Smart-seq2 library construction method based on Tn5 transposase complex

Abstract

The invention discloses a Smart-seq2 library construction method based on a Tn5 transposase complex. The Smart-seq2 library construction method comprises the following steps: preparing a Tn5 transposase complex solution; carrying out reverse transcription and pre-amplification on the prepared Tn5 transposase complex solution to obtain cDNA (complementary deoxyribonucleic acid), and digesting the cDNA; and adding other reagents corresponding to Smart-seq2 library construction into the obtained product to construct an Illumina library so as to obtain the transcriptome library. According to the single cell transcriptome library building method, the advantages of an original Smart-seq2 library building method can be reserved, for example, full-length transcripts are captured, the library building cost can be further reduced, and the higher number of transcriptome differential expression genes can be obtained. The method is simple in process and very low in cost, the cDNA sample broken by the self-made transposase can be as low as 10 yuan / sample, very difficult technical operation is not needed, and the method is easy to implement and wide in application in various laboratories.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a Smart-seq2 library construction method based on a Tn5 transposase complex. Background Art

[0002] Smart-seq2 single-cell transcriptome sequencing uses SMART amplification technology to reverse transcribe and PCR amplify mRNA in single cells, combined with transposase library construction technology, and finally uses high-throughput sequencing methods to quantify gene expression, functional enrichment, metabolic pathways, and other analyses of mRNA in single cells. It can solve the problems of extremely low sample quantity or cell heterogeneity in traditional RNA quantification technology in research fields such as early embryonic development, stem cells, cancer, and immunity. It is a powerful tool for studying gene expression at the single-cell level and greatly expands the application scope of RNA-Seq. The advantage of Smart-seq2 is that it uses the method of full-length transcript sequencing to obtain complete transcript information for each gene in the cell, which helps to more accurately understand the gene expression profile of single cells. Through the improvement of primer design and the characteristics of full-length transcript sequencing, Smart-seq2 is more sensitive in capturing low-expression genes and detecting rare transcripts in single cells. Smart-seq2 is not only widely applicable to various cell types and sample sources, including low-quality single-cell RNA, but also has high single-cell resolution, which can deeply explore cell heterogeneity and subtypes at the single-cell level. Moreover, compared with other single-cell transcriptome sequencing methods, Smart-seq2 has lower requirements for RNA input, which makes it applicable to restricted cell samples. Smart-seq2 technology can solve the problems of extremely low sample quantity or cell heterogeneity in traditional RNA quantification technology in research fields such as early embryonic development, stem cells, cancer, and immunity, and is a powerful tool for studying gene expression at the single-cell level.

[0003] However, Smart-seq2 has the disadvantage of high cost, especially the high cost of transposase. If the cost of Smart-seq2 experiments can be reduced, it can retain its advantages while making it more widely used. Summary of the invention

[0004] Purpose of the invention: In view of the deficiencies in the prior art, the purpose of the present invention is to provide a Smart-seq library construction method based on a homemade transposase complex, which not only retains the advantages of Smart-seq2 such as capturing full-length transcripts, but also can further reduce the cost of library construction and increase the number of differentially expressed genes in the transcriptome.

[0005] Technical solution: In order to solve the above technical problems, the present invention provides a Smart-seq2 library construction method based on the Tn5 transposase complex, comprising the following steps:

[0006] (1) Preparation of Tn5 transposase complex solution: Tn5 transposase complex includes Tn5 transposase, Adaptor1 and Adaptor2 in a molar ratio of 1: (0.4-0.6): (0.4-0.6), which are mixed by pipetting and evenly beaten, and incubated at room temperature; Adaptor1 and Adaptor2 are obtained by annealing ME sequence with Primer 1 or Primer 2 respectively; the ME sequence is shown in SEQ ID NO.1, the sequence of Primer 1 is shown in SEQ ID NO.2, and the sequence of Primer 2 is shown in SEQ ID NO.3;

[0007] (2) using the Tn5 transposase complex solution prepared in step (1) to reverse transcribe the target RNA and perform pre-amplification to obtain cDNA;

[0008] (3) Add other corresponding reagents for Smart-seq2 library construction to the product obtained in step (2) to construct an Illumina library to obtain a transcriptome library.

[0009] Wherein, in step (1), the annealing reagent comprises Annealing buffer, the annealing temperature is 95°C to 15°C, and the specific steps are step 1: 95°C, 2 min, step 2: 95°C, 8 s, -0.1°C per cycle, step 3: return to step 2, 700 cycles, step 4: 4°C, ∞.

[0010] Wherein, the reverse transcription reagents in step (2) include reverse transcriptase, dNTP, Oligos Mix v2, RNase Inhibitor, MgCl2, TSO Mix v2, first-Strand Buffer, DTT and betaine.

[0011] Wherein, in step (3), the reaction procedure of reverse transcription is 42°C, 90 min; 50°C, 2 min and 42°C, 2 min, 10 cycles; 85°C, 5 min; and storage at 4°C.

[0012] The pre-amplification in step (2) is to add pre-amplification enzyme, primer ISPCR-oligo and primer ISPCR-TSO to the reverse transcription system after the reaction, the ISPCR-oligo sequence is shown in SEQ ID NO.4, and the ISPCR-TSO sequence is shown in SEQ ID NO.5.

[0013] Wherein, the pre-amplification reaction procedure in step (2) is:

[0014]

[0015] The cDNA digestion reaction procedure in step (2) is as follows: the PCR instrument heat cover is set to 75°C, the reaction is performed at 55°C for 5 minutes; then the reaction is stored at 12°C. After the reaction is completed, magnetic beads are added to the PCR tube for adsorption and purification of the cDNA.

[0016] Among them, the corresponding reagents for constructing other Smart-seq2 libraries in step (3) include: primer L5 and primer L7-1, the sequence of primer L5 is shown in SEQ ID NO.6, and the sequence of primer L7-1 is shown in SEQ ID NO.7.

[0017] The construction method further comprises sequencing the obtained transcriptome library, and performing quality control and data analysis.

[0018] Wherein, the sequencing method is the second-generation sequencing NovaSeq 6000S4 PE150.

[0019] Beneficial effects: Compared with the existing Smart-seq2 library construction method, the advantages of the present invention are: the single-cell transcriptome library construction method can not only retain the advantages of the original Smart-seq2 library construction method, such as capturing full-length transcripts, but also can further reduce the cost of library construction and obtain a higher number of differentially expressed genes in the transcriptome. The method has a simple process and very low cost, does not require very difficult technical operations, is easy to implement in various laboratories and is widely used. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a diagram of the Smart-seq2 library construction results based on the homemade transposase complex of the present invention.

[0021] Figure 2 It is a comparison diagram of the quality control results of the library obtained by building the library with the homemade transposase complex in Example 1 of the present invention and the quality control results of the Smart-seq2 library with the commercial transposase.

[0022] Figure 3 It is a comparison diagram of the library quality control results obtained by building the library with the homemade transposase complex in Example 1 of the present invention and the Smart-seq2 library Q30 of the commercial transposase.

[0023] Figure 4It is a comparison diagram of the number of genes obtained by constructing a library using a homemade transposase complex in Example 1 of the present invention and the number of genes obtained by constructing a Smart-seq2 library using a commercial transposase. DETAILED DESCRIPTION

[0024] The technical solution of the present invention is described in detail below in conjunction with the accompanying drawings and examples. The Tn5 transposase (182 μM) in the homemade transposase complex of this example was purchased from Beijing TuoTusaisi Biotechnology Co., Ltd.

[0025] 1. Materials and reagents:

[0026] 1) Mice: SPF healthy male C57BL / 6J mice, 12 weeks old, weighing 23-25 ​​g, were purchased from Shanghai Yaokang Biotechnology Co., Ltd.;

[0027] 2) Sources of other biological reagents:

[0028] Table 1 Reagent list

[0029]

[0030]

[0031] Table 2 Self-designed sequences

[0032]

[0033] The above self-designed sequence was commissioned to be synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0034] 2. The Smart-seq library construction method based on the homemade transposase complex of the present invention comprises the following steps: 2.1. annealing the linker connected to the transposase;

[0035] The reaction system and reaction conditions are as follows:

[0036]

[0037] Primer 1 or Primer 2 were annealed and labeled as Adaptor1 and Adaptor2 respectively;

[0038] 2.2. Preparation of transposase complex;

[0039] Tn5 transposase, Adaptor1 and Adaptor2 were mixed in a molar ratio of 1:0.5:0.5; 1:0.4:0.4; 1:0.6:0.6, respectively, and marked as group 1, group 2, and group 3; pipetted evenly, and incubated at room temperature for 1 hour. After the reaction, it was stored at -20°C for future use.

[0040] 2.3. Fragment the cDNA obtained by reverse transcription of RNA from mouse brain tissue of the prepared transposase complex solution;

[0041] 2.3.1 RNA reverse transcription

[0042] Mix the following reaction system on ice: Mouse RNA was extracted from mouse brain tissue and then diluted to 10 pg / μL (approximately single-cell level concentration).

[0043]

[0044] After mixing, the reaction system was marked as S1, and then the PCR tube was placed in a PCR instrument, the temperature of the hot cover was set to 105°C, and the reaction was carried out at 72°C for 3 min.

[0045] Then prepare the reaction system on ice in the following order and name it S2:

[0046]

[0047]

[0048] Reaction procedure: 42°C, 90 min; (50°C, 2 min; 42°C, 2 min) 10 cycles; 85°C, 5 min; and finally storage at 4°C.

[0049] 2.3.2 cDNA pre-amplification

[0050] Mix the following reactions on ice:

[0051]

[0052] The primer used is ISPCR-TSO (10 μm) sequence: AAGCAGTGGTATCAACGCAGAGT. ISPCR-oligo (10 μm) sequence:

[0053] AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN.

[0054] The amplification reaction procedure is as follows:

[0055]

[0056] Then use 0.7× Ampure XP (Company: Beckman; Product Number: A63882) for magnetic bead purification. Equilibrate the DNA magnetic beads at room temperature in advance, then add enzyme-free water to each sample to a total volume of 40μL, then add 28μL magnetic beads (0.7×), pipette 10 times to mix, and let it stand at room temperature for 8min. Place the magnetic bead mixture on a magnetic stand and leave it for 5min until it is clear. Remove the supernatant and wash twice with 200μL 80% ethanol, 30s each time. Discard the ethanol and dry the magnetic beads. Add 12μL of enzyme-free water to dissolve, pipette 10 times to mix, and let it stand for 2min. Place it on a magnetic stand until it is clear, and pipette 10μL into a new PCR tube. Finally, use Qubit to determine the cDNA concentration.

[0057] 2.3.3 cDNA digestion

[0058] Set up the following reaction on ice:

[0059]

[0060] The reaction procedure is as follows: the PCR instrument heat cover is set to 75℃; the reaction is at 55℃ for 5min; and then stored at 12℃. After the reaction is completed, add 10μL 6×Termination Buffer and place at room temperature for 5min to stop the reaction. Then purify with magnetic beads. After stopping the reaction, add 60μL magnetic beads (1.0×) to the PCR tube, pipette 10 times to mix, and place at room temperature for 8min. Place the magnetic bead mixture on a magnetic rack and place it for 5min until it is clear. After removing the supernatant, wash the magnetic beads twice with 200μL 80% ethanol, each time for 30s. Discard the ethanol and dry the magnetic beads. Add 22μL of enzyme-free water to dissolve, pipette 10 times to mix, and let it stand for 2min. Place on a magnetic rack until it is clear, and pipette 20μL into a new PCR tube. Low melting point agarose is separated by extracting the purified cDNA according to the 1:1 DNA magnetic bead adsorption in this step.

[0061] 2.4. Add other corresponding reagents for Smart-seq2 library construction to construct Illumina library;

[0062] Set up the following reaction on ice:

[0063]

[0064] Among them, primer L5:

[0065] AATGATACGGCGACCACCGAGATCTACACGACCTGTATCGTCGGCAGCGTC;

[0066] Primer L7-1: CAAGCAGAAGACGGCATACGAGAT TAAGGCGAGTCTCGTGGGCTCGG.

[0067] The amplification reaction procedure is as follows:

[0068]

[0069]

[0070] Use 0.7× DNA magnetic beads for magnetic bead purification. Balance the DNA magnetic beads at room temperature in advance, then add enzyme-free water to each sample to a total volume of 50μL, then add 35μL magnetic beads (0.7×), pipette 10 times to mix, and leave at room temperature for 8min. Place the magnetic bead mixture on a magnetic stand and leave for 5min until clear. Remove the supernatant and wash twice with 200μL 80% ethanol, 30s each time. Discard the ethanol and dry the magnetic beads. Add 18μL of enzyme-free water to dissolve, pipette 10 times to mix, and let stand for 2min. Place on a magnetic stand until clear, and pipette 15μL into a new PCR tube. Finally, use Qubit to determine the final concentration, and use agarose gel electrophoresis to check the library construction results.

[0071] The conventional Smart-seq2 library construction method as a control group is consistent with the other steps of the previous embodiment, except that the homemade transposase complex is replaced with a commercial transposase complex, which is purchased from the company ABclonal, and its product number is RK20265. The unit price of the commercial transposase is 600 yuan / sample, and its cost is relatively high. In this embodiment, the homemade transposase complex can be used to interrupt the cDNA sample at as low as 10 yuan / sample.

[0072] The experimental results can be found in Figure 1 Lane M is a 2000 bp marker, lanes 1 and 2 are the results of the conventional Smart-seq2 library construction method, and lanes 3, 4, and 5 are the library construction results of the homemade transposase complex group 1, group 2, and group 3, respectively.

[0073] Transcriptome gene alignment was performed using Hisat2. Quality control comparison was performed using Qualimap and FastQc. Figure 2 As shown, the homemade Tn5 complex group 1 in Example 1 ( Figure 2 A), group 2( Figure 2 B) and Group 3 ( Figure 2 C) is better than the quality control results of Smart-seq2 method using commercial transposase ( Figure 2 D) is better. Figure 3As shown, the Q30 value of the quality control results showed that the quality control results of the homemade Tn5 complex group 1 (1:0.5:0.5), the homemade Tn5 complex group 2 (1:0.4:0.4), and the homemade Tn5 complex group 3 (1:0.6:0.6) in Example 1 were significantly better than the quality control results of the traditional Smart-seq2 (P<0.001). Samtools was used for data conversion. FeatureCounts is used to calculate the number of reads mapped to each gene. Based on the length of the gene and the number of reads mapped to the gene, the number of fragments per million transcripts of each gene is calculated. The obtained data was partitioned and split at different sequencing depths, and then the analysis was rerun to obtain the number of reads obtained at the same sequencing depth. As Figure 4 As shown, the number of genes obtained in Group 1, Group 2 and Group 3 in Example 1 was significantly higher than that obtained by traditional Smart-seq (P<0.05).

Claims

1. A method for constructing a Smart-seq2 library based on the Tn5 transposase complex, characterized in that: The following steps are involved: (1) Preparation of Tn5 transposase complex solution: Tn5 transposase complex includes Tn5 transposase, Adaptor1 and Adaptor2 in a molar ratio of 1: (0.4-0.6): (0.4-0.6), which are mixed by pipetting and evenly beaten, and incubated at room temperature; Adaptor1 and Adaptor2 are obtained by annealing ME sequence with Primer 1 or Primer 2 respectively; the ME sequence is shown in SEQ ID NO.1, the sequence of Primer 1 is shown in SEQ ID NO.2, and the sequence of Primer 2 is shown in SEQ ID NO.3; (2) using the Tn5 transposase complex solution prepared in step (1) to reverse transcribe the target RNA and perform pre-amplification to obtain cDNA, and then digesting the obtained cDNA; (3) Add other corresponding reagents for Smart-seq2 library construction to the product obtained in step (2) to construct an Illumina library to obtain a transcriptome library.

2. The method for constructing a Smart-seq library based on the Tn5 transposase complex according to claim 1, characterized in that: In step (1), the annealing reagent includes Annealing buffer, the annealing temperature is 95°C to 15°C, and the specific steps are step 1: 95°C, 2min, step 2: 95°C, 8s, -0.1°C per cycle, step 3: return to step 2, 700 cycles, step 4: 4°C, ∞.

3. The method for constructing a Smart-seq library based on the Tn5 transposase complex according to claim 1, characterized in that: The reverse transcription reagents in step (2) include reverse transcriptase, dNTP, Oligos Mix v2, RNase Inhibitor, MgCl2, TSO Mix v2, first-Strand Buffer, DTT and betaine.

4. The method for constructing a Smart-seq library based on the Tn5 transposase complex according to claim 1, characterized in that: In step (3), the reverse transcription reaction procedure is 42°C, 90 min; 50°C, 2 min and 42°C, 2 min, 10 cycles; 85°C, 5 min; and storage at 4°C.

5. The method for constructing a Smart-seq library based on the Tn5 transposase complex according to claim 1, characterized in that: The pre-amplification in step (2) is to add pre-amplification enzyme, primer IS PCR-oligo and primer IS PCR-TSO to the reverse transcription system after the reaction, the IS PCR-oligo sequence is shown in SEQ ID NO.4, and the IS PCR-TSO sequence is shown in SEQ ID NO.

5.

6. The method for constructing a Smart-seq library based on the Tn5 transposase complex according to claim 1, characterized in that: The pre-amplification reaction procedure in step (2) is: 。 7. The method for constructing a Smart-seq library based on the Tn5 transposase complex according to claim 1, characterized in that: The cDNA digestion reaction procedure in step (2) is as follows: the PCR instrument heat cover is set to 75°C, the reaction is carried out at 55°C for 5 minutes; then it is stored at 12°C. After the reaction is completed, magnetic beads are added to the PCR tube for adsorption and purification of the cDNA.

8. The method for constructing a Smart-seq library based on the Tn5 transposase complex according to claim 1, characterized in that: The corresponding reagents for constructing other Smart-seq2 libraries in step (3) include: primer L5 and primer L7-1, the sequence of primer L5 is shown in SEQ ID NO.6, and the sequence of primer L7-1 is shown in SEQ ID NO.

7.

9. The method for constructing a Smart-seq library based on the Tn5 transposase complex according to claim 1, characterized in that: The construction method also includes sequencing the obtained transcriptome library on a machine, and performing quality control and data analysis.

10. The method for constructing a Smart-seq library based on the Tn5 transposase complex according to claim 9, characterized in that: The sequencing method is the second-generation sequencing NovaSeq 6000S4 PE150.

Images