Construction method of 6030442E23Rik conditional gene knockout mouse model

Abstract

The invention discloses a construction method of a 6030442E23Rik conditional gene knockout mouse model, belongs to the technical field of gene engineering, and is characterized in that flox modification is carried out on a 6030442E23Rik gene by using a homologous recombination principle and adopting a fertilized egg homologous recombination mode. The brief process is as follows: Cas9mRNA and gRNA are obtained in an in-vitro transcription mode; a homologous recombinant vector (donor vector) is constructed by an In-Fusion cloning method, the vector comprises a 2.9 kb 5'homologous arm, a 2.2 kb flox region and a 2.6 kb 3 'homologous arm, Cas9mRNA, gRNA and the donor vector are microinjected into a fertilized egg of a C57BL / 6J mouse to obtain an F0-generation mouse, and the F0-generation mouse which is positive in PCR (Polymerase Chain Reaction) amplification and sequencing identification is obtained.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a method for constructing a 6030442E23Rik conditional gene knockout mouse model. Background Art

[0002] The global aging society is one of the major public health challenges around the world. Aging is the most important cardiovascular risk factor. Vascular aging is a structural abnormality and functional disorder in the aging process of individuals, characterized by increased vascular cell senescence, vascular dysfunction, and vascular remodeling. Therefore, further understanding of the specific molecular mechanisms of aging-induced vascular dysfunction may provide new therapeutic options for delaying vascular aging and reducing the morbidity and mortality of age-related cardiovascular diseases.

[0003] Long noncoding RNA (lncRNA) is a type of noncoding RNA with a length greater than 200 nt, and is an important component of the noncoding genome. A large number of studies have shown that lncRNAs are involved in a variety of biological processes, including cell aging, DNA methylation, histone modification, RNA post-transcriptional regulation, and protein translation regulation, and affect the regulation of various physiological and pathological processes. They are important molecules for regulating genes in cells and even individuals.

[0004] In the early stage, we used aged and young aortic tissues, combined with lncRNAarray technology, to screen out the age-related lncRNA - 6030442E23Rik, and named it "Aging Associated Transcript" (AAT). In addition, we have verified in mouse aortic tissue that the expression of 6030442E23Rik will continue to increase with age, and after the 6030442E23Rik mutation, the vascular function of mice is improved, the energy metabolism is activated, and the activity capacity is enhanced.

[0005] In general, humans also have an AAT sequence that is homologous to that of mice, and targeting this sequence is expected to become a potential therapeutic strategy to delay vascular aging and improve vascular function. Summary of the invention

[0006] In view of the above problems, the present invention adopts the method of homologous recombination of fertilized eggs to perform flox modification on the 6030442E23Rik gene to obtain a mouse model that can conditionally knock out the 6030442E23Rik gene.

[0007] The purpose of the present invention is to provide a method for constructing a 6030442E23Rik conditional gene knockout mouse model, comprising the following steps:

[0008] Step 1: Design gRNA that recognizes the 6030442E23Rik gene, perform in vitro transcription, and obtain Cas9 mRNA and gRNA;

[0009] Step 2: construct homologous recombination vector;

[0010] Step 3: Microinject Cas9 mRNA, gRNA and homologous recombination vector into mouse fertilized eggs to obtain a mouse model with 6030442E23Rik gene knockout.

[0011] Furthermore, the primer sequences used to prepare gRNA in step 1 include gRNA1 and gRNA2, and the nucleotide sequences of gRNA1 and gRNA2 are as follows:

[0012] gRNA1: 5'-GCCAATAAGGTTTTATCAGCTGG-3';

[0013] gRNA2: 5'-GCTGGAGACCTTATTCTATTGGG-3'.

[0014] Furthermore, the homologous recombination vector in step 2 comprises a 2.9 kb 5' homology arm, a 2.2 kb flox region and a 2.6 kb 3' homology arm.

[0015] Furthermore, the target fragments of the 5' homology arm, the flox region and the 3' homology arm were ligated to the pBR-322 vector using the In-fusion cloning method.

[0016] Furthermore, in step 3, Cas9 mRNA, gRNA and homologous recombination vectors are microinjected into mouse fertilized eggs. The mice born on day 20 are F0 generation mice. PCR identification is performed on the F0 generation mice to obtain positive F0 generation mice, which are mouse models with 6030442E23Rik gene knockout.

[0017] Furthermore, the F0 generation mouse identification scheme is as follows:

[0018] The 5' arm homologous recombination positive genome should amplify a 5.4kb fragment, and the negative genome should amplify a 8.3kb fragment; the 3' arm homologous recombination positive genome should amplify a 5.7kb fragment, and the negative genome should amplify a 9.4kb fragment.

[0019] Furthermore, the PCR primer sequences for the 5' homology arm are as follows:

[0020] Forward-GGCATGGTAAAGGATTCACATCAAA;

[0021] Reverse-TACACTCTTGATGCTTGGGTTTTC.

[0022] Furthermore, the PCR primer sequences for the 3' homology arms are as follows:

[0023] Forward-TCCTGTGTTGACATAGTTCTTTGGA;

[0024] Reverse-TGTCATGTTTACCTCTCCAGACATT.

[0025] Furthermore, the mice are C57BL / 6J mice.

[0026] Compared with the prior art, the present invention has the following advantages:

[0027] The 6030442E23Rik gene conditional knockout mouse model constructed in this application has high repeatability, good controllability, is easy to breed, and is more stable and more in line with clinical characteristics, providing a better platform for the study of the pathogenesis of cardiovascular and cerebrovascular diseases related to vascular aging and the exploration of intervention measures. Using this model, the research on the pathogenesis of vascular aging, drug treatment and drug screening will be further in-depth and more scientific. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Schematic diagram of the strategy for constructing a mouse model, where 5'homology arm: 5'homology arm, 3'homology arm: 3'homology arm, Wildtype allele: wild-type allele, Targeting vector: targeting vector, Targeted allele: target allele, Knockout allele: knockout allele, Cre recombination: recombinase gene recombination, Exon1: exon 1, Exon2: exon 2, Coding region: coding region, Uncoding region: non-coding region;

[0029] Figure 2 is the homologous recombination plasmid map;

[0030] Figure 3 Electrophoresis diagram of homologous recombination vector digestion identification, 1: EcoR I digestion identification result, theoretical band sizes are 7594bp, 5614bp, 466bp; M: 1kb DNA ladder;

[0031] Figure 4Schematic diagram of the identification strategy for F0 generation mice, where homology arm: homology arm, Wildtype allele: wild-type allele, Targeted allele: target allele, Exon1: exon 1, Exon2: exon 2, Coding region: coding region, Uncoding region: non-coding region, Primer location: primer location, PCR product: PCR product, PCR sequenced region: PCR sequencing region;

[0032] Figure 5 This is the electrophoresis diagram of PCR identification of homologous recombination-positive F0 generation mice. Numbers: F0 generation mouse number; M is 1kb DNA marker;

[0033] Figure 6 This is the electrophoresis diagram for PCR identification of the 5' homology arm and 3' homology arm of F1 generation mice; A-5' homology arm; B-3' homology arm; Numbers: F1 generation mouse number; M: 1kb DNA ladder;

[0034] Figure 7 This is a schematic diagram of sequencing verification of PCR products of F1 generation mice;

[0035] Figure 8 Schematic diagram of F1 generation positive mice;

[0036] Fig. 9 This is a schematic diagram of the subsequent mouse breeding process, Heterozygous flox mouse: Heterozygous flox mouse,

[0037] Cre mouse: Cre recombinase mouse, Homozygous flox mouse: homozygous flox mouse, Heterozygous flox mouse and Cre positive: heterozygous flox / Cre positive mouse, Homozygous flox mouse and Cre positive: homozygous flox / Cre positive mouse;

[0038] Fig.10 Schematic diagram of the positions of primers for PCR identification of flox mice;

[0039] Fig.11 This is the electrophoresis diagram for restriction digestion identification of flox mouse genotype;

[0040] Fig.12It is the alignment result of the 1# sequencing reaction of the 5' homology arm of the F1 generation mouse; Query is the target sequence (E23Rikrecombined genomic DNA sequence), Subject is the sequencing result, and the red underline is the 5arm homology arm sequence;

[0041] Fig.13 It is the alignment result of 5' homology arm 2# sequencing reaction of F1 generation mice; Query is the target sequence (E23Rikrecombined genomic DNA sequence), Subject is the sequencing result, the red box base is the Loxp sequence, and the red underline is the 5arm homology arm sequence;

[0042] Fig.14 It is the alignment result of 1# sequencing reaction of 3' homology arm of F1 generation mouse; Query is the target sequence (E23Rikrecombined genomic DNA sequence), Subject is the sequencing result, the red box base is the Loxp sequence, and the red underline is the 3arm homology arm sequence;

[0043] Fig.15 It is the alignment result of 2# sequencing reaction of 3' homology arm of F1 generation mouse; Query is the target sequence (E23Rikrecombined genomic DNA sequence), Subject is the sequencing result, and the red underline is the 3arm homology arm sequence. DETAILED DESCRIPTION

[0044] The present invention is further described below with reference to specific examples.

[0045] The present application provides a method for constructing a 6030442E23Rik conditional gene knockout mouse model, such as Figure 1 As shown, the 6030442E23Rik gene was floxed by homologous recombination of fertilized eggs using the principle of homologous recombination. The brief process is as follows: Cas9 mRNA and gRNA were obtained by in vitro transcription; a homologous recombination vector (donor vector) was constructed by In-Fusion cloning, which contained a 2.9kb 5' homology arm, a 2.2kb flox region, and a 2.6kb 3' homology arm. Cas9 mRNA, gRNA, and donor vector were microinjected into fertilized eggs of C57BL / 6J mice to obtain F0 generation mice, and positive F0 generation mice were identified by PCR amplification and sequencing.

[0046] The target gene name (Ensembl number): 6030442E23Rik

[0047] (ENSMUSG00000100664)

[0048] Ensembl website link of target gene:

[0049] http: / / asia.ensembl.org / Mus_musculus / Gene / Summary?db=core;g=ENSMUSG00000100664;r=7:70866797-70874157;t=ENSMUST00000186618

[0050] Transcript targeted by the protocol (Ensembl number): 6030442E23Rik-201

[0051] (ENSMUST00000186618.2)

[0052] Exon targeted by Flox: exon 1

[0053] 1. Design of Guide RNA (gRNA):

[0054] The gRNA design was mainly based on http: / / crispr.mit.edu / and

[0055] http: / / www.rgenome.net / cas-designer / for design: Design by selecting the editing type, selecting the species, inputting the sequence of the target gene, etc.

[0056] The gRNAs sequence information is shown in the following table:

[0057] gRNAs Sequence(5'-3') gRNA1 GCCAATAAGGTTTTATCAGCTGG gRNA2 GCTGGAGACCTTATTCTATTGGG

[0058] 2. Homologous recombination plasmid construction

[0059] 2.1 Homologous recombination plasmid map

[0060] Method for constructing homologous recombination plasmid:

[0061] 1. According to the restriction site of the target fragment, select the corresponding endonuclease, cut the circular vector plasmid into a linear vector by double restriction method, and recover the restriction product by agarose gel method;

[0062] 2. Amplify the sequence of the target fragment by PCR and recover the amplified product by agarose gel method;

[0063] 3. Connect the linearized vector and the amplified fragment in proportion at 37°C for 1-2h. Transfer the connected recombinant plasmid (10μl) into the cloning competent cells DH5α, gently blow and mix evenly, let it stand on ice for 30min, then put it in a 42°C water bath for 90s, and immediately put it on ice to cool for 2-3min;

[0064] 4. Add 500 μl of LB liquid medium without antibiotics, shake at 37°C for 1 hour, and rotate at 250 rpm;

[0065] 5. Centrifuge the bacterial solution from the previous step at 5000rpm for 5 minutes and discard 300μl of supernatant. Resuspend the bacterial cells with the remaining culture medium. It is best to apply different gradients to prevent the monoclonal bacteria from being too dense or too sparse. Use a sterile coating stick to spread evenly on the plate containing plasmid resistance, and place it in a 37℃ incubator for 10 to 12 hours;

[0066] 6. After overnight, use a 1μl pipette tip to pick up the monoclonal bacteria, place them in 5ml of LB liquid medium containing antibiotics, and continue to culture for 10-12h;

[0067] 7. After extracting the recombinant plasmid from the bacterial solution with a plasmid extraction kit, digest it with restriction endonuclease EcoR I, and perform enzyme digestion identification by agarose electrophoresis;

[0068] 8. At the same time as step 7, part of the bacterial solution can be taken for bacterial solution PCR. The PCR product can be subjected to agarose gel electrophoresis to determine the band size and further identify whether the recombinant plasmid is correct.

[0069] 9. Perform bidirectional sequencing on the successfully identified bacterial solution. Once the sequence results are aligned correctly, it means that the recombinant plasmid has been successfully constructed and downstream experiments can be carried out.

[0070] Homologous recombination plasmid map, such as Figure 2 shown.

[0071] 2.2 Identification of homologous recombination plasmids by restriction enzyme digestion

[0072] After PCR, the product was subjected to agarose gel electrophoresis to check the band size. Figure 3 As shown, according to the EcoR I endonuclease results, combined with Figure 2 Plasmid map, three bands will appear in agarose gel electrophoresis: 7594bp, 5614bp, 466bp, and 1 in the figure matches the corresponding band, confirming that the recombinant plasmid is correct.

[0073] 2.3 Genotype identification of F0 generation mice

[0074] The injected fertilized eggs were transplanted into pseudo-pregnant female mice, and the mice born around 20 days later were F0 generation mice. Their genotypes were identified by PCR amplification and sequencing.

[0075] 2.3.1 Genotyping strategy for F0 generation mice

[0076] like Figure 4 As shown, in Wild type (WT) mice, due to the absence of gene editing, the I / II primers can amplify a fragment of 8.3Kb, and the III / IV primers can amplify a fragment of 9.4Kb; in positive mice, due to the addition of the loxp system, the I / II primers can amplify a fragment of 5.4Kb, and the III / IV primers can amplify a fragment of 5.7Kb. The genotype of the F0 generation mice can be identified by the difference in the bands.

[0077] Homologous recombination positive mouse PCR identification scheme:

[0078] The 5' arm homologous recombination positive genome should amplify a 5.4kb fragment, and the negative genome should amplify a 8.3kb fragment; the 3' arm homologous recombination positive genome should amplify a 5.7kb fragment, and the negative genome should amplify a 9.4kb fragment.

[0079] 2.3.2 PCR identification results of homologous recombination positive F0 generation mice

[0080] The F0 mice with positive double-arm homologous recombination were No. 1, 9, and 14. The results of long-fragment PCR electrophoresis were as follows: Figure 5 As shown, in the 5' and 3' homology arms, the positive mice had obvious bands of 5.4 kb and 5.7 kb, respectively, while the WT mice had obvious bands of 8.3 kb and 9.4 kb.

[0081] 2.3.3 PCR identification method of F0 generation mice with positive 5' homology arm recombination

[0082] Primer information

[0083] Primer Sequence5'-->3' PrimerType I GGCATGGTAAAGGATTCACATCAAA Forward II TACACTCTTGATGCTTTGGGTTTTC Reverse

[0084] Reaction system:

[0085] ReactionComponent Volume(μl) ddH2O 8.05 2xPCRBuffer 10 PrimerI (20 pmol / μl) 0.3 Primer II (20 pmol / μl) 0.3 KOD-Multi&Epi-* 0.35 Genomic DNA 1 Total 20

[0086] KOD-Multi&Epi-(TOYOBO, Code No: KME-101)

[0087] Reaction conditions:

[0088] Step# Temperature(℃) Time Note 1 94 3min - 2 98 20min - 3 63 20min - 4 68 4min repeatsteps2-4for35cycles 5 68 5min - 6 12 - hold

[0089] 2.3.4 Primer information for PCR identification of F0 generation mice with positive 3' homology arm recombination

[0090] Primer Sequence5'-->3' PrimerType III TCCTGTGTTGACATAGTTCTTTGGA Forward IV TGTCATGTTTACCTCTCCAGACATT Reverse

[0091] Reaction system:

[0092] ReactionComponent Volume(μl) ddH2O 8.05 2xPCRBuffer 10 Primer III (20 pmol / μl) 0.3 Primer IV (20 pmol / μl) 0.3 KOD-Multi&Epi-* 0.35 Genomic DNA 1 Total 20

[0093] KOD-Multi&Epi-(TOYOBO, Code No: KME-101) reaction conditions:

[0094]

[0095]

[0096] 2.4 Obtaining F1 generation mice and identifying their genotypes

[0097] Since the cleavage rate of the fertilized egg is very fast in the early stage, the F0 generation mice obtained are chimeras and may not have the ability to stably inherit. They need to be subcultured to obtain F1 generation mice with stable inheritance. F0 generation positive mice are mated with wild-type C57BL / 6J mice to obtain F1 generation mice, and their genotypes are identified by PCR method and sequencing.

[0098] 2.4.1 PCR Identification of 5' and 3' Homologous Arms of F1 Mice

[0099] The PCR identification strategy and method are the same as those in 2.3 F0 generation mouse identification. The electrophoresis results of PCR identification of 5' and 3' homology arms of F1 generation mice are as follows: Figure 6 As shown in A and 6B. The positive mice identified by PCR were: 1, 6, 8, 10, 11, 12, 13, 14, 15, 20, 22, and 23; all were confirmed to be positive by sequencing.

[0100] 2.4.2 PCR identification and sequencing results of F1 generation mice

[0101] The PCR identification products of F1 positive mice were sequenced, and a total of 4 sequencing reactions were performed. The corresponding regions of the sequencing reactions were as follows: Figure 7 Among them, 2 sequencing reactions were performed for 5' homology arm identification and PCR product sequencing, which were marked as 1 and 2 respectively; 2 sequencing reactions were performed for 3' homology arm identification and PCR product sequencing, which were marked as 3 and 4 respectively.

[0102] 2.4.3F1 generation positive mouse number and basic information

[0103] The numbers and basic information of F1 positive mice are shown in the table below;

[0104] Basic information of F1 positive mice

[0105]

[0106]

[0107] 3. After the mice are delivered, follow-up work

[0108] 3.1 Mouse Validation

[0109] After receiving the mice delivered by our company, please first check the number of mice delivered and the number of the delivered mice according to the information on the delivery note. The numbering principle of our mice is as follows: Figure 8 shown.

[0110] 3.2 Subsequent mouse breeding plan

[0111] Unless otherwise specified, all delivered flox mice were flox heterozygous mice (geneflox / +).

[0112] 3.2.1 Brief process and suggestions for subsequent experimental mouse breeding

[0113] 3.2.1.1 A brief procedure for subsequent experimental mouse breeding is as follows Fig. 9 As shown:

[0114] (1) The obtained flox heterozygous mice (gene flox / + ) is divided into two parts:

[0115] Some of the flox mice were mated with Cre mice to obtain both flox-positive and Cre-positive mice (these mice are abbreviated as: gene flox / + :Cre+) and flox-positive and Cre-negative mice (gene flox / + ); some flox mice were self-fertilized to obtain flox homozygous (the mice are abbreviated as: gene flox / flox ) and flox heterozygous mice (gene flox / + ).

[0116] (2) To obtain flox homozygous and Cre-positive mice, there are two breeding methods:

[0117] One method is to obtain flox and Cre double positive heterozygous mice (gene flox / + :Cre+) and flox heterozygous mice (gene flox / + ) mating, and finally obtained the experimental group mice with flox homozygosity and Cre positive (the mice are abbreviated as: gene flox / flox : Cre+, the proportion of offspring of this mouse is 1 / 8) and the control group of mice homozygous for flox and Cre negative (gene flox / flox , the proportion of offspring of this mouse is: 1 / 8);

[0118] Another method is to obtain flox and Cre double positive heterozygous mice (geneflox / + :Cre+) and flox homozygous mice (gene flox / flox ) mating, and finally obtained the experimental group mice with flox homozygous and Cre positive (gene flox / flox : Cre+, the proportion of offspring of this mouse is 1 / 4) and the control group of mice homozygous for flox and Cre negative (gene flox / flox , the proportion of offspring of this mouse is: 1 / 4).

[0119] Note: The above breeding scheme for experimental mice is only a reference scheme. During the mouse breeding process, the situation varies depending on the number of mice of various genotypes. Please make adjustments according to the actual situation.

[0120] 3.2 Subsequent mouse genotyping protocol

[0121] After the delivered flox mice are verified to be problem-free, the mouse genotype can be identified by short-fragment PCR during the subsequent mouse mating and breeding process. The primers and conditions required for mouse genotype identification in the subsequent mouse breeding steps are as follows. There are many options for mouse genotype identification. This report only gives one set of options. Customers can also design primers themselves according to the design principles we give. There are no special requirements for primer design software. The PrimerSelect program in the conventional DNASTAR software can meet the requirements (the relevant software can be downloaded through online search).

[0122] 3.2.1 Identification of flox mouse genotype (used to identify flox homozygous, heterozygous and wild type)

[0123] The principle of flox mouse genotype identification based on the Cas9 strategy is: after the loxp site is inserted, the wild type and mutant PCR identification are performed, and the different sizes of the PCR product fragments are used to distinguish different genotypes. This report only gives the primer position diagrams of two sets of schemes (P1, P2 primer pairs and P3, P4 primer pairs). The primer sequence information and specific PCR identification methods of one set of schemes are for reference; the primer sequence information and specific PCR identification methods of the other set of schemes are for your own design and verification. Users can perform identification according to the identification schemes and methods we provide, or they can design their own.

[0124] 3.2.1.1 Schematic diagram of the positions of PCR identification primers

[0125] like Fig.10 As shown, WT mice only have a band of 291 bp, heterozygous mice have two bands of 291 kb and 350 kb, and homozygous mice only have a band of 350 bp.

[0126] 3.2.1.2 PCR identification

[0127]

[0128]

[0129] 4. Analysis of Sequencing Results

[0130] 4.1 Sequencing results of PCR identification products of F1 generation mice and comparison with target sequences

[0131] The sequencing comparison results take positive mouse No. 1 as an example.

[0132] 4.1.1 PCR identification and sequencing results of 5' homology arm of F1 mice

[0133] 1# Sequencing reaction comparison results are as follows Fig.12 As shown, Query is the target sequence (E23Rik recombinatedgenomic DNA sequence), Subject is the sequencing result, and the red underline is the 5arm homology arm sequence.

[0134] 2# Sequencing reaction comparison results are as follows Fig.13 As shown, Query is the target sequence (E23Rik recombinated genomic DNA sequence), Subject is the sequencing result, the red box base is the Loxp sequence, and the red underline is the 5arm homology arm sequence.

[0135] 4.1.2 PCR identification and sequencing results of 3' homology arms of F1 mice

[0136] 3# Sequencing reaction comparison results are as follows Fig.14 As shown, Query is the target sequence (E23Rik recombinated genomic DNA sequence), Subject is the sequencing result, the red box base is the Loxp sequence, and the red underline is the 3arm homology arm sequence.

[0137] 4# Sequencing reaction comparison results are as follows Fig.15 As shown, Query is the target sequence (E23Rik recombinatedgenomic DNA sequence), Subject is the sequencing result, and the red underline is the 3arm homology arm sequence.

[0138] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention, rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A method for constructing a 6030442E23Rik conditional gene knockout mouse model, characterized in that: The following steps are involved: Step 1: Design gRNA that recognizes the 6030442E23Rik gene, perform in vitro transcription, and obtain Cas9 mRNA and gRNA; Step 2: construct homologous recombination vector; Step 3: Microinject Cas9 mRNA, gRNA and homologous recombination vector into mouse fertilized eggs to obtain F0 generation mice; Step 4: The positive F0 mice identified by PCR amplification and sequencing were mated with C57BL / 6J mice to obtain positive F1 mice.

2. The method for constructing the 6030442E23Rik conditional knockout mouse model according to claim 1, characterized in that: The primer sequences used to prepare gRNA in step 1 include gRNA1 and gRNA2, and the nucleotide sequences of gRNA1 and gRNA2 are as follows: gRNA1: 5'-GCCAATAAGGTTTTATCAGCTGG-3'; gRNA2: 5'-GCTGGAGACCTTATTCTATTGGG-3'.

3. The method for constructing the 6030442E23Rik conditional knockout mouse model according to claim 2, characterized in that: The homologous recombination vector in step 2 contains a 2.9 kb 5' homology arm, a 2.2 kb flox region and a 2.6 kb 3' homology arm.

4. The method for constructing the 6030442E23Rik conditional knockout mouse model according to claim 3, characterized in that: The method for constructing the homologous recombination vector includes: connecting the target fragments of the 5' homology arm, the flox region and the 3' homology arm to the pBR-322 vector by using the In-fusion cloning method.

5. The method for constructing the 6030442E23Rik conditional knockout mouse model according to claim 4, characterized in that: The identification scheme of F0 generation mice is as follows: The 5' arm homologous recombination positive genome should amplify a 5.4kb fragment, and the negative genome should amplify a 8.3kb fragment; the 3' arm homologous recombination positive genome should amplify a 5.7kb fragment, and the negative genome should amplify a 9.4kb fragment.

6. The method for constructing the 6030442E23Rik conditional gene knockout mouse model according to claim 5, characterized in that: The PCR primer sequences for the 5' homology arms are as follows: Forward-GGCATGGTAAAGGATTCACATCAAA; Reverse-TACACTCTTGATGCTTGGGTTTTC.

7. The method for constructing the 6030442E23Rik conditional knockout mouse model according to claim 6, characterized in that: The PCR primer sequences for the 3' homology arms are as follows: Forward-TCCTGTGTTGACATAGTTCTTTGGA; Reverse-TGTCATGTTTACCTCTCCAGACATT.

8. The method for constructing the 6030442E23Rik conditional knockout mouse model according to claim 7, characterized in that: The mice were C57BL / 6J mice.

Images