Universal primer pair and kit for helicobacter bacteria amplification and application of universal primer pair and kit

Abstract

The invention discloses a universal primer pair for helicobacter bacteria amplification, a kit and application of the universal primer pair and the kit. The universal primer pair for amplification of the helicobacter bacteria comprises a primer pair 23SS-F1 and a primer pair 23SS-R1, wherein the nucleotide sequences of the primer pair 23SS-F1 and the primer pair 23SS-R1 are as shown in SEQ ID NO. 1 and SEQ ID NO. 2. The invention innovatively provides a universal primer pair based on conserved gene 23S rRNA (ribosomal Ribonucleic Acid) for helicobacter specificity, the helicobacter bacteria in sample DNA (Deoxyribose Nucleic Acid) are amplified, and a specific helicobacter strain can be obtained by combining sequencing and sequence analysis. The universal primer pair provided by the invention can better amplify the target gene DNA, avoids the defects of low efficiency, complex operation, high cost and the like when a single primer pair is adopted to amplify each helicobacter bacterium, and is suitable for large-scale sample detection.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a universal primer pair, a kit and application thereof for amplifying Helicobacter bacteria. Background Art

[0002] Helicobacter is a type of microorganism widely found in nature and in the human digestive tract. It belongs to the ε-Proteobacteria, Campylobacterales, and Helicobacteraceae families under the phylum Proteobacteria. More than 30 different species have been confirmed in this genus, including but not limited to Helicobacter pylori (H. pylori), Helicobacter bizzozeronii, Helicobacter canis, Helicobacter canadensis, Helicobacter cinaedi, Helicobacter felis, Helicobacter pullorum, Helicobacter winghamensis, and Helicobacter felis. Among the Helicobacter species closely related to human health, Helicobacter pylori is undoubtedly the most significant and common pathogen, which is closely related to digestive tract diseases such as gastric cancer, iron deficiency anemia, chronic gastritis, and chronic atrophic gastritis, and is also related to some extragastric diseases, including biliary tract infection, atherosclerosis, urticaria, etc. However, other species such as Helicobacter bieneusi, Helicobacter canis, Helicobacter canadensis, Helicobacter homosexualis and Helicobacter felis have also been found to be associated with human infection, although their prevalence or pathogenicity may be relatively low. The study of these species is of great significance for understanding human gastrointestinal diseases and their prevention and treatment strategies.

[0003] Helicobacter bacteria are Gram-negative bacteria that grow slowly and are extremely demanding on nutritional conditions. They must grow in a specific environment. The biochemical reactions of Helicobacter bacteria are not active, and there are currently no commercial identification reagent strips or kits specifically for this genus on the market. Because the culture conditions of Helicobacter bacteria are harsh, the operation is complicated, the positive detection rate is low and the cost is high, molecular biological detection has the advantages of high sensitivity, strong specificity, rapidity and non-invasive or minimally invasive, providing a powerful tool for the classification, typing and identification of Helicobacter. Polymerase chain reaction (PCR) is one of the most widely used molecular diagnostic techniques for the detection of various pathogens, including bacteria, viruses, fungi and parasites. By designing specific primers for the conserved sequences of Helicobacter, PCR can quickly detect Helicobacter bacteria, greatly improving the efficiency and accuracy of diagnosis.

[0004] Except for Helicobacter pylori, the infection rate of other Helicobacter bacteria in the human body is low. If each Helicobacter bacteria is tested, the cost will be high and it will be difficult to popularize the test in clinical practice. Therefore, a detection kit based on Helicobacter-specific universal primers is designed and developed to realize a detection method for identifying multiple Helicobacter bacteria at one time, avoiding the missed detection of various Helicobacter species. Summary of the invention

[0005] In order to identify multiple Helicobacter bacteria at one time, the present invention provides a universal primer pair for amplifying Helicobacter bacteria, including primer pairs 23SS-F1 and 23SS-R1 with nucleic acid sequences as shown in SEQ ID NO.1 and SEQ ID NO.2.

[0006] The present invention also provides a kit for detecting Helicobacter bacteria, comprising the universal primer pair for amplifying Helicobacter bacteria as described above.

[0007] In some embodiments, the kit for detecting Helicobacter bacteria further comprises a probe with a nucleic acid sequence as shown in SEQ ID NO. 5 and / or SEQ ID NO. 17. The probe is fluorescently labeled.

[0008] In some embodiments, the kit for detecting Helicobacter bacteria also includes a primer pair for NGS detection; the primer pair for NGS detection includes a primer pair for the first round of PCR and a primer pair for the second round of PCR; the primer pair for the first round of PCR is a nucleic acid fragment that adds a first sequencing adapter sequence to the 5' end of 23SS-F1 and a nucleic acid fragment that adds a second sequencing adapter sequence to the 5' end of 23SS-R1, and the length of each primer is 50-55bp; the primer pair for the second round of PCR is a nucleic acid fragment that adds P5 and index to the 5' end of the first sequencing adapter sequence and a nucleic acid fragment that adds P7 and index to the 5' end of the second sequencing adapter sequence, and the length of each primer is 60-80bp, wherein the index is used to distinguish different samples of the same NGS.

[0009] In some embodiments, the primer pair for the first round of PCR is a nucleotide fragment as shown in SEQ ID NO. 13 and SEQ ID NO. 14. The primer pair for the second round of PCR is a nucleotide fragment as shown in SEQ ID NO. 15 and SEQ ID NO. 16, wherein the fully degenerate base N is any one selected from A, G, C and T.

[0010] The present invention also provides the use of the universal primer pair for amplifying Helicobacter bacteria as described above in detecting Helicobacter bacteria. In other words, the present invention also provides a method for detecting Helicobacter bacteria, which uses the universal primer pair for amplifying Helicobacter bacteria as described above for detection.

[0011] In some embodiments, the application is to apply the universal primer pair for amplification of Helicobacter bacteria to one or more of common PCR, quantitative PCR and NGS detection techniques, thereby achieving detection of Helicobacter bacteria.

[0012] In some embodiments, the using comprises the following steps:

[0013] Step 1: Using the universal primer pair for amplifying Helicobacter bacteria as primers, PCR detection is performed on the sample to be tested. If a nucleic acid fragment can be amplified, it indicates that the sample to be tested contains Helicobacter bacteria.

[0014] In some embodiments, the use further comprises the following steps:

[0015] Step 2: Sequence the nucleic acid fragment amplified in step 1, and determine the type of Helicobacter by Blast comparison.

[0016] In some embodiments, the sequencing in step 2 is performed by NGS sequencing, and a kit including a universal primer pair for amplification of Helicobacter bacteria and a primer pair for NGS detection is used to perform Helicobacter bacteria detection and NGS sequencing.

[0017] In some embodiments, the using comprises the following steps:

[0018] Step 1', using the universal primer pair for amplifying Helicobacter bacteria as primers, using the nucleic acid fragment labeled with a fluorescent group as a probe, and performing qPCR detection on the sample to be tested. If the Ct value is <40, <39, <38, or <37, it means that the sample to be tested contains Helicobacter bacteria. Further, according to the parameters and performance of the detection system, set the Ct value <40, <39, <38, or <37 as the judgment value to determine whether the test sample contains Helicobacter bacteria.

[0019] The present invention innovatively proposes a universal primer pair specific to Helicobacter based on the conserved gene 23S rRNA, that is, the universal primer pair for amplifying Helicobacter bacteria as described above, which amplifies Helicobacter bacteria in sample DNA, and can be combined with sequencing and sequence analysis to obtain specific Helicobacter species. In addition, 23S rRNA is a double-copy gene in Helicobacter, which can effectively improve the detection rate of Helicobacter bacteria.

[0020] The beneficial effects of the present invention include:

[0021] 1. The primer design method adopted in the present invention is designed based on homology analysis of 23S rRNA sequences of common bacteria such as Helicobacter and Enterobacter, Staphylococcus, Streptococcus, Campylobacter, Pseudomonas, Prevotella, Bacteroides, Bacteroides, and Peptostreptococcus, which can better design primers and probes in the common conserved gene sequence region of Helicobacter, avoiding nonspecific amplification and false positive and false negative results.

[0022] 2. The universal primer pair provided by the present invention can better identify Helicobacter bacteria and identify the species based on the base sequence differences in the amplified region. Therefore, different Helicobacter bacteria can also be typed based on the differences in internal sequences.

[0023] 3. The universal primer pair provided by the present invention can better amplify the target gene DNA, avoiding the disadvantages of low efficiency, complex operation and high cost of amplifying each Helicobacter bacteria using a single primer pair, and is suitable for the detection of large-scale samples.

[0024] 4. The universal primer pair provided by the present invention makes the Helicobacter bacteria amplification and identification method have the advantage of high sensitivity, and can detect complex samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solution of the present invention, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments or comparative examples of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the results shown in these drawings without paying any creative work.

[0026] Figure 1 It is a schematic diagram of the process of research and development of the present invention.

[0027] Figure 2A It is the nucleotide sequence position of the upstream primer 23SS-F1 in the selected Helicobacter 23S rRNA gene of the designed primer sequence in Example 1 of the present invention.

[0028] Figure 2B It is the nucleotide sequence position of the downstream primer 23SS-R1 of the designed primer sequence in the selected Helicobacter 23S rRNA gene in Example 1 of the present invention.

[0029] Figure 3This is the electrophoresis pattern obtained by using 23SS-F1 and 23SS-R1 primer pairs with 4 Helicobacter pylori strains and 4 non-Helicobacter pylori genomes as templates in Example 2 of the present invention: M is Marker, 1-4 are Helicobacter pylori, 5-8 are Streptococcus pneumoniae ATCC6305, Pseudomonas aeruginosa ATCC27853, Escherichia coli ATCC25922, and Staphylococcus aureus ATCC25923, respectively.

[0030] Figure 4A The Helicobacter pylori genomic DNA extracted in Example 2 was used as a template to test the effect of the probe primer combination formed by the Helicobacter probe 1, 23SS-F1 and 23SS-R1 primer pair on fluorescent quantitative PCR.

[0031] Figure 4B The Helicobacter pylori genomic DNA extracted in Example 2 was used as a template to test the effect of the probe primer combination formed by the Helicobacter probe 2, 23SS-F1 and 23SS-R1 primer pair on fluorescent quantitative PCR.

[0032] Figure 4C The non-Helicobacter pylori extracted in Example 2 was used as a template to test the effect of the probe primer combination formed by the Helicobacter probe 1 and the Helicobacter probe 2 and the 23SS-F1 and 23SS-R1 primer pairs on fluorescent quantitative PCR.

[0033] Figure 5A These are the results of fluorescent quantitative PCR in Example 3 of the present invention, using gastric mucosal tissue DNA of 20 Helicobacter pylori-positive patients as templates.

[0034] Figure 5B This is the result of fluorescent quantitative PCR in Example 3 of the present invention, using 2 samples of water as templates and as positive and negative quality controls.

[0035] Fig. 6A The fluorescence quantitative PCR results of 100 samples (parts) that were negative for Helicobacter pylori by breath test and negative by first-generation sequencing in Example 3 of the present invention are selected. That is, the fluorescence quantitative PCR results of 100 gastric mucosal DNA samples that were negative for Helicobacter pylori by first-generation sequencing, Helicobacter pylori culture identification, and pathological test results.

[0036] Figure 6B These are the fluorescence quantitative PCR results of 3 samples with FAM signal peaks among the 100 samples in Example 3.

[0037] Figure 7This is the gel electrophoresis diagram after nested PCR of the sample and negative control that are positive for Helicobacter genus as shown by qPCR experimental results in Example 3 of the present invention, A is the result of the first round of PCR amplification, B is the result of the second round of PCR amplification, wherein M is Marker, 1 is the negative control, and 2-4 are Helicobacter genus positive samples.

[0038] Figure 8 In Example 3 of the present invention, samples that were positive for Helicobacter spp. by qPCR were subjected to nested PCR and sequence Blast showed that one of them was Helicobacter felis.

[0039] Fig. 9A This is a fragment distribution quality inspection diagram of some library samples in Example 4 of the present invention, which is a sample that failed the quality inspection and had no obvious fragments.

[0040] Fig. 9B This is a fragment distribution quality inspection diagram of some library samples in Example 4 of the present invention, which is a sample that has passed the quality inspection and has correct and uniform fragment distribution.

[0041] Fig.10 It is the IGV visualization display of the bam file of the Helicobacter library sequencing results after the NGS library construction is completed in Example 4 of the present invention. In IGV, the comparison of the genome sequencing data is viewed through the imported bam file, and the base variation of the sequencing data and the reference genome can be observed through the comparison results. When there is an inconsistency in the aligned bases of the two, these variations are usually represented by different colors. IGV can also display the depth of sequencing coverage, that is, the number of sequencing reads at each position. By observing the sequencing depth, the uniformity and coverage of the sequencing can be evaluated, thereby judging the quality of the sequencing data. DETAILED DESCRIPTION

[0042] In order to make the technical means, creative features, objectives and effects of the invention easier to understand, the invention is further described below with reference to specific diagrams. However, the invention is not limited to the following implementation cases.

[0043] At the same time, the terms such as "upper", "lower", "left", "right" and "one" cited in this specification are only for the convenience of description and are not used to limit the scope of implementation of the present invention. Changes or adjustments to their relative relationships should be regarded as the scope of implementation of the present invention without substantially changing the technical content.

[0044] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0045] Unless otherwise specified, the experimental methods used in the examples are all conventional methods. Unless otherwise specified herein, nucleic acid sequences are shown from the 5' end to the 3' end.

[0046] Unless otherwise specified, the materials used in the examples can be obtained from commercial sources.

[0047] The effects of the universal primers, kit and method for detecting Helicobacter genus of the invention are studied below through specific examples. The development process is generally as follows: Figure 1 As shown, firstly, the 23S rRNA gene sequences of various Helicobacter and Enterobacter were compared, and Helicobacter-specific universal primers were designed based on the 23S rRNA gene sequences. The primer specificity was verified by comparison on the Blast website, and the primer amplification effect was verified by first-generation sequencing and fluorescent quantitative PCR. Finally, the amplicon NGS sequencing was used to identify the Helicobacter species.

[0048] Example 1. Design and verification of primers

[0049] 1. Reference sequence 23S rRNA gene sequence introduction

[0050] DNA STAR software was used to perform homology analysis on the 23S rRNA sequences of various common bacteria such as Helicobacter, Enterobacter, Staphylococcus, Streptococcus, and Pseudomonas in NCBI. The Helicobacter species introduced by this method are as follows:

[0051] Helicobacter acinonychis, Helicobacter ailurogastricus, Helicobacteranatolicus, Helicobacter anseris, Helicobacter apodemus, Helicobacter apri, Helicobacter aurati, Helicobacter baculiformis, Helicobacter bilis, Helicobacter bizzozeronii, Helicobacter brantae, Helicobacter burdigaliensis, Helicobacter callitrichis, Helicobacter canadensis, Helicobacter canicola, Helicobacter canis, Helicobacter cappadocius, Helicobacter cetorum, Helicobacter cholecystus, Helicobacter cinaedi, Helicobacter colisuis, Helicobacter cynogastricus, Helicobacter delphinicola, Helicobacter didelphidarum, Helicobacter enhydrae, Helicobacter equorum, Helicobacter felis, Helicobacter fennelliae, Helicobacterheilmannii, Helicobacter higonensis, Helicobacter himalayensis, Helicobacter ibis, Helicobacter jaachi, Helicobacter japonicus, Helicobacter kayseriensis, Helicobacter kumamotonensis, Helicobacter labacensis, Helicobacter labetoulli, Helicobacter macacae, Helicobacter magdeburgensis, Helicobacter marmotae, Helicobacter mastomyrinus, Helicobactermehlei, Helicobacter mesocricetorum, Helicobacter monodelphidis, Helicobacter muricola, Helicobacter muridarum, Helicobacter mustelae, Helicobacter pametensis, Helicobacter peregrinus, Helicobacter pullorum, Helicobacter saguini, Helicobacter salomonis, Helicobacter suis, Helicobacter suncus, Helicobacter trogontum, Helicobacterturcicus, Helicobacter tursiopsae, Helicobacter typhlonius, Helicobactervaldiviensis, Helicobacter vulpecula, Helicobacter vulpis, Helicobacterwinghamensis, etc.

[0052] 2. Selection of appropriate sequence region

[0053] The 23S rRNA gene sequences of various Helicobacter bacteria were compared by software DNA STAR, and multiple comparisons were performed to screen out highly conserved common gene regions as amplification targets, and to ensure that there were different base regions in the selected range to facilitate species typing later. The relatively conserved regions for designing universal primers obtained by comparing the Helicobacter sequences. The two regions of the universal primers designed in this embodiment are Figure 2A The 23S rRNA gene in the range of about 1340-1360 bp (boxed area) and Figure 2B The approximately 1520-1540 bp position (boxed area).

[0054] 3. Primer design

[0055] According to the above steps, universal primers are designed for the regions of Helicobacter bacteria that are conserved but different from Enterobacter. Specifically, the conserved sequences obtained by screening are pasted into the primer3-Input website, and after setting the parameters, primer generation is selected.

[0056] 4. Primer specificity verification

[0057] The multiple pairs of primers designed by the website were specifically compared and screened by the Blast website. The present invention specifically relates to a total of 4 pairs of primers involved in specific verification. The results of the specific comparison of all primer pairs by the Blast website show that non-specific comparison genome results appear in two pairs of results, so it is preliminarily believed that these two pairs do not meet the requirements. Then, agarose gel electrophoresis and first-generation sequencing were performed using fecal DNA genome as a template, and then the screening requirements were single electrophoresis bands and clean sequencing peaks. As a result (as shown in Table 1), only one pair of primers met the requirements.

[0058] Table 1 Results of specificity verification primer pairs

[0059]

[0060]

[0061] As described above, a pair of primers 23SS-F1 and 23SS-R1 with the best specificity and sensitivity were obtained, ensuring that the selected primer pair would not cause nonspecific amplification and affect the experimental results as much as possible. All primers and probe sequences described in the examples of the present invention were commissioned to be synthesized by Bio-Tech (Shanghai) Co., Ltd.

[0062] Example 2: Study on the effect of primer amplification by Sanger sequencing

[0063] Step 1: Extraction of genome from gastric mucosal samples of patients infected with Helicobacter pylori

[0064] (1) Four samples of Helicobacter pylori culture fluid and four samples of Streptococcus pneumoniae ATCC6305, Pseudomonas aeruginosa ATCC27853, Escherichia coli ATCC25922, and Staphylococcus aureus ATCC25923 were selected and genomes were extracted using the HiPure Bacterial DNA Kit (D3146-02) from Meiji.

[0065] (2) DNA quality was tested by agarose gel electrophoresis and NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). The samples were qualified if the electrophoresis bands were clear and bright and the A260 / A280 value was between 1.8 and 2.0.

[0066] Step 2: PCR amplification

[0067] The total DNA extracted in step 1 was used as a template, and the primer pair (23SS-F1 and 23SS-R1) designed in Example 1 was used to prepare a PCR reaction system for PCR amplification. The amplification reagent used was 2×TaqMaster Mix of Nanjing Novozymes Biotech Co., Ltd., as shown in Table 2 (the reaction solution should be prepared on ice), and the reaction procedure of PCR amplification is shown in Table 3.

[0068] Table 2 Common PCR reaction system

[0069] Reagents Usage Final concentration 2×Taq Master Mix 25μL 1× Primer1 (10 μM) 2.5μL 0.5μM Primer2 (10 μM) 2.5μL 0.5μM Template DNA (<100ng) 6μL - <![CDATA[RNase-free ddH2O]]> 14μL - Total 50μL -

[0070] Table 3 General PCR reaction program

[0071]

[0072] Step 3: Amplification product determination

[0073] The PCR amplification product obtained in step 2 is subjected to gel electrophoresis. If an obvious and clear DNA band appears in the electrophoresis result and the length of the amplification product is 150-200 bp, the PCR amplification product can be further sequenced and compared.

[0074] The gel electrophoresis results of the 4 Helicobacter pylori strain samples after amplification showed obvious and clear DNA bands, and the length of the amplified product was between 150-200 bp ( Figure 3 Lanes 1-4); however, the gel electrophoresis results of the amplified products of the four samples of Streptococcus pneumoniae ATCC6305, Pseudomonas aeruginosa ATCC27853, Escherichia coli ATCC25922, and Staphylococcus aureus ATCC25923 showed no bands (these four strains correspond to Figure 3 Lanes 5-8). This indicates that the primer pair provided by the present invention can amplify Helicobacter bacteria well while avoiding non-specific amplification of non-Helicobacter bacteria, that is, the designed universal primers 23SS-F1 and 23SS-R1 have good specificity.

[0075] Step 4: Sequencing

[0076] (1) Gel electrophoresis and rubber recovery and purification

[0077] 2% agarose solution was prepared with 1×TAE electrophoresis buffer, 35 μL of the second round amplification product was drawn into the gel well, the gel running voltage was 120 V, and the gel running time was 20 minutes. The PCR product of the cut gel block was purified and recovered using TaKaRaMiniBEST Agarose Gel DNAExtraction Kit Ver.4.0.

[0078] (2) Sequencing reaction

[0079] The sequencing reaction reagent used was BigDye reagent from Thermo Fisher Scientific, and the reaction system and reaction procedure are shown in Tables 4 and 5.

[0080] Table 4 First generation sequencing reaction system

[0081] Reagents volume Purified PCR products 1μL Primer (1uM) 1μL BigDye(2.5×) 0.8μL <![CDATA[ddH2O]]> 7.2 Total 10μL

[0082] Table 5 PCR program for first generation sequencing reaction

[0083]

[0084] (3) Sequencing

[0085] The purified product was used in Applied Biosystems TM Sanger bidirectional sequencing was performed on a 3730XL sequencer. After sequencing, the product sequences in the SEQ format were compared on the NCBI website. The results showed that the sequences of these amplified products were all 23S RNA gene fragments of Helicobacter pylori, and no non-specific comparison results of other bacteria appeared. This result further illustrates the specificity and superiority of the primers.

[0086] Example 3: Establishing a qPCR system for quantitative detection of Helicobacter genus and exploring the amplification effect of Helicobacter genus. This example includes the following steps:

[0087] 1. Design of universal probe for Helicobacter

[0088] As in Example 1, the downloaded Helicobacter sequence was compared with the analysis software. Some conservative sequences were found in the sequence between the upstream primer and the downstream primer, and two probes were designed on the conservative sequence (the positions of the Helicobacter probes were 1420-1440bp and 1390-1410bp, respectively). The one with better capture efficiency will be found through test experiments in the future. In addition, in order to verify the credibility of the experiment and avoid false negative amplification, two primers based on the human gene hemoglobinsubunit beta (HBB) and one probe were designed as internal standards. The sequences of the two primers and three probes are:

[0089] Human internal standard forward primer (HBB-F, SEQ ID NO.8): ACACAACTGTGTTCACTAGC Human internal standard reverse primer (HBB-R, SEQ ID NO.9): CCAACTTCATCCACGTTCACC

[0090] Helicobacter probe 1 (PROBE-23SS1, SEQ ID NO. 5): FAM-GAGCTGTGGATAGGGGTGAA

[0091] Helicobacter probe 2 (PROBE-23SS2, SEQ ID NO. 17): FAM-ACTCGTACCCATTGAAACG

[0092] Human internal standard probe (PROBE-HBB, SEQ ID NO.10): VIC-TGCATCTGACTCCTGAGGA

[0093] 2. Probe Verification

[0094] In order to verify whether the probe and primer combination is usable, we used the primer pair (23SS-F1 and 23SS-R1) obtained in Example 1 and the probe sequence listed in step 1 of this example to perform fluorescence quantitative PCR experiments for verification. In order to select the best one from the two probe sequences, the two probes were tested simultaneously and the results were compared. The amplification reagent used was Hieff qPCR TaqMan ProbeMaster Mix, using the bacterial solution DNA of Helicobacter pylori and the bacterial solution DNA of non-Helicobacter pylori in Example 2 as templates, the reaction system and procedure are shown in Table 6 and Table 7, respectively.

[0095] Table 6 qPCR reaction system

[0096]

[0097] Table 7 qPCR reaction procedure

[0098]

[0099] The detection results are shown in FIG4 . The combination of primers 23SS-F1 and 23SS-R1 and Helicobacter probe 1 can effectively detect Helicobacter pylori, and the Ct value of the FAM channel is about 30 ( Figure 4A ), the results are more stable; although the combination of primers 23SS-F1 and 23SS-R1 with Helicobacter probe 2 can also detect Helicobacter pylori, the Ct value of 1 Helicobacter pylori sample is 36 ( Figure 4B ), and the Ct values ​​of the samples used were different, so it is believed that its capture effect is slightly worse than that of probe 1. The FAM signal channel of the two probes and primers used for non-Helicobacter pylori detection did not peak, indicating that no related products were amplified ( Figure 4C); and since the bacterial samples used did not contain human genes, the internal standard results of the VIC channel did not peak, indicating that the experimental results were reliable and there should be no false negatives. In summary, this combination can effectively detect Helicobacter pylori by fluorescent quantitative PCR, and probe 1 and primers are considered to be the combination with the best amplification and capture effects.

[0100] 3. Clinical sample testing and verification

[0101] 20 samples positive for Helicobacter pylori were selected as positive quality control, and 2 wells with water as template were selected as negative quality control. 100 gastric mucosal DNA samples whose first-generation sequencing, Helicobacter pylori culture identification and pathological test results all showed Helicobacter pylori negative were selected for Helicobacter 2S rRNA quantitative PCR detection. The qPCR reaction system and procedure were the same as those in step 2 of Example 3, and Helicobacter probe 1 (PROBE-23SS1, SEQ ID NO.5) was selected.

[0102] Quantitative PCR data analysis showed that the Ct values ​​of the fluorescent quantitative PCR of 20 Helicobacter pylori-positive samples were distributed between 28 and 34, and the FAM and VIC channels had normal peaks, and there was no missed detection. The same as step 2, indicating that the experimental results of this step are more reliable and there is no false negative result ( Figure 5A ). No peaks appeared in the two wells that added water as a template, and the Ct values ​​were all 0, which also ruled out the possibility of false positives in this experiment ( Figure 5B ). The results of 100 samples with negative results in Helicobacter pylori first-generation sequencing showed that the human internal standards all had normal peaks, further indicating that the possibility of false negatives in this experiment was low ( Fig. 6A At the same time, the FAM channel results of 100 Helicobacter pylori-negative gastric mucosa samples were analyzed. The Helicobacter FAM signal of 3 samples had a peak and the Ct value was around 34. It was preliminarily believed that the Helicobacter genome was present in these 3 samples ( Figure 6B ). Further, according to the parameters and performance of the detection system, a Ct value of <40, <38, or <37 is set as a judgment value to determine whether the test sample contains Helicobacter bacteria.

[0103] 4. Nested PCR + Sanger sequencing verification

[0104] The three samples of DNA that were positive for Helicobacter in the above steps were tested again by nested PCR using the universal primers for Helicobacter designed by the present invention to obtain specific sequence information, and the steps were as follows:

[0105] (1) First round of PCR

[0106] Using the three samples of DNA with positive results in step 3 of Example 3 as templates, and adding one tube of water as a negative control, the PCR reaction system was prepared using the primer pairs 23SS-F1 and 23SS-R1 designed in Example 1, and PCR amplification was performed. The PCR amplification system is shown in Table 8 (please prepare the reaction solution on ice), and the reaction procedure of the PCR amplification is shown in Table 9.

[0107] Table 8 PCR reaction system

[0108]

[0109] Table 9 General PCR reaction program

[0110]

[0111] (2) Second round of PCR

[0112] The amplified product of the first round of PCR was used as a template, and the PCR reaction system was prepared again using the primer pair 23SS-F1 and 23SS-R1 designed in Example 1 to perform the second round of PCR amplification. The PCR amplification system and amplification procedure were the same as those of the first round of PCR.

[0113] (3) Determination of amplification products

[0114] The amplified products obtained from the two rounds of PCR were detected by gel electrophoresis. After the first round of amplification, no obvious amplified bands appeared in the three samples and one water sample ( Figure 7 Lanes 1-4 of A), the reason may be that the sample does not contain Helicobacter genome fragments or the Helicobacter nucleic acid content in the sample is below the detection limit and therefore not detected. After two rounds of amplification, the gel electrophoresis results of the three samples showed obvious and clear DNA bands, and the length of the amplified product was between 150-200bp ( Figure 7 B lanes 2-4), while one water sample showed no bands ( Figure 7 Lane 1 of B) indicates that there is no false positive contamination in the amplification process.

[0115] (4) Sequencing

[0116] The 3 samples with obvious bands in the above steps were recovered by tapping and then sequenced, and the sequencing was the same as step 4 of Example 2.

[0117] After sequencing, the product sequences in the SEQ format file were compared on the NCBI website. The results showed that two of the samples were Helicobacter pylori. The reason may be that the amount of Helicobacter pylori nucleic acid in the two samples was too small, so they were negative in the previous first-generation sequencing, Helicobacter pylori culture identification and pathological detection, and the nested PCR detection limit was lower, so it was detected; the Blast comparison result of the remaining positive sample showed that it was Helicobacterfelis (cat stomach Helicobacter) ( Figure 8 ), proving that the previous experimental verification process was accurate, and also proving that the primers designed by the present invention can amplify the Helicobacter genome other than Helicobacter pylori.

[0118] Example 4: Establishment of an amplicon NGS detection system to explore the reliability of primer amplification results and identify Helicobacter species

[0119] This embodiment includes the following steps:

[0120] 1. First round of PCR

[0121] (1) Design and preparation of forward and reverse universal specific primers

[0122] According to the specific universal primer pair (23SS-F1 and 23SS-R1) obtained in Example 1, a sequencing adapter sequence 1 (read1) and a sequencing adapter sequence 2 (read2)' were added to the 5' end of the primer, as shown in SEQ ID NO.11 and SEQ ID NO.12, respectively, and primer synthesis was performed. The purification method selected HPLC purification, and the structure of the final synthesized upstream primer was Illumina library sequence read1-23SS-F1 primer (abbreviated as read1-23SS-F1) as shown in SEQ ID NO.13 and the structure of the downstream primer was Illumina library sequence read2-23SS-R1 primer (abbreviated as read2-23SS-R1) as shown in SEQ ID NO.14.

[0123] read1(SEQ ID NO.11):ACACTCTTTCCCTACACGACCGCTTCCGATCT

[0124] read2(SEQ ID NO.12): GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

[0125] read1-23SS-F1(SEQ ID NO.13):ACACTCTTTCCCTACACGACCGCTCTTCCGATCT-AGTGATCTATCCATGGCCA

[0126] read2-23SS-R1 (SEQ ID NO.14): GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-AGCCCAATCAGAGCTCTAC

[0127] After centrifuging the synthesized dry powder of each primer at 4000 rpm for 5 minutes, add sterile water 10 times the dilution volume marked on the tube wall to dilute it into a 10 μM stock solution, place it on a vortex shaker to mix it thoroughly, mark the tube body, and let it stand for use.

[0128] (2) First round of PCR

[0129] Transgene 2×TransStareFastPfPCR SuperMix from Beijing Quanshijin Biotechnology Co., Ltd. was used as amplification reagent. 20 Helicobacter pylori-positive samples, 100 gastric mucosal DNA samples that were negative for Helicobacter pylori by first-generation sequencing, Helicobacter pylori culture identification, and pathological examination, and 2 water samples were used as templates. PCR amplification was performed using read1-23SS-F1 and read2-23SS-R1 as primer pairs. The reagent system shown in Table 10 was configured in a 200 μL PCR tube, and the first round of PCR amplification was performed according to the procedure shown in Table 11.

[0130] Table 10 PCR reaction system

[0131] Reagents Usage Final concentration 2×TransStare FastPf PCR SuperMix 25 1X Primer1 (10 μM) 1μL 0.2μM Primer2 (10 μM) 1μL 0.2μM Template DNA (10-500ng) 5μL - <![CDATA[RNase-free ddH2O]]> 13μL - Total 50μL -

[0132] Table 11 PCR reaction program

[0133]

[0134] (3) Purification of the first round of PCR products

[0135] The purified magnetic beads were taken out of the 4°C refrigerator in advance and equilibrated at 25°C for 30 minutes; 40 μL (0.8×) XP magnetic beads (Yisun Biotechnology (Shanghai) Co., Ltd.) were added to the obtained PCR product for purification, and the obtained product was dissolved in 20 μL ddH2O.

[0136] 2. Second round of PCR (library construction)

[0137] (1) Adapter Primer Synthesis

[0138] Based on the Illumina platform amplicon library construction, the library of the Illumina sequencing platform was constructed by PCR, and the structure of the upstream primer was the Illumina library sequence P5-8N-read1 primer (SEQ ID NO.15), and the structure of the downstream primer was shown in the Illumina library sequence P7-8N-read2 primer (SEQ ID NO.16).

[0139] P5-8N-read1(SEQ ID NO.15):AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTA CACGACGCTCTCCGATCT

[0140] P7-8N-read2 (SEQ ID NO.16): CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACG TGTGCTCTTCCGATCT

[0141] The 8 Ns are internal indices used to distinguish different samples in the same sequencing.

[0142] After centrifuging the synthesized dry powder of each primer at 4000 rpm for 5 minutes, add sterile water 10 times the dilution volume marked on the tube wall to dilute it into a 10 μM stock solution, place it on a vortex shaker to mix it thoroughly, mark the tube body, and let it stand for use.

[0143] (2) Second round of PCR

[0144] The second round of PCR was performed using the amplified product of the first round of this example as a template and P5-8N-read1 and P7-8N-read2 as upstream and downstream primers. The reagent system shown in Table 10 was configured in a 200 μL PCR tube, and the second round of PCR amplification was performed according to the procedure shown in Table 12.

[0145] Table 12 PCR reaction program

[0146]

[0147] (3) Purification of the second round of PCR products

[0148] The purified magnetic beads were taken out of the 4°C refrigerator in advance and placed at 25°C for equilibration for 30 minutes; 40 μL of XP magnetic beads were added to the obtained PCR product for purification, and the obtained product was dissolved in 20 μL of XX water.

[0149] 3. Library analysis

[0150] (1) Library quantification: The Qubit 4.0 dsDNA high sensitivity kit was used for library quantification. The library concentration was considered qualified if it was greater than 3 ng / μL.

[0151] (2) Fragment analysis: The library fragment distribution was analyzed using the Agilent 4200 instrument, and the main peak was around 300-350 bp, which was considered qualified.

[0152] After two rounds of amplification, 20 samples known to be positive for Helicobacter pylori all met the library quality inspection requirements, and only 3 of the 100 samples met the library quality inspection requirements. After comparison, it was found that these 3 samples were also the 3 samples with peaks in the fluorescence quantitative PCR experiment in Example 3. The concentrations of the 2 negative quality control samples were all below the detection limit. This result also shows that there are no false negatives and false positives in this experiment. The distribution diagram of 4200 quality inspection fragments of some samples is shown in Figure 9, where A is a quantitative concentration below the detection limit and no obvious fragments exist, and B is a sample that has passed the library quality inspection, and the library fragments are mainly concentrated around 340bp.

[0153] 4. Sequencing

[0154] All products obtained from the three qualified samples in the above steps were standardized and mixed in equal amounts, and the mixed libraries were sequenced in parallel using the sequencing platform Novasek 6000 and the sequencing type PE150.

[0155] 5. Data Analysis

[0156] After sequencing is completed, the data is obtained and bioinformatics analysis is performed on the data. The analysis steps include filtering the adapter primer sequence, alignment and other basic steps. The Helicobacter pylori CP003904.1 genome is used as the reference genome for sequencing data comparison analysis. The GATK software performs mutation analysis on the target site. The final results are manually analyzed with the IGV software. The sequence of the target amplification product site is as follows: Fig.10 shown. Fig.10It can be seen that there are only a small number of irregular variations, indicating that the sequencing data basically conforms to the aligned genome sequence, and the number of reads also meets the requirements. The aligned sequences were copied to the Blast website for species comparison analysis. Among the three samples that were negative for Helicobacter pylori by first-generation sequencing but showed the presence of the Helicobacter genome by fluorescent quantitative PCR and NGS, the comparison results of two samples also showed Helicobacter pylori. The reason for the analysis may be that the number of Helicobacter pylori nucleic acids in the sample is small, lower than the detection limit of first-generation sequencing, and because fluorescent quantitative PCR and NGS detection are more sensitive, it was detected; the comparison result of another case showed that it was indeed Helicobacter felis in the Helicobacter genus, and the number of reads was greater than 50, indicating that the result was true and reliable. And by comparing with the nested PCR in Example 3, it was found that the species identification of the sequencing results of the three samples was consistent, indicating that the experimental method provided by the present invention is stable and reliable, and has a high degree of credibility.

[0157] The preferred specific embodiments of the present invention are described in detail above. It should be understood that ordinary technicians in the field can make many modifications and changes based on the concept of the present invention without creative work. Therefore, all technical solutions that can be obtained by technicians in the technical field based on the concept of the present invention through logical analysis, reasoning or limited experiments on the basis of the prior art should be within the scope of protection determined by the claims.

Claims

1. A universal primer pair for amplification of Helicobacter bacteria, characterized in that: The invention comprises a primer pair 23SS-F1 and 23SS-R1, the nucleic acid sequences of which are shown as SEQ ID NO.1 and SEQ ID NO.

2.

2. A kit for detecting Helicobacter bacteria, characterized in that: The invention comprises the universal primer pair for amplifying Helicobacter bacteria as claimed in claim 1.

3. The kit for detecting Helicobacter bacteria according to claim 2, characterized in that Also included are probes whose nucleic acid sequences are shown as SEQ ID NO.5 and / or SEQ ID NO.

17.

4. The kit for detecting Helicobacter bacteria according to claim 2, characterized in that It also includes primer pairs for NGS detection; the primer pairs for NGS detection include primer pairs for the first round of PCR and primer pairs for the second round of PCR; the primer pairs for the first round of PCR are nucleic acid fragments that add a first sequencing adapter sequence to the 5' end of 23SS-F1 and a nucleic acid fragment that adds a second sequencing adapter sequence to the 5' end of 23SS-R1, and the length of each primer is 50-55bp; the primer pairs for the second round of PCR are nucleic acid fragments that add P5 and index to the 5' end of the first sequencing adapter sequence and a nucleic acid fragment that adds P7 and index to the 5' end of the second sequencing adapter sequence, and the length of each primer is 60-80bp, wherein the index is used to distinguish different samples of the same NGS.

5. Use of the universal primer pair for amplification of Helicobacter bacteria as claimed in claim 1 in detection of Helicobacter bacteria.

6. The use according to claim 5, characterized in that The universal primer pair for amplifying Helicobacter bacteria is applied to one or more of common PCR, quantitative PCR and NGS detection techniques, thereby realizing the detection of Helicobacter bacteria.

7. The use according to claim 5, characterized in that The following steps are involved: Step 1: Using the universal primer pair for amplifying Helicobacter bacteria as primers, PCR detection is performed on the sample to be tested. If a nucleic acid fragment can be amplified, it indicates that the sample to be tested contains Helicobacter bacteria.

8. The use according to claim 7, characterized in that The following steps are also included: Step 2: Sequence the nucleic acid fragment amplified in step 1, and determine the type of Helicobacter by Blast comparison.

9. The use according to claim 8, characterized in that The sequencing in step 2 adopts NGS sequencing, and the kit as described in claim 4 is used to perform Helicobacter bacteria detection and NGS sequencing.

10. The use according to claim 5, characterized in that The following steps are involved: Step 1', using the universal primer pair for amplifying Helicobacter bacteria as primers and the nucleic acid fragment labeled with a fluorescent group as shown in SEQ ID NO.5 and / or SEQ ID NO.17 as a probe, perform qPCR detection on the sample to be tested. If the Ct value is less than 40, it means that the sample to be tested contains Helicobacter bacteria.

Images