Recombinant HSV-1 vector, oncolytic HSV-1 and application of oncolytic HSV-1

Abstract

The invention provides a recombinant HSV-1 vector, oncolytic HSV-1 and application of the oncolytic HSV-1, and belongs to the technical field of viral vectors. According to the recombinant HSV-1 vector provided by the invention, nucleotides at the 117014 site to the 132565 site and nucleotides at the 145316 site to the 145585 site in an HSV-1 genome are deleted. The recombinant HSV-1 vector provided by the invention is high in safety, can be copied in mammalian cells and carry a plurality of exogenous genes, has the advantages of wide host range, high infection efficiency, large capacity, easiness in preparation and sustainable expression of the carried exogenous genes, and can be applied to the fields of tumor treatment, gene therapy and virus vector vaccines. The oncolytic HSV-1 provided by the invention is high in safety, retains the replication ability in mammalian cells, has a remarkable oncolytic effect, and can induce an organism to generate tumor immune response so as to play a tumor inhibition role.

Description

Technical Field

[0001] The present invention belongs to the technical field of viral vectors, and specifically relates to a recombinant HSV-1 vector, oncolytic HSV-1 and applications thereof. Background Art

[0002] Herpes simplex virus type 1 (HSV-1) is a neurotropic virus that is very common in the population. Clinical manifestations include mild symptoms such as localized herpes on the mucosa or skin, occasionally accompanied by fever. HSV-1 is a double-stranded DNA virus with a genome of 152kb, consisting of a unique long segment (UL) and a short segment (US), with terminal inverted repeats TRL and TRS at both ends, and an internal inverted repeat (IR) at the junction of the two segments. Although there are reports in the prior art on the transformation of HSV-1 into viral vectors or oncolytic viruses, the ability of the recombinant HSV-1 vectors obtained by transformation to accommodate exogenous genes is limited, or the replication level of the oncolytic viruses obtained by transformation is low, and large-scale preparation is difficult. Summary of the invention

[0003] In view of this, one of the objects of the present invention is to provide a recombinant HSV-1 vector that is highly safe, can replicate in mammalian cells and can carry foreign genes.

[0004] The second purpose of the present invention is to provide an oncolytic HSV-1, which has direct oncolytic effect and immunomodulatory effect to achieve tumor inhibition effect, and can be applied to the treatment of various tumors.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a recombinant HSV-1 vector, wherein the recombinant HSV-1 vector is a vector lacking nucleotides at positions 117014-132565 and nucleotides at positions 145316-145585 in the HSV-1 genome.

[0007] The present invention also provides the use of the above-mentioned recombinant HSV-1 vector in the preparation of oncolytic virus or viral vector vaccine.

[0008] The present invention also provides an oncolytic HSV-1, wherein a tandem human IL-12 gene expression frame and a human IL-15 gene expression frame are inserted into the above-mentioned recombinant HSV-1 vector, and the insertion is inserted into the nucleotide deletion region at positions 117014-132565 in the HSV-1 genome.

[0009] Preferably, the nucleotide sequence of the tandem human IL-12 gene expression cassette and human IL-15 gene expression cassette is as shown in SEQ ID NO.1.

[0010] The present invention also provides an oncolytic HSV-1, wherein the PD-L1-scFv encoding gene expression frame is inserted into the above-mentioned oncolytic HSV-1, and the insertion is inserted into the nucleotide deletion region at positions 145316-145585 in the HSV-1 genome.

[0011] Preferably, the nucleotide sequence of the PD-L1-scFv encoding gene expression frame is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0012] The present invention also provides the use of the above-mentioned recombinant HSV-1 vector, the above-mentioned oncolytic HSV-1 or the above-mentioned oncolytic HSV-1 in the preparation of tumor treatment products.

[0013] Preferably, the tumor includes glioma, melanoma, colorectal cancer, breast cancer, cervical cancer, liver cancer or lung cancer.

[0014] Preferably, the product comprises a medicine.

[0015] The present invention also provides a drug for treating tumors, which includes the above-mentioned oncolytic HSV-1 or the above-mentioned oncolytic HSV-1.

[0016] Beneficial effects of the present invention:

[0017] The recombinant HSV-1 vector provided by the present invention can accommodate about 30kb of exogenous DNA fragments; the replication level of the vector and the oncolytic virus carrying multiple therapeutic genes is close to that of wild-type HSV-1, and it is easy to prepare in large quantities. In addition, the recombinant HSV-1 vector provided by the present invention has high safety, can replicate in mammalian cells and can carry multiple exogenous genes, has the advantages of a wide host range, high infection efficiency, large capacity, easy preparation, and sustainable expression of the exogenous genes carried, and can be applied to tumor treatment, gene therapy and viral vector vaccine fields.

[0018] The oncolytic HSV-1 provided by the present invention has high safety, retains the ability to replicate in mammalian cells, has a significant oncolytic effect, and can induce the body to produce a tumor immune response and thus exert a tumor-suppressing effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1The results of enzyme digestion identification of the recombinant shuttle plasmid pKO5-A, where 1 is DNA Marker; 2 is pKO5 digested with XbaI and SalI; 3 is pKO5 digested with SalI; 4 is pKO5 digested with XbaI; 5 is pKO5 digested with XhoI; 6 is pKO5 digested with BamH I; 7 is pKO5-A digested with XbaI and SalI; 8 is pKO5-A digested with SalI; 9 is pKO5-A digested with XbaI; 10 is pKO5-A digested with XhoI; 11 is pKO5-A digested with BamH I;

[0020] Figure 2 This is the sequencing result of the recombination arm of the recombinant shuttle plasmid pKO5-A;

[0021] Figure 3 The results of nucleic acid hybridization identification of recombinant HSV-BAC-A and recombinant HSV RG2001, where 1 is HSV-1 wild type; 2 is blank control; 3 and 4 are both HSV-BAC-A; 5 and 6 are both RG2001;

[0022] Figure 4 This is the sequencing result of the recombination arm of the recombinant shuttle plasmid pKO5-B;

[0023] Figure 5 The results of PCR identification of recombinant HSV-BAC-B and recombinant RG2002, where 1 is DNA Marker; 2 is wild type HSV-1; 3 and 4 are RG2002;

[0024] Figure 6 A schematic diagram of the tandem expression cassettes of human IL-15 and IL-12 genes;

[0025] Figure 7 The results of PCR identification of the recombinant shuttle plasmid pKO5-A / IL-15-IL-12, where 1 is IL15; 2 is IL12; 3 is the tandem fragment of IL15 and IL12; 4 is the SacB gene; 5 is DNA Marker;

[0026] Figure 8 The results of PCR identification of recombinant HSV-BAC-B / IL-15-IL-12, where 1 is DNA Marker; 2 is IL15; 3 is IL12; 4 is the tandem fragment of IL15 and IL12; 5 is HSV-1UL6; 6 is HSV-1UL40;

[0027] Fig. 9 ELISA was used to detect the expression of IL-15 in cells infected with recombinant RG2005;

[0028] Fig.10ELISA was used to detect the expression of IL-12 in cells infected with recombinant RG2005;

[0029] Fig.11 Flow cytometry was used to detect the activation effect of RG2005-infected cell supernatant on NK92 cells, where the left picture is the uninfected group; the middle picture is the HSV-1 wild type (HSV-1WT) infected group; the right picture is the RG2005 infected group;

[0030] Fig.12 The results of ELISA detection of the binding ability of PD-L1 scFv and PD-L1, among which B2016 is a conventional PD-L1 antibody and serves as the positive control group;

[0031] Fig.13 The affinity result of PD-L1 scFv and PD-L1 detected by surface plasmon resonance technology, where a is PD-L1-scFv HL Results; b is PD-L1-scFv LH Results; c is the result of B2016 (PD-L1 conventional antibody, positive control);

[0032] Fig.14 The results of PD-L1 scFv blocking activity test, where B2016 is a conventional PD-L1 antibody and serves as a positive control; the Buffer group is a negative control without antibody.

[0033] Fig.15 Identification of pKO5-B / PD-L1-scFv for enzyme digestion LH Results: M is DNA Marker; 1 is EcoRⅤ and SalⅠ digested pKO5-B / PD-L1-scFv LH ;

[0034] Fig.16 PCR identification of recombinant HSV-BAC-B / IL-15-IL-12 / PD-L1-scFv LH Results, where M is DNAMarker; 1 is PD-L1-scFv LH Encoding gene expression cassette;

[0035] Fig.17 The expression results of PD-L1 scFvLH in RG2006-infected cells were detected by Western blotting, where M is a protein marker; 1 and 2 are both RG2006-infected cells;

[0036] Fig.18 is the proliferation curve of recombinant HSV in infected Vero cells;

[0037] Fig.19It is the highest titer achieved when recombinant HSV infects Vero cells;

[0038] Fig. 20 The inhibitory effect of recombinant oncolytic HSV-1 on the proliferation of mouse glioma cells GL261 and mouse colon cancer cells CT26 cultured in vitro;

[0039] Fig.21 The results show the inhibitory effect of recombinant oncolytic HSV-1 on subcutaneous transplanted tumors established by mouse glioma cells GL261, where a is the volume of subcutaneous transplanted tumors on the side injected with oncolytic HSV-1 (right side); b is the volume of subcutaneous transplanted tumors on the side not injected with oncolytic HSV-1 (left side);

[0040] Fig. 22 Schematic diagram of shuttle plasmid pKO5;

[0041] Fig.23 The results show the inhibitory effect of recombinant oncolytic HSV-1 on subcutaneous transplanted tumors established by mouse melanoma cells B16F10, where a is the volume of subcutaneous transplanted tumors on the side injected with oncolytic HSV-1 (right side); b is the volume of subcutaneous transplanted tumors on the side not injected with oncolytic HSV-1 (left side);

[0042] Fig.24 The results show the inhibitory effect of recombinant oncolytic HSV-1 on subcutaneous transplanted tumors established by mouse colon cancer cells CT26, where a is the volume of subcutaneous transplanted tumors on the side injected with oncolytic HSV-1 (right side); b is the volume of subcutaneous transplanted tumors on the side not injected with oncolytic HSV-1 (left side). DETAILED DESCRIPTION

[0043] The present invention provides a recombinant HSV-1 vector, wherein the recombinant HSV-1 vector is a vector lacking nucleotides at positions 117014-132565 and nucleotides at positions 145316-145585 in the HSV-1 genome.

[0044] In the present invention, the accession number of the HSV-1 genome is NC_001806.2. In the present invention, the method for deleting the nucleotides 117014-132565 and the nucleotide fragments 145316-145585 in the HSV-1 genome when constructing a recombinant HSV-1 vector is to utilize the HSV-1 bacterial artificial chromosome (HSV-BAC) technology, according to the experimental method in the paper Horsburgh Bc, Hubinette MM, tufaro F. genetic manipulation of herpes simplex virus using bacterial artificial chromosomes. Methods Enzymol published by Brian c Horsburgh et al.

[0045] The present invention also provides the use of the above-mentioned recombinant HSV-1 vector in the preparation of oncolytic virus or viral vector vaccine.

[0046] The present invention also provides an oncolytic HSV-1, wherein a tandem human IL-12 gene expression frame and a human IL-15 gene expression frame are inserted into the above-mentioned recombinant HSV-1 vector, and the insertion is inserted into the nucleotide deletion region at positions 117014-132565 in the HSV-1 genome.

[0047] In the present invention, the nucleotide sequence of the tandem human IL-12 gene expression cassette and human IL-15 gene expression cassette is preferably as shown in SEQ ID NO.1.

[0048] The present invention also provides an oncolytic HSV-1, wherein the PD-L1-scFv encoding gene expression frame is inserted into the above-mentioned oncolytic HSV-1, and the insertion is inserted into the nucleotide deletion region at positions 145316-145585 in the HSV-1 genome.

[0049] In the present invention, the PD-L1-scFv encoding gene expression frame is preferably composed of a peptide chain (Linker) with the two ends of the linker connecting the PD-L1 antibody heavy chain variable region (VH) and the light chain variable region (VL), wherein the PD-L1-scFv HL VH is at the amino terminus, VL is at the carboxyl terminus, and the nucleotide sequence is shown in SEQ ID NO.2. PD-L1-scFv LH VL is at the amino terminus and VH is at the carboxyl terminus, and the nucleotide sequence is shown in SEQ ID NO.3.

[0050] In the present invention, the method for inserting foreign genes into the recombinant HSV-1 vector is preferably the HSV-1 bacterial artificial chromosome (HSV-BAC) method.

[0051] The present invention also provides the use of the above-mentioned recombinant HSV-1 vector, the above-mentioned oncolytic HSV-1 or the above-mentioned oncolytic HSV-1 in the preparation of tumor treatment products.

[0052] In the present invention, the tumor preferably includes glioma, melanoma, colorectal cancer, breast cancer, cervical cancer, liver cancer or lung cancer; the product preferably includes a drug.

[0053] The present invention also provides a drug for treating tumors, the drug comprising the above-mentioned oncolytic HSV-1 or the above-mentioned oncolytic HSV-1. When using the drug of the present invention, it is preferably administered by injection, and other therapies may be received during, before or after the use of the drug of the present invention, and the other therapies include chemotherapy, radiotherapy, immunotherapy or surgical intervention.

[0054] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0055] In the following embodiments, unless otherwise specified, all of them are conventional methods.

[0056] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0057] In the following examples, the methods for genetic engineering to obtain recombinant HSV-1 and oncolytic HSV-1 using HSV-BAC technology were performed in accordance with the methods in the publicly published paper by Brian c Horsburgh et al., Horsburgh BC, Hubinette MM, tufaroF. Genetic manipulation of herpes simplex virus using bacterial artificial chromosomes. Methods Enzymol. Molecular biology and other methods were performed in accordance with the Molecular Cloning Experimental Technical Guide (written by J. Sambrook and DW Russell, translated by Huang Peitang et al., Science Press, third edition 2002) or the operating instructions provided by the experimental reagent manufacturers.

[0058] Example 1

[0059] A recombinant HSV-1 vector, wherein the recombinant HSV-1 vector is a vector lacking nucleotides 117014-132565 and nucleotides 145316-145585 in the HSV-1 genome, and the specific preparation method is as follows:

[0060] 1.1 Delete nucleotides 117014-132565 of the HSV-1 genome

[0061] (1) Construction of shuttle plasmid: DNA synthesis was performed to obtain the nucleotide fragments 114989-117013 (AL fragment) and 132566-135423 (AR fragment) of the HSV-1 genome (NC_001806.2). The two DNA fragments were used as recombination arms and cloned in series into the plasmid pKO5 (see Fig. 22 ) was cloned into the BamH I cloning site of the 100-well cloned plasmid. The obtained recombinant shuttle plasmid was digested with Xba I and Sal I to produce a DNA fragment of the expected size (see Figure 1 ), verified by DNA sequencing (see Figure 2 ), indicating that the two DNA fragments as recombination arms have been cloned in series into plasmid pKO5, and the recombinant shuttle plasmid was named pKO5-A.

[0062] (2) Obtaining recombinant herpes simplex virus bacterial artificial chromosome (HSV-BAC) by homologous recombination: pKO5-A was used to transform Escherichia coli containing wild-type HSV-BAC (the Escherichia coli containing wild-type HSV-BAC was obtained by transforming HSV-BAC containing wild-type HSV-1 genome into Escherichia coli and then screening it. The specific method was based on the literature Horsburgh Bc, Hubinette MM, tufaro F. Genetic manipulation of herpes simplex virus using bacterial artificial chromosomes. Methods Enzymol). The obtained recombinant HSV-BAC detected a specific DNA band of about 2.1 kb by nucleic acid hybridization (see Figure 3 ), which was consistent with expectations, indicating that nucleotides 117014-132565 of the recombinant HSV-BAC had been deleted, and the recombinant HSV-BAC was named HSV-BAC-A.

[0063] (3) Isolation, purification and identification of recombinant virus: The specific methods of isolation, purification and identification after HSV-BAC-A transfected Vero cells are as follows: ① Recombinant DNA transfection cells: Vero cells were cultured according to conventional methods until the cell density reached 70% to 80%, and recombinant HSV-BAC (three gradients of 2μg, 4μg and 8μg) was transfected into the cells by liposome-mediated method. Pathological changes of transfected cells were observed after 2 days, and plaques appeared in the cells after 4 days (cell status and transfection reagents, etc. will affect the transfection effect and cause the appearance of plaques to be delayed). ②Pick out plaques to purify recombinant HSV: After the recombinant HSV-BAC infected cells form plaques, perform the first round of plaque purification, discard the cell culture medium, fix the cells with a mixed solution of 2% low melting point agarose and serum-free 2×199V medium (199 medium + 1% penicillin-streptomycin solution (double antibody) + 5% fetal bovine serum + 7.5% NaHCO3) in equal volumes, pick out cells in the plaque area by conventional methods and add 200 μL skim milk powder solution (9% skim milk powder solution sterilized by conventional high pressure mass volume concentration) and 2×199V in equal volumes, and ultrasonically lyse the cells in an ice water bath to release the virus. The time and interval frequency of ultrasonic lysing the cells should be kept in a principle to avoid excessive temperature of the cell lysate. The cell lysate is stored at -80°C as a virus stock solution for standby use. The above virus stock solution is used to infect Vero cells for the second round of plaque purification, and the recombinant HSV obtained after the third round of plaque purification is subjected to molecular identification. ③ Identification of recombinant HSV: The purified recombinant HSV was infected with Vero cells to amplify the virus. 2 Taking the infection of a full-bottle cell culture bottle as an example, the cells were collected by centrifugation at 4°C and 3000rpm into a 5mL centrifuge tube, and the cells were rinsed twice with 4mL pre-cooled PBS, and the cells were collected at 4°C and 3000rpm, and the cells were resuspended with 0.5mL lyse-o-lot (150mMNaCl, 10mM tris, 1.5mM MgCl), and 5μL 10% NP40, 10μL 10% SDS, 5μL 0.5M EDTA and 1.8μL β-ME were added, and the mixture was fully mixed. The phenol-chloroform extraction was performed twice by conventional methods, and the supernatant was taken. Two volumes of anhydrous ethanol and 1 / 10 volume of sodium acetate were added, and the mixture was placed at -80°C for 2h or -20°C overnight; the viral DNA was collected at 4°C and 12000rpm, and the recombinant HSV was molecularly identified; or the infected cell protein was extracted and purified by conventional methods to detect the expression of the target gene. The recombinant HSV detected a specific DNA band of about 2.1kb by nucleic acid hybridization (see Figure 3 ), indicating that nucleotides 117014-132565 of the recombinant HSV genome had been deleted, and the recombinant HSV was named RG2001.

[0064] 1.2 Delete nucleotides 145316-145585 of the HSV-1 genome

[0065] Based on the RG2001 obtained in 1.1, a recombinant viral vector with nucleotides 145316-145585 deleted was further constructed. The steps for preparing the vector are as follows:

[0066] (1) Construction of shuttle plasmid: DNA synthesis was used to obtain the nucleotide fragments 143683-145315 (BL fragment) and 145586-147085 (BR fragment) of the HSV-1 genome. The two DNA fragments were cloned in series into the BamHI multiple cloning site of plasmid pKO5 with BL in front and BR in the back as recombination arms. The obtained recombinant shuttle plasmid was verified to be correct by DNA sequencing ( Figure 4 ), indicating that the two DNA fragments as recombination arms have been cloned in series into plasmid pKO5, and the recombinant shuttle plasmid was named pKO5-B.

[0067] (2) Obtaining recombinant HSV-BAC by homologous recombination: pKO5-B was used to transform E. coli containing HSV-BAC-A (the E. coli was obtained in the above "1.1 Deletion of nucleotides 117014-132565 of the HSV-1 genome" and was obtained by transforming E. coli containing wild-type HSV-BAC with pKO5-A and then screening. The specific method was based on the literature Horsburgh Bc, Hubinette MM, tufaro F. genetic manipulation of herpes simplex virus using bacterial artificial chromosomes. Methods Enzymol). The obtained recombinant HSV-BAC was identified by PCR for the deletion region DNA fragment (primers P145044: tgtccgcaccgactcgtagta (SEQ ID NO.4) and P145632: gaccggcggc gaccgttgcg (SEQ ID NO.5)), generating a DNA fragment of about 300 bp ( Figure 5 ), which was consistent with the expectation, indicating that the nucleotide gene at positions 145316-145585 of HSV-1 in the recombinant HSV-BAC had been deleted, and the recombinant DNA was named HSV-BAC-B.

[0068] (3) Isolation, purification and identification of recombinant virus: HSV-BAC-B was transfected into Vero cells and then subjected to three rounds of plaque purification (the specific method is the same as step (3) in 1.1) to obtain recombinant HSV. The genome of the recombinant HSV was identified by PCR to identify the DNA fragment of the deletion region (primers P145044 and P145632), generating a DNA fragment of about 300 bp ( Figure 5), which was consistent with expectations, indicating that the recombinant HSV had deleted the nucleotide gene at positions 145316-145585 of HSV-1 based on RG2001. The recombinant HSV was named RG2002.

[0069] Example 2

[0070] An oncolytic HSV-1, wherein a tandem human IL-12 gene expression frame and a human IL-15 gene expression frame are inserted into the recombinant HSV-1 vector (RG2002) obtained in Example 1, wherein the insertion is inserted into the nucleotide deletion region at positions 117014-132565 in the HSV-1 genome. The specific preparation method is as follows:

[0071] (1) Construction of shuttle plasmid: The human IL-12 gene expression cassette and the human IL-15 gene expression cassette (SEQ ID NO.1) were tandemly inserted into the shuttle plasmid. Figure 6 ) was inserted between the two recombinant arms of the shuttle plasmid pKO5-A obtained in step (1) of 1.1 in Example 1 by seamless cloning technology. The obtained recombinant plasmids were identified by PCR for IL-15 gene (primers IL-15L1: atgagaatttcgaaaccacatttgag (SEQ ID NO.6) and IL-15R1: tcaagaagtgttgatgaacatttggac (SEQ ID NO.7), IL-12 gene (primers IL-12L1: atgtgtcaccagcagttgg (SEQ ID NO.8) and IL-12R1: ctaactgcagggcacagatg (SEQ ID NO.9)), and the tandem DNA fragments of IL-15 gene and IL-12 gene (primers IL-15-12L1: catatgccaagtacgcccc (SEQ ID NO.10) and IL-15-12R1: tactgcagccaggtgga (SEQ ID NO.11)). NO.11)) and recombinant HSV-BAC screening gene SacB (primers SacBL1: aaatatctcttctgcaaaaggc (SEQ ID NO.12) and SacBR1: gtaatcacgacattgtttcctt (SEQ ID NO.13)), all produced DNA fragments consistent with the expected size ( Figure 7 ), indicating that the human IL-12 gene expression cassette and the human IL-15 gene expression cassette had been cloned into pKO5-A, and the recombinant shuttle plasmid was named pKO5-A / IL-15-IL-12.

[0072] (2) Obtaining recombinant HSV-BAC by homologous recombination: pKO5-A / IL-15-IL-12 was used to transform E. coli containing HSV-BAC-B obtained in step (2) of 1.2 of Example 1 (the E. coli was obtained by transforming E. coli containing HSV-BAC-A with pKO5-B and then screening. The specific method was based on the literature Horsburgh Bc, Hubinette MM, tufaro F. Genetic manipulation of herpes simplex virus using bacterial artificial chromosomes.MethodsEnzymol), the obtained recombinant HSV-BAC was used to identify the IL-15 gene (primers IL-15L1 and IL-15R1), IL-12 gene (primers IL-12L1 and IL-12R1), the tandem DNA fragments of IL-15 gene and IL-12 gene (primers IL-15-12L1 and IL-15-12R1), and the UL6 gene of HSV (primers UL6L1: ccgaatgctcctacaacaag (SEQ ID NO.14) and UL6R1: gtctt ccggggcgagttctg (SEQ ID NO.15)) and UL40 (primers UL40L1: accgcttcctcttcgctttc (SEQ ID NO.16) and UL40R1: cccgcagaaggttgttggtg (SEQ ID NO.17)), all of which produced DNA fragments consistent with the expected size ( Figure 8 ), indicating that the human IL-12 gene expression cassette and the human IL-15 gene expression cassette had been recombined into HSV-BAC, and the recombinant HSV-BAC was named HSV-BAC-B / IL-15-IL-12.

[0073] (3) Isolation, purification and identification of recombinant virus: HSV-BAC-B / IL-15-IL-12 was transfected into Vero cells and then subjected to three rounds of plaque purification (the specific method is the same as step (3) of 1.1 in Example 1) to obtain recombinant HSV. The expression of human IL-15 in Vero cells infected with the recombinant HSV was detected by ELISA ( Fig. 9 ) and expression of human IL-12 ( Fig.10 ), while the control group HSV-1 wild type (HSV-1 / WT) had almost no expression of IL-15 and IL-12, and the supernatant of Vero cells infected with the recombinant oncolytic HSV-1 could effectively activate NK92 cells ( Fig.11), indicating that the oncolytic HSV-1 expressed immunologically active human IL-12 and human IL-15 after infecting mammalian cells, and the recombinant oncolytic HSV-1 was named RG2005.

[0074] Example 3

[0075] An oncolytic HSV-1, wherein the PD-L1-scFv encoding gene expression frame is inserted into the oncolytic HSV-1 (RG2005) obtained in Example 2, wherein the insertion is inserted into the nucleotide deletion region at positions 145316-145585 in the HSV-1 genome, and the specific preparation method is as follows:

[0076] The present invention designs and synthesizes the coding gene sequences of two PD-L1 single-chain antibodies (ScFv) and expresses and purifies them in Chinese hamster ovary cells (CHO) cultured in vitro. The two PD-L1 ScFvs are composed of a peptide chain (Linker) connecting the heavy chain variable region (VH) and the light chain variable region (VL) of the PD-L1 antibody at both ends. HL VH is at the amino terminus, VL is at the carboxyl terminus, PD-L1-scFv LH In the sequence, VL is at the amino terminus and VH is at the carboxyl terminus. Indirect ELISA and surface plasmon resonance (SPR) analysis showed that both PD-L1 ScFvs have specific binding activity to PD-L1 ( Fig.12 ) and immunoaffinity activity ( Fig.13 ), both are high-affinity antibodies, and PD-L1-scFv LH The binding ability and immunoaffinity are stronger than PD-L1-scFv HL Both PD-L1 ScFvs can effectively block the binding of PD-L1 to PD-1 ( Fig.14 ). Therefore, PD-L1-scFv was used in the subsequent LH The following oncolytic HSV-1 construction was performed:

[0077] (1) Shuttle plasmid construction: PD-L1-scFv LH The DNA fragment encoding the gene expression cassette (SEQ ID NO.3) was inserted between the two recombinant arms of pKO5-B by seamless cloning. The obtained recombinant plasmid was digested by EcoRⅤ and SalⅠ to produce DNA fragments of 7kb, 1.5kb, 1.2kb and 0.7kb, which were consistent with the expected ( Fig.15 ), indicating that PD-L1-scFv LH The coding gene expression cassette has been cloned into pKO5-B, and the recombinant shuttle plasmid is named pKO5-B / PD-L1-scFv LH .

[0078] (2) Homologous recombination to obtain recombinant HSV-BAC: pKO5-B / PD-L1-scFv LH The E. coli containing HSV-BAC-B / IL-15-IL-12 obtained in step (2) of Example 2 was transformed (the E. coli was obtained by transforming E. coli containing HSV-BAC-B with pKO5-A / IL-15-IL-12 and then screened. The specific method is based on the literature Horsburgh Bc, Hubinette MM, tufaro F. Genetic manipulation of herpes simplex viruses using bacterial artificial chromosomes. Methods Enzymol). The obtained recombinant HSV-BAC was used to identify PD-L1-scFv by PCR LH The coding gene expression cassette (primers PDL1-scFV-L: gtcgacaagcttgatatcgcgttgacattgattattgact (SEQ ID NO.18) and PDL1-scFV-R: ctgcaggaattcgatatcatgaacaaacgacccaacac (SEQ ID NO.19)) produced a DNA fragment of about 2.3 kb, which was consistent with the expected (see Fig.16 ), indicating that PD-L1-scFv LH The coding gene expression cassette has been recombined into HSV-BAC-B / IL-15-IL-12, and the recombinant DNA is named HSV-BAC-B / IL-15-IL-12 / PD-L1-scFv LH .

[0079] (3) Isolation, purification and identification of recombinant virus: HSV-BAC-B / IL-15-IL-12 / PD-L1-scFv LH After transfection into Vero cells, recombinant HSV was obtained by three rounds of plaque purification (the specific method is the same as step (3) in 1.1 of Example 1). Vero cells infected with the recombinant HSV were detected by immunoblotting to detect PD-L1-scFv LH The expression ( Fig.17 ), indicating that the oncolytic HSV-1 expressed PD-L1-scFv after infecting mammalian cells LH The recombinant oncolytic HSV-1 was named RG2006.

[0080] Example 4

[0081] Analysis of the replication level of recombinant HSV-1 in mammalian cells

[0082] The recombinant HSV-1 vectors (RG2001 and RG2002) prepared in Example 1 of the present invention, the recombinant oncolytic HSV-1 (RG2005) prepared in Example 2, and the recombinant oncolytic HSV-1 (RG2006) prepared in Example 3 (collectively referred to as recombinant HSV in this experiment) were used to infect mammalian cells and analyze their replication levels. The experimental steps are as follows:

[0083] (1) Wild-type HSV-1 / wt (denoted as HSV-WT) and recombinant HSV were used to infect Vero cells at an MOI of 0.5, and the infected cells were collected at 0 h, 8 h, 16 h, 24 h, 32 h, 40 h, and 48 h after infection. The cells were subjected to three cycles of freeze-thaw and ultrasonic lysis to prepare the virus stock solution, which was stored in a -80°C refrigerator.

[0084] (2) The virus stock solution was diluted in a gradient manner according to conventional virology methods and infected with Vero cells. The virus titer in the virus stock solution collected at each time point was detected and the recombinant HSV proliferation curve was drawn (see Fig.18 ), and at the same time determine the highest titer that the recombinant HSV can achieve ( Fig.19 The results showed that there was no significant difference in the replication levels of the four recombinant HSVs RG2001, RG2002, RG2005, and RG2006 and wild-type HSV-1, indicating that the four recombinant HSVs prepared by the present invention can replicate efficiently in mammalian cells.

[0085] Example 5

[0086] Inhibitory effect on tumor cells cultured in vitro

[0087] Two oncolytic HSV-1s, RG2005 prepared in Example 2 of the present invention and RG2006 prepared in Example 3, were used to infect tumor cells cultured in vitro (mouse glioma cells GL261 and mouse colon cancer cells CT26 were used in this example) and their inhibitory effects on tumor cells were analyzed. The experimental steps are as follows:

[0088] (1) Tumor cells were inoculated at 5,000 cells / well in a 96-well cell culture plate and cultured using conventional methods.

[0089] (2) After 12 hours of cell culture, the tumor cells were infected with oncolytic HSV-1 at MOIs of 0.05, 0.1, and 0.5, respectively. A blank control group not infected with the virus, an HSV-1 / wt (wild type, HSV-WT) infection group, and a recombinant HSV empty vector RG2002 (prepared in Example 1) infection group were set up.

[0090] (3) The inhibitory effect of oncolytic HSV-1 on tumor cell proliferation was determined by CCK8 assay at 48 h after virus infection (see Fig. 20The results showed that oncolytic HSV-1, viral vector RG2002 and HSV-1 / wt infection significantly inhibited the proliferation of tumor cells ( Fig. 20 ). Since the functions of the three inserted therapeutic genes IL-12, IL-15 and PD-L1-scFv can only be exerted when the body's immune system is involved, in vitro cells, the two oncolytic HSV-1 and viral vectors RG2002 and HSV-1 / wt all exert tumor-suppressing effects by lysing cells, and there is no significant difference in the inhibitory effect on the proliferation of infected cells.

[0091] Example 6

[0092] Inhibitory effect on subcutaneous transplanted tumors in mice

[0093] Two oncolytic HSV-1, RG2005 prepared in Example 2 and RG2006 prepared in Example 3, were used to treat mouse tumor models (this example used a mouse bilateral abdominal subcutaneous glioma model, a mouse bilateral abdominal subcutaneous melanoma model, and a mouse bilateral abdominal subcutaneous colon cancer model) by intratumoral injection and their inhibitory effects on tumors in mice were analyzed. The experimental steps are as follows:

[0094] (1) Establishment of mouse tumor model: Mouse glioma cells GL261, mouse melanoma cells B16F10, and mouse colon cancer cells CT26 were cultured in vitro until the confluence reached 80-90%, and the cell density was counted and adjusted to 2×10 7 / mL; 6-8 week old female BALB / c mice were used for modeling, and the mouse skin was wiped with alcohol cotton balls at 2×10 6 The cells were inoculated subcutaneously on both sides of the abdomen of the mice, and the mice were raised normally. The tumor formation of the mice was observed. When the volume of the tumor on both sides of the mice reached 100mm 3 When treating tumors.

[0095] (2) Intratumoral injection for treatment of subcutaneous transplanted tumors in mice: The mice were randomly divided into the following groups: RG2005 group, RG2006 group, HSV-1 / wt group as control, RG2002 group (prepared in Example 1) group and MOCK group not infected with the virus. In addition to the above five groups, an RG2001 group (prepared in Example 1) was also added to the treatment experiment of bilateral abdominal subcutaneous colon cancer model in mice. The virus stock solution was diluted to 2×10 7 pfu / mL, 100 μL of diluted virus stock solution was directly injected into the subcutaneous transplanted tumor on one side (right side) of the mouse, and the injection was divided into three points. The needle was not withdrawn from the subcutaneous tissue between the injection points. A total of three injections were made, with one day between each injection. After the third intratumoral injection treatment, the volume of the transplanted tumors on both sides of the abdomen of the mouse was measured, and it was measured every 3 days. The tumor volume was expressed as V = L × (W) 2 / 2 calculation.

[0096] (3) The experimental treatment results are as follows Fig.21 , Fig.23 , Fig.24 As shown, the above two oncolytic HSV-1 as well as HSV-1 / wt and recombinant HSV empty vector RG2002 and RG2001 treatments significantly inhibited the growth of tumors in treated mice (see Fig.21 a), indicating that both oncolytic HSV-1 and viral vectors exerted direct oncolytic effects; the experimental results also showed that the above two oncolytic HSV-1 (RG2005 and RG2006) were better than HSV-1 / wt, RG2001 and RG2002 vectors in inhibiting mouse tumor growth (see Fig.21 , Fig.23 , Fig.24 a, b), and the growth of subcutaneous transplanted tumors in the oncolytic HSV-1 group without injection treatment (left side) was also inhibited ( Fig.21 , Fig.23 , Fig.24 b) in the figure indicates that the three therapeutic genes IL-12, IL-15 and PD-L1-scFv expressed by oncolytic HSV-1 play an anti-tumor effect by inducing the body to produce tumor immune response.

[0097] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A recombinant HSV-1 vector, characterized in that: The recombinant HSV-1 vector is a vector lacking nucleotides 117014-132565 and nucleotides 145316-145585 in the HSV-1 genome.

2. Use of the recombinant HSV-1 vector according to claim 1 in the preparation of oncolytic virus or viral vector vaccine.

3. An oncolytic HSV-1, characterized in that The tandem human IL-12 gene expression frame and the human IL-15 gene expression frame are inserted into the recombinant HSV-1 vector according to claim 1, wherein the insertion is into the nucleotide deletion region at positions 117014-132565 in the HSV-1 genome.

4. The oncolytic HSV-1 according to claim 3, characterized in that The nucleotide sequence of the tandem human IL-12 gene expression frame and the human IL-15 gene expression frame is shown in SEQ ID NO.

1.

5. An oncolytic HSV-1, characterized in that The PD-L1-scFv encoding gene expression frame is inserted into the oncolytic HSV-1 described in claim 3, and the insertion is inserted into the nucleotide deletion region at positions 145316-145585 in the HSV-1 genome.

6. The oncolytic HSV-1 according to claim 5, characterized in that The nucleotide sequence of the PD-L1-scFv encoding gene expression frame is shown as SEQ ID NO.2 or SEQ ID NO.

3.

7. Use of the recombinant HSV-1 vector according to claim 1, the oncolytic HSV-1 according to any one of claims 3 to 4, or the oncolytic HSV-1 according to any one of claims 5 to 6 in the preparation of tumor treatment products.

8. The use according to claim 7, characterized in that: The tumor includes glioma, melanoma, colorectal cancer, breast cancer, cervical cancer, liver cancer or lung cancer.

9. The use according to claim 7, characterized in that: The products include pharmaceuticals.

10. A drug for treating tumors, characterized in that: The drug comprises the oncolytic HSV-1 described in any one of claims 3 to 4 or the oncolytic HSV-1 described in any one of claims 5 to 6.

Images