Application of circular non-coding RNA-circSATB2015 in diagnosis or treatment of vascular proliferative diseases

Abstract

The invention relates to the technical field of biomedical engineering, provides application of RNA-circSATB2015 in preparation of a medicine for treating vascular proliferative diseases, and particularly relates to application of a RNA-circSATB2015 recombinant expression vector in treatment of indications of the vascular proliferative diseases. Experiments prove that the overexpressed circSATB2015 can inhibit smooth muscle cell migration, compared with a control group, the in-vivo overexpressed circSATB2015 can significantly inhibit intimal hyperplasia after mouse carotid artery guide wire injury, and the relative expression level of the circSATB2015 in peripheral circulating blood has high diagnosis accuracy on coronary atherosclerotic heart disease. The invention provides a new approach and exploration direction for the treatment of vascular proliferative diseases.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and specifically to the use of circular non-coding RNA-circSATB2_015 as a target in the diagnosis or treatment of coronary heart disease. Background Art

[0002] Cardiovascular disease remains the leading cause of death worldwide. Abnormal proliferation and migration of vascular smooth muscle cells (VSMCs) caused by vascular injury play an important role in the pathogenesis of various cardiovascular diseases, such as atherosclerosis, vein graft failure, restenosis after angioplasty, and pulmonary hypertension. VSMCs are located in the middle layer of the vascular wall and are highly specialized cells responsible for regulating vascular tension, thereby regulating blood distribution and pressure. Unlike most terminally differentiated cells, VSMCs can transform between a contractile (differentiated) phenotype and a synthetic (dedifferentiated) phenotype under the stimulation of growth factors, cytokines, mechanical forces, and other injuries, i.e., phenotypic switch of VSMCs. Among them, platelet-derived growth factor (PDGF)-BB is mainly released by vascular endothelial cells and platelets at the site of injury. It can regulate multiple transcription factors and signaling pathways, promote VSMC proliferation after injury, and migrate to the new intima layer. It is one of the most effective VSMC phenotypic switch stimulators currently studied. However, the molecular mechanism of PDGF-BB as a phenotypic switch is still unclear.

[0003] Circular RNA (circRNA) is a type of non-coding RNA with gene regulatory effects. Compared with traditional linear RNA, circRNA is composed of exons or introns connected end to end to form a unique closed circular structure, which is not easily degraded by nuclease (RNase) and has a longer half-life. More and more evidence shows that circRNAs play an important regulatory role in physiological and pathological processes such as development, aging, and cancer. Previously reported circRNAs can act as miRNAs molecular sponges to regulate the expression of downstream target genes, and can also play multiple functions such as protein scaffolds, transcriptional regulation, competitive linear splicing, and polypeptide translation. In recent years, the research on circRNA in cardiovascular diseases has made rapid progress. For example, circMAP3K5 affects PDGF-BB-mediated smooth muscle cell differentiation by regulating the miR-22-3p / TET2 pathway; circITCH can sponge miR-330-5p and upregulate the expression of SIRT6, Survivin, and SERCA2a, improving doxorubicin-induced cardiotoxicity. However, so far, there are relatively few studies on circRNAs for VSMC phenotypic transformation, and most circRNAs are considered to be miRNA sponges in the cytoplasm, and the role of circRNAs in post-transcriptional regulation is still unclear. Therefore, exploring new VSMC phenotypic transformation-related circRNAs and fully revealing their downstream regulatory mechanisms have important diagnostic and therapeutic value for vascular proliferative diseases such as coronary atherosclerotic heart disease, pulmonary hypertension, hypertension, and restenosis after angioplasty. Summary of the invention

[0004] The present invention is based on the above research. By performing high-throughput sequencing of circular RNA in human aortic smooth muscle cells induced by PDGF-BB, the circular RNA circSATB2_015, which is highly expressed and highly conservative in the PDGF-BB stimulation group compared with the control group, was screened. Then, siRNA or adenovirus was transfected in vitro for interference, and it was found that inhibition or overexpression of circSATB2_015 can regulate the phenotypic transformation of vascular smooth muscle cells. Adenovirus was further used for overexpression in mice, and it was found that overexpression of circSATB2_015 can improve the hyperplasia of the neointima after guidewire injury of the mouse carotid artery. At the same time, the relative expression level of circSATB2_015 in peripheral circulating blood has a high diagnostic accuracy for coronary atherosclerotic heart disease, indicating that circSATB2_015 plays an important role in the phenotypic transformation of vascular smooth muscle and can be used as a target for diagnosis or treatment of vascular proliferative diseases. Based on this result, the application of circular noncoding RNA-circSATB2_015 in the diagnosis or treatment of vascular proliferative diseases is provided, aiming to break through the bottleneck of current coronary heart disease treatment and provide new ideas and targets for disease diagnosis and treatment.

[0005] The specific technical solutions of the present invention are as follows:

[0006] The first aspect of the present invention provides the use of a reagent for detecting the expression level of circular non-coding RNA-circSATB2_015 in the preparation of a diagnostic kit for vascular proliferative diseases.

[0007] Among them, the nucleic acid sequence of circular non-coding RNA-circSATB2_015 is shown as follows (SEQ ID NO.1):

[0008] gtttgatgattcctgtcttttgtgtcgtggagcagttggacggctctcttgaatatgacaacagagaagaacacgccgagtttgtcctggtgcggaaagatgtgctttttagccagctggtggagactgcgc tcctggccctggggtattctcacagctctgcggcccaggcccaaggaataatcaagctgggaaggtggaaccctctccccctcagttatgtgacagatgcacccgacgcgacagtggccgacatgctacaaga tgtctatcatgttgtgacgttgaaaatccaattacaaagttgttcaaagttggaagacttgcctgcggagcagtggaaccatgccacagtccgcaatgccttaaaggaactgctcaaagagatgaaccagagc acattagccaaagaatgccctctctcccagagtatgatttcatccattgtaaatagcacatattatgccaatgtgtcagcaaccaagtgccaggagtttgggagatggtataaaaagtacaagaagattaaag

[0009] The reagent for detecting the expression amount of circular non-coding RNA-circSATB2_015 is selected from primers with detection specificity for RNA-circSATB2_015, and the primer sequences are shown in SEQ ID NO. 2 and 3 as follows:

[0010] Forward primer F: 5'-TGAACCAGAGCACATTAG-3' (SEQ ID NO. 2);

[0011] Reverse primer R: 5'-ACAGGAATCATCAAACCTT-3' (SEQ ID NO. 3).

[0012] The vascular proliferative diseases described in the present invention refer to cardiovascular diseases caused by abnormal proliferation and migration of VSMCs, including coronary atherosclerotic heart disease, pulmonary hypertension, hypertension, and restenosis after angioplasty.

[0013] In a second aspect, the present invention provides a diagnostic kit for vascular proliferative diseases, comprising a reverse transcription system, a primer system and an amplification system, wherein the primer sequences of the primer system are shown in SEQ ID NOs. 2 and 3 above.

[0014] In a third aspect, the present invention provides the use of circular non-coding RNA-circSATB2_015 in the preparation of drugs for vascular proliferative diseases.

[0015] Preferably, the drug is selected from small interfering RNA of RNA-circSATB2_015 or a recombinant expression vector of RNA-circSATB2_015.

[0016] Further preferably, the nucleic acid sequence of RNA-circSATB2_015 is as shown in SEQ ID NO.1 above.

[0017] In addition to the above sequence, the following situations also fall within the protection scope of the present invention:

[0018] (i) a molecule that hybridizes to the nucleotide sequence defined by SEQ ID NO.1 under stringent conditions;

[0019] (ii) a nucleic acid molecule that is homologous to or has sequence identity with the nucleotide sequence shown in SEQ ID NO.1 and has similar functions;

[0020] (iii) A nucleic acid molecule having similar functions, wherein one or more nucleotides are substituted, deleted or added to the nucleotide sequence shown in SEQ ID NO.1.

[0021] In a fourth aspect of the present invention, a use of an RNA-circSATB2_015 recombinant expression vector in the preparation of a drug for vascular proliferative diseases is provided. The RNA-circSATB2_015 recombinant expression vector comprises an expression vector and an RNA-circSATB2_015 nucleic acid molecule inserted into the expression vector, and the sequence thereof is as described above.

[0022] The expression vector includes a viral vector and a non-viral vector.

[0023] The "viral vector" includes adenovirus, adeno-associated virus, lentivirus, coxsackie virus, herpes simplex virus, measles virus, Newcastle disease virus, parvovirus, poliovirus, reovirus, vaccinia virus and vesicular stomatitis virus, etc. Suitable viral vectors are well known to those of ordinary skill in the art.

[0024] The "non-viral vector" includes liposomes or lipid complexes, cationic polymers, chitosan polymers and nanoparticle vectors, etc. Suitable non-viral vectors are well known to those skilled in the art.

[0025] In a fifth aspect of the present invention, a pharmaceutical composition for treating vascular proliferative diseases is provided, comprising an active ingredient and a pharmaceutically acceptable excipient, wherein the active ingredient is the RNA-circSATB2_015 or a recombinant vector thereof as described above.

[0026] In terms of drug form, the drug or drug composition is selected from the following methods of administration: oral administration, injection, gold-coated gene gun bombardment, reproduction-defective bacteria carrying plasmid DNA, replication-defective adenovirus carrying target DNA, transdermal administration, etc.

[0027] When the composition of the present invention is administered to animals including humans, the dosage varies depending on the patient's age and weight, disease characteristics and severity, and administration route. The results of animal experiments and various circumstances can be referred to, and the total dosage cannot exceed a certain range.

[0028] Furthermore, the pharmaceutical composition of the present invention can be used in combination with other pharmaceutical compositions for treating vascular proliferative diseases.

[0029] The technical effects and significant technical progress achieved by the present invention are:

[0030] The present invention provides the use of RNA-circSATB2_015 in the preparation of a reagent or drug for diagnosing or treating vascular proliferative diseases. Experiments have confirmed that overexpression of circSATB2_015 can inhibit smooth muscle cell migration, and overexpression of circSATB2_015 in vivo can significantly inhibit intimal hyperplasia after guidewire injury in mouse carotid arteries compared with the control group. The present invention provides a new approach and exploration direction for the treatment of vascular proliferative diseases.

[0031] The technical solution of the present invention aims at the key technical problems in the diagnosis, monitoring and treatment of vascular proliferative diseases in the prior art, and proposes an innovative application method, including a kit for detecting the expression of RNA-circSATB2_015, a nanomedicine and a recombinant expression vector. The specific technical problems solved and the significant technical progress achieved are as follows:

[0032] 1. Technical problems solved

[0033] 1. Insufficient sensitivity and specificity of diagnosis: Existing diagnostic methods for vascular proliferative diseases often lack sensitivity and specificity, and it is difficult to accurately distinguish vascular proliferative lesions from normal tissues. By using a kit to detect the specific expression of RNA-circSATB2_015, this technical solution significantly improves the ability to diagnose coronary heart disease in the early stage.

[0034] 2. Difficulties in targeting and controlling the efficacy of therapeutic drugs: Conventional drugs have limited effects in vascular proliferative diseases and are difficult to precisely target the lesion area. By introducing a nano drug delivery system that encapsulates RNA-circSATB2_015, the technical solution achieves targeted drug delivery, improves the effectiveness of treatment, and avoids side effects caused by the distribution of drugs throughout the body.

[0035] 3. Safety and durability of the treatment process: For severe vascular lesions, existing therapies are insufficient in maintaining the durability of the treatment effect, and long-term medication may cause adverse reactions. The introduction of the RNA-circSATB2_015 recombinant expression vector in the present invention provides a safe and effective long-term solution for continuous regulation of components.

[0036] 2. Significant technological progress

[0037] 1. Improved diagnostic accuracy and early detection capabilities: RNA-circSATB2_015, as a specific biomarker, provides significantly improved detection sensitivity and specificity. Especially in the early detection of proliferative diseases such as coronary heart disease, it can detect lesions in time, which is conducive to early intervention.

[0038] 2. Enhanced targeting and effectiveness of treatment:

[0039] 3. Achieved long-term, low-side effect treatment: The persistent expression of RNA-circSATB2_015 expression vector can effectively inhibit the excessive proliferation of blood vessels, without the need for frequent medication or high doses, reducing side effects during treatment and improving patient compliance and quality of life.

[0040] 4. Promoted the development of personalized and precision medicine: The technical solution of the present invention can not only be used for individualized disease diagnosis and treatment plan design, but also provides a means for real-time monitoring and evaluation of treatment effects, promoting the application of personalized treatment and precision medicine in the field of vascular proliferative diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 The circular RNA high-throughput sequencing transcriptome characterization of PDGF-BB-induced VSMC phenotypic transformation in Example 1;

[0042] Figure 2 The structural characteristics of circSATB2_015 and its expression level in the PDGF-BB-induced VSMC phenotypic transformation model in Example 1;

[0043] Figure 3 The effect of circSATB2_015 on vascular smooth muscle cell phenotypic transformation markers ACTA2, CNN1 and TAGLN in Example 2;

[0044] Figure 4 is the effect of circSATB2_015 on the proliferation and migration ability of vascular smooth muscle cells in Example 3;

[0045] Figure 5 This is the regulatory effect of circSATB2_015 on neointimal hyperplasia after guidewire injury of the mouse carotid artery in Example 4.

[0046] Figure 6 The ROC curve of the relative expression level of circSATB2_015 in peripheral blood in Example 5 for distinguishing coronary heart disease from non-coronary heart disease DETAILED DESCRIPTION

[0047] The present invention is further described below with examples, but should not be construed as limiting the present invention. The examples do not include a detailed description of conventional methods, which are well known to those skilled in the art and are described in many publications.

[0048] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein can be applied to the present invention, and the preferred implementation methods and materials described in the specific implementation methods are for demonstration purposes only.

[0049] This paper proposes an innovative diagnostic and therapeutic system based on RNA-circSATB2_015, which is applied to the precise diagnosis and targeted treatment of vascular proliferative diseases. The specific working principle can be divided into the following eight steps:

[0050] 1. Detection of RNA-circSATB2_015 as a biomarker

[0051] The primers and reverse transcription system in the kit can detect the expression of RNA-circSATB2_015 in patient samples. As a specific marker for coronary heart disease, RNA-circSATB2_015 provides an accurate molecular detection method. The primer system uses specific primer sequences (SEQ ID NO.2 and NO.3) to ensure efficient and specific recognition and amplification of RNA-circSATB2_015, thereby improving the sensitivity of diagnosis.

[0052] 3. Composition and testing process of diagnostic kit

[0053] The kit includes reverse transcription, primers and amplification systems, which can fully perform the detection of RNA-circSATB2_015. After the sample is reverse transcribed into cDNA, the amplification system detects the expression level of RNA-circSATB2_015 through quantitative PCR and obtains the results quickly. The entire system is integrated and suitable for clinical detection applications.

[0054] 5. RNA-circSATB2_015 recombinant expression vector

[0055] The present invention further constructs RNA-circSATB2_015 into a recombinant expression vector to facilitate intracellular expression and therapeutic effects. Recombinant vectors include common plasmids, bacteriophages and viral vectors, etc. Viral vectors such as adenovirus and lentivirus are used to deliver RNA-circSATB2_015 to target cells, thereby achieving long-term expression in vivo, which helps to continuously treat coronary heart disease.

[0056] 6. Choose the best viral vector

[0057] The system selects a variety of viral vectors with different delivery capabilities, including lentivirus, adenovirus, and Newcastle disease virus. By selecting viral vectors suitable for specific lesion sites, the delivery efficiency of RNA-circSATB2_015 in target cells can be enhanced, and the durability of treatment can be achieved, ensuring the efficacy of the drug.

[0058] 8. Personalized diagnosis and treatment

[0059] The system of the present invention can perform personalized diagnosis and treatment for different patients based on the expression difference of RNA-circSATB2_015. The diagnosis part realizes early screening and staging judgment of the disease, and the treatment part realizes disease control through continuous expression, thereby effectively improving the overall diagnosis and treatment level of vascular proliferative diseases.

[0060] Example 1 Discovery and identification of circular transcript circSATB2_015

[0061] 1.1 Cell culture and treatment

[0062] The human primary aortic smooth muscle cells (HAoSMCs) used in the present invention were purchased from Sicencell, USA, and the domestic agent was Shanghai Zhongqiao Xinzhou Biotechnology Co., Ltd.;

[0063] The cell culture medium is a special culture medium for primary vascular smooth muscle cells (Smooth Muscle Cell Medium, SMCM, Cat No. 11012, Sicencell, USA), which contains 500 mL of basal culture medium (Cat No. 1101), 10 mL of fetal bovine serum (Fetal bovine serum, FBS, Cat No. 0010), 5 mL of smooth muscle cell growth factor (Smooth Muscle Cell Growth Supplement, SMCGS, Cat No. 1152), and 5 mL of penicillin / streptomycin solution (penicillin / streptomycin, P / S, Cat No. 0503);

[0064] HAoSMCs are spindle-shaped and adherent cells. The culture conditions are 37°C, 5% CO2, and the cell culture medium is changed every 2-3 days. When the cells grow to 80-90% density, 0.25% Trypsin containing EDTA is used for digestion and passage.

[0065] PDGF-BB (powder) was dissolved in PBS and prepared into 10 -2 PDGF-BB was dissolved in 4mmol / L HCl to prepare a 50μg / mL stock solution, which was stored at -80℃ after aliquoting to avoid repeated freezing and thawing.

[0066] 1.2 High-throughput sequencing

[0067] The present invention performs circular RNA high-throughput sequencing on human aortic smooth muscle cells induced by PDGF-BB, and screens out a circular RNA circSATB2_015 that is highly expressed in the PDGF-BB stimulation group compared with the control group and is highly conservative. The sequence is highly homologous and conserved in humans and mice, and the sequence is shown in SEQ ID NO.1.

[0068] gtttgatgattcctgtcttttgtgtcgtggagcagttggacggctctcttgaatatgacaacagagaagaacacgccgagtttgtcctggtgcggaaagatgtgctttttagccagctggtggagactgcgc tcctggccctggggtattctcacagctctgcggcccaggcccaaggaataatcaagctgggaaggtggaaccctctccccctcagttatgtgacagatgcacccgacgcgacagtggccgacatgctacaaga tgtctatcatgttgtgacgttgaaaatccaattacaaagttgttcaaagttggaagacttgcctgcggagcagtggaaccatgccacagtccgcaatgccttaaaggaactgctcaaagagatgaaccagagc acattagccaaagaatgccctctctcccagagtatgatttcatccattgtaaatagcacatattatgccaatgtgtcagcaaccaagtgccaggagtttgggagatggtataaaaagtacaagaagattaaag

[0069] By comparing the gene sequence and protein sequence of human circSATB2_015, the present application designed a reverse primer for the circSATB2_015 joint. The reverse primer sequence is as follows:

[0070] F: 5'-TGAACCAGAGCACATTAG-3' (SEQ ID NO. 2);

[0071] R: 5'-ACAGGAATCATCAAACCTT-3' (SEQ ID NO. 3).

[0072] Primer synthesis was completed by Shanghai Genewise.

[0073] 1.3 RNA extraction

[0074] Total RNA was extracted using the Trizol method. Trizol was purchased from Acre Biotechnology (AG RNAex Pro RNA extraction reagent, Cat NO.AG21101). Enzyme-free pipette tips were used throughout the entire operation. The specific steps are as follows (taking a six-well plate as an example):

[0075] 1) After the cell treatment time is up, take the cells out of the incubator, discard the culture medium in the cell culture dish or well plate, and wash twice with 2 mL of high-temperature sterilized PBS;

[0076] 2) Add 1 mL of Trizol lysis buffer to the culture dish or well plate and lyse on ice for 15 minutes;

[0077] 3) After repeated pipetting, transfer the lysate to a 1.5 mL enzyme-free EP tube, add 200 μL chloroform (trichloromethane), shake vigorously on a vortex for 20-30 seconds, and let stand at room temperature for 5 minutes;

[0078] 4) Centrifuge at 12500 rpm for 15 min at 4°C;

[0079] 5) Take the mixture out of the 4°C centrifuge. It can be seen that it is divided into three layers: upper, middle and lower. Use a 200μL enzyme-free pipette tip to aspirate the supernatant into a new 1.5mL enzyme-free EP tube (about 500μL supernatant is obtained for every 1mL Trizol). This step should be performed as carefully and steadily as possible to avoid touching the middle and lower layers.

[0080] 6) Add 500 μL of isopropanol, mix by inversion, and let stand at room temperature for 10 minutes. After this step, the mixture can be stored at -80°C overnight to facilitate RNA precipitation and increase RNA yield;

[0081] 7) The next day, thaw the sample at room temperature and centrifuge at 4°C, 12,500 rpm for 15 minutes;

[0082] 8) Take the sample out of the 4°C centrifuge. White precipitate can be seen at the bottom of the EP tube. Carefully discard the supernatant, add 1 mL of 75% ethanol (prepared with DEPC water and anhydrous ethanol), and gently invert to mix;

[0083] 9) Centrifuge at 4°C, 7500 rpm for 10 min;

[0084] 10) Discard the supernatant and carefully aspirate the supernatant with a 20 μL enzyme-free pipette tip to avoid touching the precipitate at the bottom;

[0085] 11) Place in a fume hood for 10-15 minutes to fully absorb the remaining ethanol;

[0086] 12) After the ethanol is completely evaporated and the bottom precipitate changes from white to colorless, add 30-50uL R RNase Free dd water into the EP tube and mix by pipetting;

[0087] 13) Use a spectrophotometer to measure the concentration of extracted RNA. First, wash the machine probe 2-3 times with 1-2μL RNase Free dd water, select the RNA concentration measurement mode, change 1.5μL RNase Free dd water for BLANK operation, and then change new RNase Free dd water for concentration measurement. After calibrating the concentration to -0.3~0.3ng / μL, measure the sample RNA concentration in turn, and record the RNA concentration and A260 / 280 value (between 1.8-2.0);

[0088] 1.4 RNA reverse transcription reaction

[0089] Reverse transcription of circRNA and mRNA was performed using Novizan III 1st Strand cDNA Synthesis Kit (+gDNAwiper, R312-01 / 02), the 5×gDNAwiper Mix in the kit can quickly remove genomic DNA contamination at 42°C for 2 min. Reverse transcription was performed according to the kit system.

[0090] 1.5 Quantitative Real-time PCR

[0091] The cDNA obtained by the reverse transcription reaction was used as a template and SYBR Green Pro Taq HS premix reagent (Acry Biotechnology, Cat No. AG11701) was used for real-time fluorescence quantitative PCR (Roche 480) for real-time fluorescence quantitative PCR reaction.

[0092] 1.6 Agarose gel electrophoresis

[0093] 1) cDNA is subjected to conventional or quantitative PCR to obtain PCR products, which are then mixed with loading buffer in appropriate proportions;

[0094] 2) Prepare 2% agarose gel: First, dissolve 50×TAE buffer in ddH2O at a ratio of 1:49 to prepare 1×TAE buffer. Then weigh an appropriate amount of agarose and dissolve it in 1×TAE buffer to prepare 2% agarose gel. Heat in a microwave oven for 2 minutes to form a transparent agarose solution. After cooling slightly, add an appropriate amount of nucleic acid dye (10000×) and mix well.

[0095] 3) Pour the agarose solution into the gel plate. After 30 minutes, place the solidified 2% agarose gel into the electrophoresis tank filled with electrophoresis solution (1×TAE buffer). Gently remove the comb to avoid damaging the gel.

[0096] 4) Use a 20ul pipette to add the PCR product and DNA marker into the gel wells;

[0097] 5) Electrophoresis at 140 V for 30 minutes;

[0098] 6) Use a gel imager to select an appropriate exposure time, take a picture of the band image, then use a UV observer to observe the band and cut out the target band gel and send it to Genewise for Sanger sequencing.

[0099] 1.7 Results

[0100] The circular structure characteristics of circSATB2_015 were determined through forward and reverse primer PCR, RNase R treatment and Sanger sequencing experiments, laying the foundation for further exploring the function of circSATB2_015. Figure 1 Transcriptome characterization of PDGF-BB-induced VSMC phenotypic transformation by circular RNA high-throughput sequencing. Figure 2 A is a schematic diagram of the formation of circular RNA circSATB2_015 and the sequencing results; Figure 2 B is the electrophoresis imaging of circSATB2_015 PCR product, which proves its circularity; Figure 2 C represents RNA stability. Compared with linear RNA, circSATB2_015 is more stable. Figure 2 D is the RNA expression level. Compared with the control group, the expression level of circSATB2_015 in the PDGF-BB group was significantly decreased.

[0101] Example 2 Regulatory effect of circSATB2_015 on phenotypic transformation of smooth muscle cells

[0102] In this embodiment, the methods of RNA extraction, RNA reverse transcription reaction and real-time fluorescence quantitative PCR reaction are the same as those in Example 1.

[0103] 2.1 siRNA synthesis and transfection

[0104] The siRNA used in this case was commissioned to Shanghai Jima Pharmaceutical Technology Co., Ltd. to design and synthesize small interfering RNA and negative control siRNA (small interfering RNA negative control, siRNANC) targeting circSATB2_015.

[0105] Si-circSATB2_015:

[0106] Sense: 5'-AAAGGUUUGAUGAUUCCUGTT-3'(SEQ ID NO.4);

[0107] Anti-sense: 5'-CAGGAAUCAUCAAACCUUUAA-3' (SEQ ID NO.5);

[0108] Negative Control:

[0109] Sense: 5'-UUCUCCGAACGUGUCACGUTT-3'(SEQ ID NO.6);

[0110] Anti-sense: 5'-ACGUGACACGUUCGGAGAATT-3' (SEQ ID NO. 7).

[0111] Transfection of primary aortic smooth muscle cells is difficult. Our laboratory uses Invitrogen's Lipofectamine RNAiMAX transfection reagent (Cat No. 178150) to transfect cells with siRNAs, and performs related operations according to the RNAiMAX transfection instructions.

[0112] 2.2 Construction and infection of circSATB2_015 adenovirus

[0113] The full-length sequence of circSATB2_015 was obtained based on software such as circBase and circBank, and Shanghai Hanheng Biotechnology Co., Ltd. was commissioned to construct the circSATB2_015 overexpression plasmid and adenovirus as well as the corresponding control plasmid and virus.

[0114] When the cells were confluent to 60-70%, the virus was infected. The infection experiment was divided into two groups, and the circSATB2_015 overexpression adenovirus and the control virus vector of the same titer and volume were added respectively. The amount of virus added ranged from MOI = 20 to 50. Three concentration gradients were set, and 0.5uL, 1uL, 1.5uL and 2uL of virus were added respectively. 1 / 2 volume (1mL) of SMCM complete medium was infected, and 2mL of medium was added after 4 hours. After 8 hours, 2mL of fresh complete SMCM medium was replaced, and experimental operation or molecular detection was performed after continued culture as needed. If PDGF-BB and other stimulations are required later, fresh medium was replaced with serum-free SMCM for starvation culture after 12 hours, and blank SMCM containing PDGF-BB (20ng / mL) was added after 24 hours to continue culture.

[0115] 2.3 Western Blot

[0116] VSMC total protein was extracted with RIPA lysis buffer containing 0.1% PMSF. Then, the cell lysate was separated by SDS-PAGE (GenScript) and transferred to a polyvinylidene difluoride membrane. After blocking for 2 hours in TBST solution containing 5% skim milk containing 0.05% Tween20 at room temperature, the cells were incubated with primary antibodies at 4°C overnight, and then incubated with appropriate HRP-labeled secondary antibodies at room temperature for 2 hours. Chemiluminescent signals were detected using ImageQuant LAS4000 software (GE).

[0117] 2.4 Results

[0118] In order to verify whether circSATB2_015 affects the phenotypic transformation of vascular smooth muscle cells, the present invention detected the expression of smooth muscle cell phenotypic transformation markers after siRNA and overexpression adenovirus transfection by quantitative PCR and Western Blot experiments. It was found that compared with the control group transfected with NC, the expression of ACTA2, CNN1 and TAGLN in VSMC was significantly downregulated after knocking down circSATB2_015, and PDGF-BB stimulation could also downregulate ACTA2, CNN1 and TAGLN, and this downregulation effect could be further enhanced with the knockdown of circSATB2_015 ( Figure 3 C). Through Western Blot experiments, we further verified at the protein level that transfection of circSATB2_015 siRNAs could significantly downregulate the expression of VSMC differentiation markers, and the differentiation ability was significantly inhibited ( Figure 3 D).

[0119] However, overexpression of circSATB2_015 by adenovirus had the opposite effect. Compared with the control group transfected with ad-GFP, the expression of ACTA2, CNN1 and TAGLN in the ad-circSATB2_015 group was significantly upregulated. PDGF-BB stimulation downregulated the expression of ACTA2, CNN1 and TAGLN, but overexpression of circSATB2_015 could reverse the downregulation caused by PDGF-BB to a certain extent ( Figure 3 A). Similarly, ad-circSATB2_015 was verified at the protein level to promote the expression of differentiation markers such as ACTA2, CNN1, and TAGLN in VSMCs, and to correct the dedifferentiation state caused by PDGF-BB ( Figure 3 B).

[0120] Example 3 Regulatory effect of circSATB2_015 on smooth muscle cell proliferation and migration

[0121] In this example, the siRNA transfection and overexpression adenovirus infection methods are the same as those in Example 2.

[0122] 3.1BeyoClickTM EdU-594 cell proliferation assay

[0123] EdU (5-Ethynyl-2'-deoxyuridine) is a thymidine nucleoside analog that can replace thymine (T) to penetrate into the replicating DNA molecule during the cell proliferation period, and then quickly mark and detect the replication activity of DNA in the cell through a specific reaction based on EdU and fluorescent dyes. It is very suitable for cell proliferation, cell differentiation, growth and development, DNA repair, virus replication, cell labeling and tracing, and is an important method for studying the proliferation function of vascular smooth muscle cells. Our experiment used the BeyoClickTM EdU-594 kit (No. C0078S) from Beyotime Biotechnologies, and operated according to the instructions.

[0124] 3.2 Scratch healing experiment

[0125] The scratch healing experiment is one of the earliest methods developed to study the migration function of cells in vitro. Its advantages are simplicity and low cost. The basic steps are to establish a "scratch wound" in a monolayer of cells, record the initial "wound" image, and then take images regularly during the cell migration process to record the cell migration healing process. The image changes of different groups are analyzed to compare the differences in cell migration rates under different treatments. The specific experimental operation is as follows:

[0126] 1) Digest and resuspend the overgrown 10 cm dish of VSMCs and inoculate them into a six-well plate at a ratio of 1:2. The inoculation cell density is about 50-60%. Add the culture medium to 2 mL and continue to culture in a cell culture incubator for more than 24 hours.

[0127] 2) When the cell density reaches 70-80%, siRNA or adenovirus transfection is performed;

[0128] 3) When the cells were confluent to a density of 90-100%, the cells were washed twice with PBS and replaced with fresh serum-free SMCM medium for starvation treatment;

[0129] 4) Scratch operation can be performed 24 hours later (to ensure sufficient cell density and exclude the influence of cell proliferation). Sterilize the ruler and use a sterile 1 mL pipette tip to measure the ruler. Try to scratch the center line of the hole. The pipette tip should be vertical to avoid tilting. Then, discard the previous culture medium and replace it with fresh serum-free SMCM culture medium (starvation medium) according to the group. The starvation medium with a PDGF-BB concentration of 20 ng / mL is taken under a microscope to record the scratch morphology at 0 hours. Then, the cells are placed in culture for further culture.

[0130] 5) Observe cell migration under a microscope. After about 18-24 hours, take photos to record the healing of cell scratches.

[0131] 6) ImageJ was used to count the migrating cells in different groups and compare the differences in the horizontal migration ability of VSMCs in different groups.

[0132] 3.3 Results

[0133] The present invention detected the effect of circSATB2_015 on the proliferation ability of smooth muscle cells through EdU experiment, and found that after knocking down circSATB2_015, the number of proliferative cells marked by red fluorescence increased significantly ( Figure 4 B), while overexpression of circSATB2_015 could inhibit VSMC proliferation ( Figure 4 A). In order to verify whether circSATB2_015 affects the migration ability of smooth muscle cells, the present invention conducted a cell scratch test and found that the migration level of cells in the circSATB2_015 silencing group was significantly enhanced ( Figure 4 D), while overexpression of circSATB2_015 could inhibit smooth muscle cell migration ( Figure 4 C).

[0134] Example 4 Effect of circSATB2_015 on neointimal hyperplasia after guidewire injury of the carotid artery in mice

[0135] 4.1 Construction of circSATB2_015 adeno-associated virus

[0136] The full-length sequence of circSATB2_015 was obtained based on software such as circBase and circBank, and Heyuan Biotechnology Co., Ltd. was commissioned to construct the circSATB2_015 overexpression plasmid, AAV2 / 9 serotype adeno-associated virus, and corresponding control plasmids and viruses.

[0137] 4.2 Mouse carotid artery guidewire injury experiment

[0138] The C57BL / 6J mice of the present invention were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd., and 10-week-old mice were selected for carotid artery guidewire injury surgery. One week before the operation, the AAV2 / 9circSATB2_015 virus was used to perform an in vivo overexpression experiment in mice, and then the carotid artery guidewire injury surgery was performed: 3-month-old C57BL / 6 mice were selected and anesthetized with isoflurane, and a 1-cm long longitudinal incision was made along the midline of the mouse neck, and then the right common carotid artery (CCA) was exposed under a microscope, and the CCA and the right internal carotid artery were temporarily blocked with artery forceps and silk thread. Next, a slit was cut in the external carotid artery, a 0.38 mm guidewire was inserted into the lumen, and it was pulled and rotated 5 times to damage the endothelium. After that, suture was performed, and the undamaged CCA on the left was used as a sham control group.

[0139] 4.3 HE staining

[0140] Four weeks after CCA guidewire injury, mice were anesthetized with urethane. Carotid arteries and aortas were harvested for experiments. Hematoxylin-eosin (HE) staining was used to observe the extent of neointimal hyperplasia in carotid arteries, and Image J software was used to measure the intima / media thickness ratio.

[0141] 4.4 Results

[0142] Effect of adenovirus overexpression on intimal hyperplasia after guidewire injury in mice Figure 5 As shown in B. In vivo overexpression of circSATB2_015 significantly inhibited intimal hyperplasia after guidewire injury in the mouse carotid artery compared with the control group.

[0143] Example 5 Comparison of circSATB2_015 expression levels in peripheral blood of patients with coronary heart disease and those without coronary heart disease

[0144] 5.1 General Information

[0145] Twenty patients with coronary heart disease (CAD group) admitted to a tertiary hospital in Shanghai from August to September 2024 and 25 patients without coronary heart disease (Non-CAD group) admitted to the hospital during the same period were selected, and all were confirmed by DSA examination. CAD diagnostic criteria: Coronary angiography showed that the degree of stenosis of any of the three major blood vessels of the heart (left anterior descending coronary artery, left circumflex coronary artery, right coronary artery) exceeded 80%. Non-CAD inclusion criteria: Coronary angiography showed that there was no obvious stenosis in the three major blood vessels of the heart. All subjects signed informed consent.

[0146] 5.2 Clinical blood sample collection method

[0147] 5 ml of fasting venous blood from all patients in the morning was collected using EDTA anticoagulant tubes, and the plasma was separated by centrifugation at 2000 g at 4°C and frozen at -80°C for future use.

[0148] 5.3 Extraction of plasma total RNA using Trizol method

[0149] RNA method is the same as in Example 1

[0150] 5.4 Detection method of plasma circSATB2_015 expression level

[0151] The RNA reverse transcription reaction and real-time fluorescence quantitative PCR method are the same as in Example 1

[0152] 5.5 Results

[0153] Quantitative PCR results showed that the relative expression level of circSATB2_015 in the peripheral blood of CAD patients was significantly lower than that of the Non-CAD group ( Figure 6 A, P < 0.001). The relative expression levels of circSATB2_015 in the peripheral blood of CAD and Non-CAD patients were entered into SPSS26.0 software, and the ROC curve analysis function was used to obtain the ROC curve and AUC value of the relative expression level of circSATB2_015 in the peripheral blood to distinguish CAD and Non-CAD. The results are shown in Figure 6 B. When LncRNA-ITGA2 was used to diagnose the difference between patients with coronary heart disease and normal people, the area under the ROC curve was 0.858, and the 95% CI was (0.742-0.974) (P < 0.001). The analysis results suggest that the relative expression level of circSATB2_015 in peripheral circulating blood has important clinical application value in improving the early diagnosis of coronary heart disease.

[0154] The following are application examples based on circular noncoding RNA-circSATB2_015:

[0155] Example 1: Early diagnosis of vascular proliferative diseases

[0156] In hospitals or diagnostic laboratories, patient blood samples are screened using a kit that detects the expression of RNA-circSATB2_015. The kit contains specific primers that can detect the expression level of RNA-circSATB2_015. When abnormal expression of RNA-circSATB2_015 is detected by quantitative PCR technology, patients at high risk of coronary atherosclerotic heart disease can be identified early, providing a basis for early intervention.

[0157] The preferred embodiments of the present invention have been specifically described above, but the present invention is not limited to the embodiments. Those skilled in the art may make various equivalent modifications or substitutions without violating the spirit of the present invention. These equivalent modifications or substitutions are all included in the scope defined by the claims of this application.

Claims

1. Use of a reagent for detecting the expression of circular noncoding RNA-circSATB2_015 in the preparation of a kit for diagnosing vascular proliferative diseases, characterized in that: This reagent provides support for the detection of coronary atherosclerotic heart disease through the specific detection of RNA-circSATB2_015.

2. The use according to claim 1, characterized in that: The reagent for detecting the expression amount of circular non-coding RNA-circSATB2_015 comprises primers with detection specificity, and the primer sequences are shown in SEQ ID NO.2 and SEQ ID NO.3, which are used to identify the specific expression of RNA-circSATB2_015.

3. A diagnostic kit for vascular proliferative diseases, characterized in that: It comprises a reverse transcription system, a primer system and an amplification system, wherein the primer sequences of the primer system are shown as SEQ ID NO.2 and SEQ ID NO.

3.

4. Use of circular non-coding RNA-circSATB2_015 recombinant expression vector in the preparation of drugs for vascular proliferative diseases.

5. The use according to claim 4, characterized in that: The vascular proliferative diseases include coronary atherosclerotic heart disease, pulmonary hypertension, hypertension and restenosis after angioplasty. The drug is selected from small interfering RNA of RNA-circSATB2_015 or a recombinant expression vector of RNA-circSATB2_015, The nucleic acid sequence of the RNA-circSATB2_015 is shown in SEQ ID NO.

1.

6. Use of RNA-circSATB2_015 recombinant expression vector in the preparation of drugs for vascular proliferative diseases.

7. The use according to claim 6, characterized in that The RNA-circSATB2_015 recombinant expression vector includes an expression vector and an RNA-circSATB2_015 nucleic acid molecule inserted into the expression vector. The nucleic acid sequence of the RNA-circSATB2_015 is shown in SEQ ID NO.

1.

8. The use according to claim 7, characterized in that The expression vector is a plasmid vector or a viral vector.

9. The use according to claim 8, characterized in that The viral vector is selected from adenovirus and adeno-associated virus, lentivirus, coxsackie virus, herpes simplex virus, measles virus, Newcastle disease virus, parvovirus, poliovirus, reovirus, vaccinia virus or vesicular stomatitis virus.

10. A pharmaceutical composition for treating vascular proliferative diseases, characterized in that: The pharmaceutical composition comprises an active ingredient and a pharmaceutically acceptable excipient. Wherein, the active component is the RNA-circSATB2_015 described in claim 4 or 5 or the RNA-circSATB2_015 recombinant expression vector described in any one of claims 6 to 9.

Images