yield of pears. The present invention obtains the PbrZFP719 gene that is highly expressed in pear pollen, and studies its effect on the growth of pear pollen tubes and its role in the process of pear self-incompatibility. Exploring pollen magnetic transfection technology and applying it to practice can greatly reduce the cost of artificial pollination, and it also has considerable theoretical and practical significance for agricultural production. Summary of the invention

[0005] The purpose of the present invention is to provide a PbrZFP719 gene or a biomaterial related to the PbrZFP719 gene for use in promoting the growth of pear pollen tubes. The applicant screened a PbrZFP719 gene highly expressed in pollen tubes from 'Huanghuali', which belongs to the CCHC type ZFPs family gene. The pollen tube magnetic transfection technology was applied to the pollen overexpression research, and combined with pollen ODN transfection, it was identified that the PbrZFP719 gene has the function of affecting the ROS level and cellulose content at the top of the pollen tube and affecting the growth of pear pollen tubes.

[0006] In order to achieve the above purpose, the present invention adopts the following technical solutions:

[0007] In the first aspect, the present invention claims protection for at least one application of the PbrZFP719 gene or a biological material related to the PbrZFP719 gene in the following (a1)-(a8):

[0008] (a1) Application in promoting the growth of pollen tubes in pear flowers;

[0009] (a2) Application in the preparation of a product for promoting the growth of pear pollen tubes;

[0010] (a3) Application in increasing ROS levels at the tip of pear pollen tubes;

[0011] (a4) Application in the preparation of a product for increasing the ROS level at the tip of pear pollen tubes;

[0012] (a5) Application in increasing the cellulose content at the tip of pollen tubes in pear flowers;

[0013] (a6) Application in the preparation of a product for increasing the cellulose content at the top of a pear pollen tube;

[0014] (a7) Application in improving the efficiency of in vitro pollination of pear;

[0015] (a8) Application in the preparation of a product for improving the efficiency of in vitro pollination of pears;

[0016] The PbrZFP719 gene is any one of the following DNA molecules (b1)-(b4):

[0017] (b1) a DNA molecule whose coding region includes the nucleotide sequence shown in SEQ ID NO.1;

[0018] (b2) a DNA molecule with a nucleotide sequence as shown in SEQ ID NO.1;

[0019] (b3) A DNA molecule that hybridizes with the DNA sequence defined in (b1) or (b2) under stringent conditions and encodes a protein associated with promoting pollen tube growth in pear flowers.

[0020] Furthermore, the biological material related to the PbrZFP719 gene is at least one of the following (c1)-(c6):

[0021] (c1) protein encoded by the PbrZFP719 gene;

[0022] (c2) an expression cassette containing the PbrZFP719 gene;

[0023] (c3) a recombinant vector containing the PbrZFP719 gene, or a recombinant vector containing the expression cassette described in (c2);

[0024] (c4) a recombinant microorganism containing the PbrZFP719 gene, or a recombinant microorganism containing the expression cassette described in (c2), or a recombinant microorganism containing the recombinant vector described in (c3);

[0025] (c5) a transgenic plant cell line containing the PbrZFP719 gene, or a transgenic plant cell line containing the expression cassette described in (c2), or a transgenic plant cell line containing the recombinant vector described in (c3);

[0026] (c6) A magnetic transfection reagent containing the PbrZFP719 gene, or a magnetic transfection reagent containing the expression cassette described in (c2), or a magnetic transfection reagent containing the recombinant vector described in (c3).

[0027] Furthermore, the protein encoded by the PbrZFP719 gene is as follows (d1) or (d2) or (d3):

[0028] (d1) a protein with an amino acid sequence as shown in SEQ ID NO.2;

[0029] (d2) a protein derived from SEQ ID NO.2 which is related to promoting the growth of pear pollen tubes and in which one or more amino acid residues of the amino acid residue sequence shown in SEQ ID NO.2 are substituted and / or deleted and / or added;

[0030] (d3) A fusion protein in which the N-terminus and / or C-terminus of (d1) or (d2) are linked to a protein tag.

[0031] Furthermore, the above application is to stably overexpress the PbrZFP719 gene in pear pollen tubes to promote the growth of pear pollen tubes or / and increase the ROS level or / and cellulose content at the top of pear pollen tubes. Furthermore, the PbrZFP719 gene is stably overexpressed in pear pollen tubes by treating pear pollen in vitro using magnetic transfection overexpression technology.

[0032] The applicant screened a PbrZFP719 gene highly expressed in pollen tubes from 'Huanghuali (Pyrus)', which belongs to the CCHC-type ZFPs family gene; and cloned the CCHC-type ZFPs family gene PbrZFP719 from 'Huanghuali' using gene cloning technology. The nucleotide sequence of PbrZFP719 is shown in SEQ ID No.1, which contains an open reading window of 843bp and encodes 281 amino acids. The amino acid sequence encoded by it is shown in SEQ ID No.2, with an isoelectric point of 9.55 and a molecular weight of 30.96kDa.

[0033] The applicant designed a pair of cDNA primers for cloning the gene PbrZFP719, the base sequence of which is shown below:

[0034] PbrZFP719 F1:5'-ATGGCAGGGAAGGAAGACTACC-3'(SEQ ID No.3)

[0035] PbrZFP719 R1:5'-GTAACGGTCAAAGGAAGATGGG-3' (SEQ ID No. 4).

[0036] ODN and magnetofection overexpression techniques were used to treat 'Huanghuali' pollen in vitro to verify that PbrZFP719 has the function of promoting pollen growth and affecting the ROS level and cellulose content at the top of the pollen tube.

[0037] In a second aspect, the present invention seeks to protect a method for promoting the growth of pear pollen tubes, wherein the PbrZFP719 gene is stably overexpressed in pear pollen tubes to promote the growth of pear pollen tubes.

[0038] In a third aspect, the present invention claims a method for increasing the ROS level and cellulose content at the top of a pear pollen tube, wherein the PbrZFP719 gene is stably overexpressed in a pear pollen tube to increase the ROS level and / or cellulose content at the top of a pear pollen tube.

[0039] In a fourth aspect, the present invention seeks to protect a method for improving the efficiency of in vitro pollination of pears, wherein the PbrZFP719 gene is stably overexpressed in pear pollen tubes to promote the growth of pear pollen tubes and improve the efficiency of in vitro pollination of pears.

[0040] Furthermore, in the above method, the magnetic transfection overexpression technology is used to treat pear pollen in vitro to stably overexpress the PbrZFP719 gene in pear pollen tubes. Furthermore, the magnetic transfection overexpression technology specifically includes the following steps:

[0041] (1) Designing primers for PCR amplification of the PbrZFP719 gene, inserting the PbrZFP719 gene into the XbaI and BamHI restriction sites of the LAT52::GFP vector, and constructing a recombinant plasmid PbrZFP719-LAT52::GFP;

[0042] (2) The transfection reagent and the recombinant plasmid PbrZFP719-LAT52::GFP were mixed and prepared. / PbrZFP719-LAT52::GFP transfection reagent was used as described / PbrZFP719-LAT52::GFP transfection reagent treated pollen cells.

[0043] The present invention clones the gene PbrZFP719 from the pollen of 'Huanghuali' by using plant gene cloning technology. The gene belongs to the CCHC type ZFPs gene family member and is highly expressed in pollen grains and pollen tubes. The pollen of 'Huanghuali' was treated in vitro by ODN and pollen magnetic transfection test. The results showed that the overexpression gene PbrZFP719 can actively promote the growth of pollen tubes, and the changes in the expression of PbrZFP719 are related to the changes in the ROS level and cellulose content at the top of the pollen tube. In addition, PbrZFP719 is also involved in the regulatory mechanism of self-incompatibility reaction. The present invention uses pollen magnetic transfection technology to study the function of genes in pollen tubes, which provides broad application prospects for improving pollination efficiency.

[0044] The room temperature described in the present invention is generally 25±10° C., but is not limited thereto.

[0045] Compared with the prior art, the present invention has the following advantages and effects:

[0046] (1) The discovery of the PbrZFP719 gene provides a new idea for improving the efficiency of in vitro pollination of pears, reducing labor costs, and providing a new way to implement green agriculture.

[0047] (2) Compared with the traditional pollen gene gun technology, the method of overexpressing pollen tube genes through pollen magnetic transfection technology has the advantages of high transformation efficiency, simple operation, cost saving, and targeted trait improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 Identification of CCHC-type ZFPs family members in pear.

[0049] Figure 2 Transcriptome expression patterns of 14 CCHC-type ZFPs genes in different tissues.

[0050] Figure 3 The PbrZFP719 gene positively promotes pollen tube growth;

[0051] Among them, A is the phenotypic image of pollen tubes treated with as-ODN, s-ODN, cell transfection and control, and the black line represents a scale bar (50 μm); B is the length of pollen tubes treated with as-ODN, s-ODN, cell transfection and control; C is the expression level of PbrZFP719 gene in pollen tubes with different treatments.

[0052] Figure 4 For the application of magnetic transfection of PbrZFP719 gene in promoting pollen tube growth;

[0053] Among them, A is a fluorescent image of pollen magnetic transfection. The red line indicates a scale bar (10μm); B is a phenotypic image of pollen tubes transferred by PbrZFP719-LAT52::GFP fusion vector and LAT52::GFP vector, and the red line indicates a scale bar (50μm); C is the length of pollen tubes measured by pollen magnetic transfection experiment; D is the expression level of PbrZFP719 in pollen tubes detected by pollen magnetic transfection experiment.

[0054] Figure 5 The PbrZFP719 gene positively mediated the ROS level and cellulose content at the pollen tube tip;

[0055] Among them, A is the fluorescence value of ROS in pollen tubes treated with as-ODN, s-ODN, cell transfection and control, stained with CM-H2DCFDA; B is the ROS level in pollen tubes detected by pollen magnetic staining experiment; C is the cellulose fluorescence value in pollen tubes treated with as-ODN, s-ODN, cell transfection and control; D is the image of cellulose content in pollen tubes induced by lat52::GFP vector and PbrZFP719-lat52::GFP fusion vector.

[0056] Figure 6 Self-S-RNase reduces the expression of the PbrZFP719 gene;

[0057] Among them, A is the ROS level in pollen tubes treated with self-S-RNase, non-self-S-RNase and control group; B is the fluorescence value of cellulose in pollen tubes after treatment; C is the expression level of PbrZFP719 in pollen tubes treated with self-S-RNase, non-self-S-RNase and control. Specific implementation plan

[0058] The present invention is described in detail below in conjunction with specific embodiments. Based on the following description and these embodiments, those skilled in the art can determine the essential features of the present invention, and can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention to make it suitable for various uses and conditions.

[0059] Example 1 Tissue localization of PbrZFP719 gene

[0060] CCHC-ZFP genes were identified from the pear (http: / / www.peargenome.njau.edu.cn) genome using a hidden Markov model (PF00098). ExPasy (http: / / web.expasy.org / protparam / ) was used to calculate the isoelectric point and molecular weight. The amino acid sequence was used to search for conserved motifs shared by members of the pear gene family in MEME (http: / / meme-suite.org / tools / meme). A total of 14 CCHC-type ZFPs genes were identified in pear, all of which contained a CCHC domain (e.g. Figure 1 shown).

[0061] Transcriptome data from previous studies were used to elucidate the expression patterns of 14 CCHC-type ZFPs genes in various tissues. Transcriptome analysis revealed the expression patterns of 14 CCHC-type ZFPs genes in pollen tubes, inflorescences, petioles, petioles, and leaves. S1 to S6 represent 30, 45, 60, 75, 90, and 110 days after harvest. 0, 1, 6, and 15 h represent the time that pollen was cultured in culture medium. The results showed that PbrZFP719 showed high levels of expression in all developmental stages of the tested tissues (e.g. Figure 2 ), especially in pollen grains and pollen tubes, suggesting its potential role in pollen tube growth.

[0062] Example 2 Identification of the effect of PbrZFP719 on pollen tube growth

[0063] The antisense oligodeoxynucleotide sequence (as-ODN) and sense oligonucleotide sequence (s-ODN) of PbrZFP719 were designed through the RNAfold website (http: / / rna.tbi.univie.ac.at). At the same time, the primer sequences were thiolated and purified by HPLC.

[0064] Primers for PbrZFP719-ODN are as follows:

[0065] PbrZFP719-as-ODN:5'-CGCCTCTAGCTGGCCCTCCGC-3'(SEQ ID No.5)

[0066] PbrZFP719-s-ODN:5'-GCTATGGAGAGAGGGACCGT-3'(SEQ ID No.6)

[0067] The specific steps are as follows: add an appropriate amount of pear pollen to 2 mL of culture medium (5 mM 2-morpholineethanesulfonic acid (MES), 440 mM sucrose, 0.55 mM calcium nitrate, 1.60 mM magnesium sulfate, 1.60 mM boric acid, 1.00 mM potassium nitrate, pH = 6.2-6.3), and incubate on a shaker for 60 min to obtain an incubated pollen culture medium. Take 12.5 μL of culture medium, 1.5 μL Lipofectamine 2000 and 6 μL of ODN primers, and incubate at room temperature for 15 min to obtain a premixed ODN primer; add the premixed ODN primer to 180 μL of incubated pollen culture medium; at 25°C, continue to culture pollen for 3 hours. Use a Nikon Eclipse E100 microscope (Tokyo, Japan) for observation and photography, and use Image J to measure the pollen tube length (such as Figure 3The results showed that after 3 h of treatment (HAT), pollen tubes treated with as-ODN were shorter than those treated with s-ODN, transfection reagent, and culture buffer (Fig. Figure 3 (as shown in B in the figure).

[0068] 3000rpm, 10min to collect pollen, remove liquid culture medium, and freeze in -80℃ refrigerator. Extract pollen RNA, obtain first-strand cDNA by reverse transcription, and use it for qRT-PCR experiment of PbrZFP719 gene. RNA extraction uses plant total RNA extraction kit (purchased from Beijing Tiangen Biotechnology Co., Ltd., and operate according to the operating instructions provided by the kit). RNA is reverse transcribed into cDNA using TransScript One-Step RT-PCR SuperMix (purchased from Beijing Quanshijin Biotechnology Co., Ltd., and operate according to the instructions provided by the kit). Design specific quantitative primers for PbrZFP719 gene:

[0069] PbrZFP719-qPCR-F:5'-ATGATAGGGATGGTGGCGCAA-3'(SEQ ID No.7)

[0070] PbrZFP719-qPCR-R:5'-AACGGTCAAAGGAAGATGGGC-3'(SEQ ID No.8)

[0071] The pear UBQ gene was used as an internal reference, and its specific quantitative primers were:

[0072] PbUBQ-F:5'-CCCTTCACTTGGTTCTCCGT-3'(SEQ ID No.9)

[0073] PbUBQ-R:5'-TAATCAGCAAGCGTGCGACC-3'(SEQ ID No.10)

[0074] The qRT-PCR experiment used the LC480 SYBR Green Mix kit (purchased from Roche) and was performed according to the kit instructions. The 20μL qRT-PCR reaction system included: 10μL 2×SYBR Green Mix, 0.4uM forward primer and reverse primer, 20ng cDNA, and the rest was supplemented with sterile water. A 96-well qRT-PCR plate (purchased from Roche) was used to perform PCR using a qRT-PCR instrument (model: LightCycler 480, Roche). The qRT-PCR reaction program was: pre-denaturation at 95°C for 10 minutes; denaturation at 95°C for 3 seconds, annealing at 62°C for 10 seconds, extension at 72°C for 30 seconds, and 45 cycles. Three biological replicates and three technical replicates were set for each cDNA, and the average Ct value of each cDNA sample was calculated. By calculating 2 -ΔΔCt The relative expression of PbrZFP719 gene was obtained. The standard error is based on 3 replicates of qRT-PCR analysis and at least 90 pollen tube growth analyses. The variance analysis was performed using Student's t-test, and letters (a and b) indicate P < 0.05. Figure 3 As shown in Figure C, the expression level of PbrZFP719 gene decreased in pollen tubes treated with as-ODN. These results indicate that the reduction of PbrZFP719 expression inhibits the growth of pear pollen tubes.

[0075] Example 3 Application of magnetic transfection of PbrZFP719 gene in promoting pollen tube growth

[0076] In the present invention, the plasmid vector is LAT52::GFP vector (Qian et al. 2020). The resistance tag of this vector is kanamycin, and the double enzyme digestion is preferably XbaI and BamHI (purchased from NEB). The optimal reaction system and conditions for enzyme digestion: 800ng LAT52::GFP empty plasmid, 5μL 10×Cutsmart Buffer, 1μL BamHI endonuclease, 1μL XbaI endonuclease, fill to 50μL with ddH2O, and react at 37°C for 4h.

[0077] The primer pairs for PCR amplification of genes are:

[0078] PbrZFP719-F1:5'-ATGGCAGGGAAGGAAGACTACC-3'(SEQ ID No.3)

[0079] PbrZFP719-R1:5'-GTAACGGTCAAAGGAAGATGGG-3'(SEQ ID No.4)

[0080] PCR amplification system: 2μL'Huanghuali'pollen cDNA, 2.5μL of forward and reverse primers, 25μL 2×PhantaMaxBuffer, 1μL dNTP Mix, 1ul PhantaMax Super-Fidelity DNA Polymerase (purchased from Nanjing Novozyme Biotechnology Co., Ltd.), and ddH2O was used to make up to 50μL. The amplification program was: 94℃, pre-denaturation for 3min, 94℃ denaturation for 30s, 60℃ annealing for 30s, 72℃ extension for 140s, 35 thermal cycles, 72℃ extension for 10min, and 4℃ storage. After amplification, the PCR product of a single target band was detected by 1.5% agarose gel electrophoresis, and the specific band was recovered according to the instructions of the gel recovery kit (purchased from Nanjing Novozyme Biotechnology Co., Ltd.).

[0081] The double-enzyme digested vector was connected to the purified DNA. The ligase ExnaseII was purchased from Nanjing Novozyme Biotechnology Co., Ltd. The reaction system was 20 μL: 150 ng LAT52:: GFP linear vector, 50 ng gene fragment, 4 μL 5×CE IIBuffer, 2 μL ExnaseII, and the rest was supplemented with ddH2O, 37°C for 30 min. Then the ligation product was transferred into Escherichia coli DH5a (purchased from Nanjing Novozyme Biotechnology Co., Ltd.), ice bathed for 30 min, heat shocked for 45 s, ice bathed for 2 min, and activated on a 37°C 220 rpm shaker for 60 min. After activation, it was coated on a LB solid plate with 100 μg / ml kanamycin. After 14 hours, 5 positive clones were selected for sequencing (completed by Shanghai Shenggong Biotechnology Co., Ltd.). The recombinant plasmid PbrZFP719-LAT52:: GFP that was successfully sequenced was extracted using an endotoxin-free plasmid extraction kit (purchased from Nanjing Novozyme Biotechnology Co., Ltd.).

[0082] The optimal method for pollen magnetic transfection is as follows: Place the pollen cells of 'Huanghuali' in a tissue culture dish placed on a magnetic scale plate (purchased from Nanjing Dongna Co., Ltd.). The volume of the culture medium containing the cells depends on the specifications of the culture dish. The preferred transfection volume is 0.5 mL. Incubate for 15 minutes. The transfection reagent (purchased from Nanjing Dongna Co., Ltd.) and PbrZFP719-LAT52::GFP recombinant plasmid were mixed, preferably 0.5-2μL, DNA amount 0.5-3μg. LAT52::GFP empty plasmid as control; / PbrZFP719-LAT52::GFP transfection reagent and control reagent were added to the cells, and the cell culture dish was still placed on the magnetic scale plate for incubation for 20 minutes; the supernatant pollen culture medium was carefully removed from the cells, and fresh culture medium was added, and the culture plate was still placed on the magnetic scale plate. Be careful not to suck away the cells that sink due to the magnetic force; remove the culture plate from the magnetic scale plate; after culturing under standard conditions of 25°C 120rpm for 3h, observe whether there is GFP fluorescence in the magnetically transfected pollen by laser confocal microscope LSM800 (Zeiss, Germany) to determine whether the MNP / DNA complex is transferred into the pollen. The pollen tube length was counted using a Nikon Eclipse E100 microscope (Tokyo, Japan) for data analysis. Extract the pollen RNA after magnetic transfection, and obtain the first-strand cDNA by reverse transcription for qRT-PCR experiments of the PbrZFP719 gene. Pollen RNA extraction, cDNA reverse transcription and qRT-PCR experiments are the same as in Example 2. Standard errors are based on three replicates of qRT-PCR analysis and at least 90 pollen tube growth assays. ANOVA was performed using Student's t-test, and letters (a and b) indicate P < 0.05.

[0083] The results showed that GFP fluorescence was detected in pollen tubes introduced with LAT52::GFP or PbrZFP719-LAT52::GFP fusion vectors, indicating the applicability of pollen magnetic staining technology in the study of gene overexpression in pear pollen tubes (e.g. Figure 4 3 HATs (as shown in A in Figure 4 As shown in B and C in Figure 1, the pollen tubes introduced with the PbrZFP719-LAT52::GFP fusion vector were longer than those introduced with the LAT52::GFP vector. At the same time, the expression level of PbrZFP719 in the pollen tubes of the PbrZFP719 fusion vector was increased compared with that of the LAT52::GFP vector (as shown in Figure 1). Figure 4 These results indicate that increased expression of PbrZFP719 promotes the growth of pear pollen tubes.

[0084] Example 4 Identification of the effects of PbrZFP719 on ROS and cellulose content in pollen tubes

[0085] Pollen culture was the same as in Examples 2 and 3.

[0086] The present invention uses H2DCFDA (Thermo Fisher Scientific, USA) fluorescent staining method to determine the ROS level at the top of the pollen tube. The optimal method is as follows: After adding H2DCFDA fluorescent dye with a final concentration of 20 μM to the pollen sample for staining for 20 minutes, the sample is washed three times with liquid culture medium; the laser confocal microscope LSM800 (Zeiss, Germany) is used for observation and photography, and the fluorescence intensity of the pollen tube tip is counted using Zeiss software. Calcofluor White (Merck, Germany) is used for cellulose staining of pollen tubes at a final concentration of 1 μg / mL.

[0087] The results showed that the ROS fluorescence at the tip of the pollen tube treated with as-ODN decreased compared with that of the pollen tubes treated with s-ODN, transfection reagent, and buffer (Fig. Figure 5 In contrast, the pollen tube tips into which the PbrZFP719-LAT52::GFP vector was introduced showed higher ROS fluorescence (as shown in A). Figure 5 These results suggest that the PbrZFP719 gene plays an active role in the level of ROS at the tip of the pear pollen tube. In addition, Calcofluor White fluorescence staining showed that cellulose fluorescence decreased after as-ODN treatment (as shown in Figure 2A). Figure 5 ), and the cellulose fluorescence of pollen tubes introduced with PbrZFP719-LAT52::GFP was enhanced (as shown in Figure 5 These results indicate that the PbrZFP719 gene also positively regulates the cellulose content in the pollen tube tip of pear anemones.

[0088] Example 5 Identification of the PbrZFP719 gene involved in self-incompatibility reaction

[0089] The full-length coding sequences of PbrS1- and PbrS2-RNase genes were amplified from the style of "Huanghuali" and the full-length coding sequences of PbrS7- and PbrS34-RNase genes were amplified from the style of "Dangshansuli"; four S-RNases were inserted into the pCold-TF expression vector to produce his-tagged recombinant proteins; BamHI and XbaI were selected as endonucleases. The primer pair sequences are as follows:

[0090] PbrS1-RNase-F:5'-ATGTACGATTATTTTCAATTTACGCAGCAAT-3'(SEQ ID No.11)PbrS1-RNase-R:5'-ATACTGAACACTGGAGGGGCAGG-3'(SEQ ID No.12)

[0091] PbrS2-RNase-F:5'-ATGGCGAGATACGATTATTTTCAATTTACGC-3'(SEQ ID No.13)PbrS2-RNase-R:5'-ATACTGAATATCATCAATGGGGCAGAA-3'(SEQ ID No.14)

[0092] PbrS7-RNase-F:5'-ATGTACGATTATTTTCAATTTACGCAGCAAT-3'(SEQ ID No.15)PbrS7-RNase-R:5'-ATACTTAACATCGGCCGGGCAG-3'(SEQ ID No.16)

[0093] PbrS34-RNase-F:5'-ATGTACGATTATTTTCAATTTACGCAGCAAT-3'(SEQ ID No.17)PbrS34-RNase-R:5'-ATACTGAATACTATTGTTTGGGCAAAAATG-3'(SEQ ID No.18)

[0094] The preferred PCR procedure, enzyme digestion system and recombinant vector construction are the same as those in Example 3.

[0095] Take 500ng of the recombinant plasmid and transform Escherichia coli Rosetta (DE3) respectively, spread it on LB plates containing 100μg / mL ampicillin to screen the recombinant gene, and culture it in a 37℃ incubator for 14h. The pCold-TF vector plasmid was also transferred into Rosetta (DE3) as a control in the same way. Select single clone colonies for identification. Inoculate the Escherichia coli Rosetta (DE3) transformed with the recombinant plasmid mentioned above on LB liquid screening medium for activation, culture it at 37℃ and 220rpm overnight, and then transfer it to a new liquid screening medium to expand the culture OD 600 =0.4-0.6, the inoculation volume ratio of the activation culture and the expansion culture is preferably 1:50; 2 ml of bacterial solution is taken out as a negative control. The expansion culture conical flask is quickly placed on ice for 45 minutes, and then IPTG inducer is added, preferably with a final concentration of 0.5 mmol / L, and induced expression is carried out at 16°C and 220 rpm for 18-24 hours.

[0096] After expression, the cells were collected by centrifugation at 4°C and 12000rpm. The cells were resuspended in 15mL PBS buffer (140mmol / L sodium chloride, 2.7mmol / L potassium chloride, 10mmol / L disodium hydrogen phosphate, 1.8mmol / L potassium dihydrogen phosphate, pH 7.4) and then ultrasonically disrupted at a power of 240W for 4s and 6s until the solution was clear. After ultrasonic disruption, the cells were centrifuged again at 4°C and 12000rpm for 20min to collect the supernatant. The control protein pCold-TF was expressed in the same way as above.

[0097] The recombinant protein was purified using Ni-NTA agarose affinity chromatography filler (purchased from Shanghai Shenggong Biotechnology Co., Ltd.). The specific operation was as follows: 10 times the filler volume of PBS buffer was used to balance the filler, and the flow rate was controlled to be 1 ml / min; the supernatant of the protein after crushing was added to the purification column, and the flow rate was controlled to be 0.5 ml / min; 20 times the filler volume of cleaning solution containing 20 mmol / L imidazole (500 mmol / L sodium chloride, 50 mmol / L tris (hydroxymethyl) aminomethane, 20 mM imidazole, pH = 7.4) was used to wash the column, and the flow rate was controlled to be 1 ml / min; 8 times the column volume of elution solution containing 400 mmol / L imidazole (500 mmol / L sodium chloride, 50 mmol / L tris (hydroxymethyl) aminomethane, 400 mM imidazole, pH = 7.9) was used to elute the purification column, and the flow rate was controlled to be 1 ml / min, and the eluate was collected to obtain the purified protein. A 30 kDa ultrafiltration tube was used for protein concentration and desalting. Take 10 μL of the purified protein, add 2 μL of 5× protein loading buffer (purchased from Shanghai Shenggong Biotechnology Co., Ltd.), take 10 μL for 12% conventional SDS-PAGE electrophoresis, and detect the recombinant protein purification after Coomassie brilliant blue staining and decolorization. Finally, the purified protein was dialyzed at 4°C and 5000 rpm using pollen culture medium, and then placed at -80°C for use.

[0098] The pollen of "Huanghuali" was pre-cultured in the basal medium for 1 hour, and then treated with recombinant PbrS1- and PbrS2-RNase proteins or recombinant PbrS7- and PbrS34-RNase proteins (final concentration was 0.15U). It was then cultured on a shaker at 25°C and 120rpm for 30 minutes. Some pollen was taken and stained with H2DCFDA and Calcofluor White for the pollen tube tip, and the steps were the same as in Example 4. The RNA extraction, cDNA reverse transcription and qRT-PCR experiments of the remaining pollen were the same as in Example 2.

[0099] To verify whether the PbrZFP719 gene is involved in GSI, we treated yellow flower pollen tubes with self (PbrS1- and PbrS2-RNase) and non-self S-RNase (PbrS7- and PbrS34-RNase) for 30 min. The results showed that ROS and cellulose fluorescence at the pollen tube tip in self-SI treatment decreased compared with non-self SC treatment and control pCold (Figure 2A). Figure 6 Real-time quantitative PCR analysis showed that the expression level of PbrZFP719 was reduced in pollen tubes treated with self-SI compared with those treated with non-self-SC and pCold (as shown in Figure 2A and B). Figure 6 Thus, the PbrZFP719 gene is involved in pear GSI by responding to self-S-RNase.

[0100] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

[0101] SEQ ID NO:1

[0102] ATGGCAGGGAAGGAAGACTACCGTATATTCGTGGGAGGGTTGTCGTGGGACGTGACGGAGCGTCAGCTGGAGAGCGCTTTCCAACGCTTCGGCAAAGTTCTTGAAGCTCAGATCATGATGGAAAGAGATACAAACCGTCCCCGAGGATTTGGGTTTATTACATTTGGAGATCGGCGAGCAATGGAAGACGCAATCCGGGAGATGCATGGGCGGGAGCTTAGTGATCGCATAATCTCTGTGAACAAAGCTCAACCCAAAATGGGAGGGGGAGGAGCTGGAGAGGATTCTGACCATGGCTACAGAGGAGGTGGCTACTCGTCTGGTGGCAGGAGAAACTATGGGGGAGGAGATAGACCTGTAGGACAAGATGAGTGCTTCAAGTGTGGTCGAACAGGACATTGGGCTCGAGATTGCCCTTCAGCAGGAGGCGGAAGAGGCGGTGGAGGTTCATTCTCATCACATTCTAGGTTTGGGGCTGGTGGCCGTGGGGATCGCTTTGGTGGAGACCGTGACCGCTACATGGATGACCGTTATGATGGAGGGCGCTATGGAGAGAGGGACCGTTTTGACAGCAGAGATGACAAATATGGTAGCCGTGATCGCTATGCTAGCGACAGGTACCCAGCCGGTGATCGTTTTGCAAGTGACAGGTACGGTGGTTCTGATCGTTATCCTCAAAATGGTTATGGCAAAGATAGAGGGTATGATAGGGATGGTGGCGCAAGAGGAGGCGACAGGTATGCAAGCGGAGGGCCAGCTAGAGGCGATAATTACAGAAGCAGGCCTGGTCCTTATGACCGCCCTAGCAGGGGAGGCCGCCCATCTTCCTTTGACCGTTACTAA

[0103] SEQ ID NO:2

[0104] MAGKEDYRIFVGGLSWDVTERQLESAFQRFGKVLEAQIMMERDTNRPRGFGFITFGDRRAMEDAIREMHGRELSDRIISVNKAQPKMGGGGAGEDSDHGYRGGGYSSGGRRNYGGGDRPVGQDECFKCGRTGHWARDCPSAGGGRGGGGSFSSHSRFGAGGRGDRFGGDRDRYMDDRYDGGRYGERDRFDSRDDKYGSRDRYASDRYPAGDRFASDRYGGSDRYPQNGYGKDRGYDRDGGARGGDRYASGGPARGDNYRSRPGPYDRPSRGGRPSSFDRY*。

Claims

1. Use of the PbrZFP719 gene or a biological material related to the PbrZFP719 gene in at least one of the following (a1)-(a8): (a1) Application in promoting the growth of pollen tubes in pear flowers; (a2) Application in the preparation of a product for promoting the growth of pear pollen tubes; (a3) Application in increasing ROS levels at the tip of pear pollen tubes; (a4) Application in the preparation of a product for increasing the ROS level at the tip of pear pollen tubes; (a5) Application in increasing the cellulose content at the tip of pollen tubes in pear flowers; (a6) Application in the preparation of a product for increasing the cellulose content at the top of a pear pollen tube; (a7) Application in improving the efficiency of in vitro pollination of pear; (a8) Application in the preparation of a product for improving the efficiency of in vitro pollination of pears; The PbrZFP719 gene is any one of the following DNA molecules (b1)-(b3): (b1) a DNA molecule whose coding region includes the nucleotide sequence shown in SEQ ID NO.1; (b2) a DNA molecule with a nucleotide sequence as shown in SEQ ID NO.1; (b3) A DNA molecule that hybridizes with the DNA sequence defined in (b1) or (b2) under stringent conditions and encodes a protein associated with promoting pollen tube growth in pear flowers.

2. The use according to claim 1, characterized in that: The biological material related to the PbrZFP719 gene is at least one of the following (c1)-(c6): (c1) protein encoded by the PbrZFP719 gene; (c2) an expression cassette containing the PbrZFP719 gene; (c3) a recombinant vector containing the PbrZFP719 gene, or a recombinant vector containing the expression cassette described in (c2); (c4) a recombinant microorganism containing the PbrZFP719 gene, or a recombinant microorganism containing the expression cassette described in (c2), or a recombinant microorganism containing the recombinant vector described in (c3); (c5) a transgenic plant cell line containing the PbrZFP719 gene, or a transgenic plant cell line containing the expression cassette described in (c2), or a transgenic plant cell line containing the recombinant vector described in (c3); (c6) A magnetic transfection reagent containing the PbrZFP719 gene, or a magnetic transfection reagent containing the expression cassette described in (c2), or a magnetic transfection reagent containing the recombinant vector described in (c3).

3. The use according to claim 2, characterized in that: The protein encoded by the PbrZFP719 gene is as follows (d1) or (d2) or (d3): (d1) a protein with an amino acid sequence as shown in SEQ ID NO.2; (d2) a protein derived from SEQ ID NO.2 which is related to promoting the growth of pear pollen tubes and in which one or more amino acid residues of the amino acid residue sequence shown in SEQ ID NO.2 are substituted and / or deleted and / or added; (d3) A fusion protein in which the N-terminus and / or C-terminus of (d1) or (d2) are linked to a protein tag.

4. The use according to claim 1, characterized in that: The PbrZFP719 gene is stably overexpressed in pear pollen tubes to promote the growth of pear pollen tubes and / or increase the ROS level and / or cellulose content at the top of the pear pollen tubes.

5. The use according to claim 4, characterized in that: The PbrZFP719 gene was stably overexpressed in pear pollen tubes by treating pear pollen in vitro using magnetic transfection overexpression technology.

6. A method for promoting the growth of pear pollen tubes, characterized in that: The PbrZFP719 gene described in claim 1 is stably overexpressed in pear pollen tubes to promote the growth of pear pollen tubes.

7. A method for increasing the ROS level and / or cellulose content at the top of pear pollen tubes, characterized in that: The PbrZFP719 gene described in claim 1 is stably overexpressed in pear pollen tubes to increase the ROS level and / or cellulose content at the top of the pear pollen tubes.

8. A method for improving the efficiency of in vitro pollination of pears, characterized in that: The PbrZFP719 gene described in claim 1 is stably overexpressed in pear pollen tubes to promote the growth of pear pollen tubes and improve the in vitro pollination efficiency of pears.

9. The method according to any one of claims 6 to 8, characterized in that: The PbrZFP719 gene was stably overexpressed in pear pollen tubes by treating pear pollen in vitro using magnetic transfection overexpression technology.

10. The method according to claim 9, characterized in that The magnetic transfection overexpression technology specifically comprises the following steps: (1) Designing primers for PCR amplification of the PbrZFP719 gene, inserting the PbrZFP719 gene into the XbaI and BamHI restriction sites of the LAT52::GFP vector, and constructing a recombinant plasmid PbrZFP719-LAT52::GFP; (2) The transfection reagent and the recombinant plasmid PbrZFP719-LAT52::GFP were mixed and prepared. / PbrZFP719-LAT52::GFP transfection reagent was used as described / PbrZFP719-LAT52::GFP transfection reagent treated pollen cells.

Images