Multiplex PCR (Polymerase Chain Reaction) detection primer combination and kit for detecting porcine respiratory diseases

Abstract

The invention provides a multiplex PCR (Polymerase Chain Reaction) detection primer combination and a kit for detecting porcine respiratory diseases, and relates to the technical field of biological detection. The multiplex PCR detection primer combination can be used for simultaneously detecting three main pathogenic bacteria of porcine respiratory tracts including porcine actinobacillus pleuropneumoniae, pasteurella multocida and streptococcus suis, has negative amplification results on genomes of escherichia coli, staphylococcus aureus, salmonella, proteus mirabilis and haemophilus parasuis, and has relatively high specificity. Meanwhile, the minimum detection amount of actinobacillus pleuropneumoniae, pasteurella multocida and streptococcus suis is only 10pg / mu L, and the sensitivity is good. Therefore, the multiplex PCR detection primer combination has the characteristics of economy, rapidness, high efficiency, strong specificity and good sensitivity, and can be used for rapidly detecting the main pathogenic bacteria of the porcine respiratory tract.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to a multiplex PCR detection primer combination and a kit for detecting porcine respiratory diseases. Background Art

[0002] Actinobacillus pleuropneumoniae (APP), Pasteurella multocida (Pm) and Streptococcus suis (SS) are the main bacterial pathogens that cause porcine respiratory diseases. They can infect pigs at different stages of growth and development, and often cause co-infection or secondary infection.

[0003] The current mainstream multiplex PCR detection technology for these three pathogens is designed based on the principle of pathogen-specific gene sequence amplification. For example, many tests currently design primers for 16SrDNA. Although 16SrDNA is highly conserved, the homology of 16SrDNA in different bacteria is high, which is prone to false positives. At the same time, from the existing research, the design of some specific primers has not been widely verified, and there may be a risk of non-specific amplification. In addition, the multiplex PCR detection methods used in some research reports lack systematic verification and evaluation of key indicators such as the specificity, sensitivity, and repeatability of the detection system, which to a certain extent limits the accuracy and reliability of the test results.

[0004] In view of this, the present invention is proposed. Summary of the invention

[0005] The purpose of the present invention is to provide a multiplex PCR detection primer combination and a kit for detecting porcine respiratory diseases. The multiplex PCR detection primer combination is economical, fast, efficient, highly specific and sensitive, and can be used to quickly detect major pathogens of the porcine respiratory tract.

[0006] In order to achieve the above-mentioned purpose of the present invention, the following technical solutions are particularly adopted:

[0007] The present invention provides a multiplex PCR detection primer combination for detecting porcine respiratory diseases, wherein the detection primer combination consists of a first primer pair, a second primer pair and a third primer pair;

[0008] The first primer pair consists of an upstream primer having a base sequence shown in SEQ ID NO.1 and a downstream primer having a base sequence shown in SEQ ID NO.2;

[0009] The second primer pair consists of an upstream primer having a base sequence shown in SEQ ID NO.3 and a downstream primer having a base sequence shown in SEQ ID NO.4;

[0010] The third primer pair consists of an upstream primer having a base sequence shown in SEQ ID NO.5 and a downstream primer having a base sequence shown in SEQ ID NO.6.

[0011] Further, the detection target gene of the first primer pair is the apxIVA gene, and the size of the primer amplification product is 882 bp;

[0012] Furthermore, the detection target gene of the second primer pair is the kmt1 gene, and the size of the primer amplification product is 628 bp;

[0013] Furthermore, the detection target gene of the third primer pair is the gdh gene, and the size of the primer amplification product is 410 bp.

[0014] The present invention provides a method for detecting respiratory diseases in pigs, comprising the following steps:

[0015] DNA of the pig respiratory tract sample to be tested is extracted as a template, the DNA is amplified using the first primer pair, the second primer pair and the third primer, and the product is subjected to electrophoresis detection and analysis after the amplification.

[0016] Furthermore, the DNA amplification is PCR amplification, and the reaction system of the PCR amplification is:

[0017] 2×Taq Master Mix 12.5μL; first primer pair 0.5μL; second primer pair 0.5μL; third primer pair 2μL; Actinobacillus pleuropneumoniae genomic DNA 1μL; Pasteurella multocida genomic DNA 1μL; Streptococcus suis genomic DNA 1μL; ddH2O 0.5μL.

[0018] Furthermore, the electrophoresis detection analysis is agarose gel electrophoresis analysis.

[0019] Furthermore, the electrophoresis detection and analysis method includes:

[0020] If a band of 882 bp appears in the DNA of the pig respiratory tract sample to be tested, the sample is infected with Actinobacillus pleuropneumoniae;

[0021] If a 628 bp band appears in the DNA of the pig respiratory tract sample to be tested, the sample is infected with Pasteurella multocida;

[0022] If a 410 bp band appears in the DNA of the pig respiratory tract sample to be tested, the sample is infected with Streptococcus suis.

[0023] The present invention provides a kit comprising the above-mentioned multiplex PCR detection primer combination for detecting porcine respiratory diseases.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The above-mentioned multiplex PCR detection primer combination provided by the present invention can simultaneously detect three major pathogenic bacteria of the respiratory tract of pigs, namely Actinobacillus pleuropneumoniae, Pasteurella multocida, and Streptococcus suis, and the detection products are located between different Maker bands, and the results are clear. The amplification results of the genomes of Escherichia coli, Staphylococcus aureus, Salmonella, Proteus mirabilis, and Haemophilus parasuis are negative, with high specificity. At the same time, the minimum detection amount of Actinobacillus pleuropneumoniae, Pasteurella multocida, and Streptococcus suis is only 10pg / μL, with good sensitivity. Therefore, the multiplex PCR detection primer combination of the present application is economical, fast, efficient, highly specific, and highly sensitive, and can be used to quickly detect the main pathogenic bacteria of the respiratory tract of pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0027] Figure 1 The electrophoresis result diagram of single PCR amplification of porcine Actinobacillus pleuropneumoniae, Pasteurella multocida, and Streptococcus suis by the multiplex PCR detection primer combination provided in Example 1 of the present invention;

[0028] Figure 2 This is a graph showing the optimization results of the annealing time for the multiplex PCR amplification reaction provided in Example 1 of the present invention;

[0029] Figure 3 This is a graph showing the optimization results of the annealing temperature for the multiplex PCR amplification reaction provided in Example 1 of the present invention;

[0030] Figure 4 A graph showing the optimization results of amplification of different cycles of a multiplex PCR amplification reaction provided in Example 1 of the present invention;

[0031] Figure 5 A graph showing the specificity test results of the multiplex PCR detection primer combination provided in Example 1 of the present invention;

[0032] Figure 6This is a sensitivity test result diagram of the multiplex PCR detection primer combination provided in Example 1 of the present invention. DETAILED DESCRIPTION

[0033] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0034] According to one aspect of the present invention, the present invention provides a multiplex PCR detection primer combination for detecting porcine respiratory diseases, the multiplex PCR detection primer combination comprising:

[0035] (A) A primer set for detecting Actinobacillus pleuropneumoniae, comprising: an upstream primer as shown in SEQ ID NO.1, and a downstream primer as shown in SEQ ID NO.2;

[0036] The specific sequence of SEQ ID NO.1 is as follows: 5'-TGATAATCCCTTAGCCCCT-3'.

[0037] The specific sequence of SEQ ID NO.2 is as follows: 5'—ATGGAGATGGGCTTGAAAC—3'.

[0038] (B) A primer set for detecting Pasteurella multocida, comprising: an upstream primer as shown in SEQ ID NO.3, and a downstream primer as shown in SEQ ID NO.4;

[0039] The specific sequence of SEQ ID NO.3 is as follows: 5'—TGCTCTATCCGCTATTTACCC—3'.

[0040] The specific sequence of SEQ ID NO.4 is as follows: 5'—TGACGGCTAACATCATCATCC—3'.

[0041] (C) A primer set for detecting Streptococcus suis, comprising: an upstream primer as shown in SEQ ID NO.5 and a downstream primer as shown in SEQ ID NO.6.

[0042] The specific sequence of SEQ ID NO.5 is as follows: 5'-AGGCGTTTGTATTGACCGT-3'.

[0043] The specific sequence of SEQ ID NO.6 is as follows: 5'-ATCTTGGCCCGTATTGTTG-3'.

[0044] The above-mentioned multiple PCR detection primer combination provided by the present invention can simultaneously detect three major pathogenic bacteria of the respiratory tract of pigs, namely Actinobacillus pleuropneumoniae, Pasteurella multocida, and Streptococcus suis, and the amplification results of the genomes of Escherichia coli, Staphylococcus aureus, Salmonella, Proteus mirabilis, and Haemophilus parasuis are negative, and have high specificity. At the same time, the minimum detection amount of Actinobacillus pleuropneumoniae, Pasteurella multocida, and Streptococcus suis is only 10pg / μL, and the sensitivity is good. Therefore, the multiple PCR detection primer combination of the present application is economical, fast, efficient, highly specific, and highly sensitive, and can be used to quickly detect the main pathogenic bacteria of the respiratory tract of pigs.

[0045] In a preferred embodiment of the present invention, the primer set for detecting Actinobacillus pleuropneumoniae has a detection target gene of apxIVA gene, and the size of the primer amplification product is 882 bp.

[0046] In a preferred embodiment of the present invention, the primer set for detecting Pasteurella multocida has a detection target gene of kmt1 gene, and the size of the primer amplification product is 628 bp.

[0047] In a preferred embodiment of the present invention, the target gene of the primer set for detecting Streptococcus suis is the gdh gene, and the size of the primer amplification product is 410 bp.

[0048] As a preferred embodiment, the above-mentioned detection target gene of the present application is obtained through long-term research and experiments. The apxIVA, kmt1, and gdh genes are specific genes of porcine Actinobacillus pleuropneumoniae, Pasteurella multocida, and Streptococcus suis, respectively. In particular, the selection of the apxIVA gene is only expressed in pigs and has better conservation and specificity.

[0049] According to one aspect of the present invention, a multiplex PCR detection kit for porcine Actinobacillus pleuropneumoniae, Pasteurella multocida and Streptococcus suis comprises the multiplex PCR detection primer combination.

[0050] In a preferred embodiment of the present invention, the reaction system of the multiplex PCR detection kit comprises:

[0051] 2×Taq Master Mix, a primer set for detecting porcine Actinobacillus pleuropneumoniae, a primer set for detecting Pasteurella multocida, a primer set for detecting Streptococcus suis, bacterial genomic DNA of porcine Actinobacillus pleuropneumoniae, bacterial genomic DNA of Pasteurella multocida, bacterial genomic DNA of Streptococcus suis and ddH2O.

[0052] In the above preferred embodiment, the reaction system of the multiplex PCR detection kit is:

[0053] 2×Taq Master Mix 12.5μL, primer set for detecting porcine Actinobacillus pleuropneumoniae 0.5μL, primer set for detecting Pasteurella multocida 0.5μL, primer set for detecting Streptococcus suis 2μL, Actinobacillus pleuropneumoniae bacterial genomic DNA 1μL, Pasteurella multocida bacterial genomic DNA 1μL, Streptococcus suis bacterial genomic DNA 1μL, and ddH2O 0.5μL.

[0054] In a preferred embodiment of the present invention, the PCR reaction conditions of the multiplex PCR detection kit are: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, annealing at 59°C for 45 s, extension at 72°C for 45 s, 40 cycles, and then extension at 72°C for 10 min.

[0055] A multiplex PCR method for simultaneously detecting three swine respiratory pathogens, namely Actinobacillus pleuropneumoniae, Pasteurella multocida and Streptococcus suis, wherein the detection method is used for detection for non-disease diagnosis purposes and comprises the following steps:

[0056] (1) extracting DNA from the sample to be tested;

[0057] (2) equipping the PCR system of the present invention, adding the DNA template extracted in (1) into a reaction tube;

[0058] (3) placing the PCR reaction tube in a PCR instrument for amplification;

[0059] (4) After the PCR reaction is completed, the product is subjected to agarose gel electrophoresis to determine the result. The result is as follows: if bands of 882 bp, 628 bp, and 410 bp appear, it means that the sample contains Actinobacillus pleuropneumoniae, Pasteurella multocida, and Streptococcus suis. If the length of the band fragment does not appear, the corresponding pathogen does not appear.

[0060] According to one aspect of the present invention, the above-mentioned multiplex PCR detection primer combination or the above-mentioned multiplex PCR detection kit is used in the preparation of a porcine respiratory pathogen detection product.

[0061] The multiplex PCR detection primer combination or the multiplex PCR detection kit provided by the present invention can be widely used in the preparation process of porcine respiratory pathogen detection products.

[0062] The technical solution of the present invention will be further described below in conjunction with embodiments.

[0063] The materials and reagents used in the following examples include:

[0064] Strains: Actinobacillus pleuropneumoniae, Pasteurella multocida, Streptococcus suis, Escherichia coli, Staphylococcus aureus, Salmonella, Proteus mirabilis, Haemophilus parasuis. The above strains are isolated, identified, and preserved by the laboratory of Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences, and can be sold to the public.

[0065] Main reagents: Tryptic soy bean agar medium (purchased from BD Difco), Tryptic soy bean liquid medium (purchased from BD Difco), 50×TAE buffer (purchased from Sangon Biotechnology Co., Ltd.), agarose (purchased from ELAB), 2×TaqMaster Mix (purchased from Vazyme), nicotinamide adenine dinucleotide (purchased from Sangon Biotechnology Co., Ltd.), newborn calf serum (purchased from Zhejiang Tianhang Biotechnology Co., Ltd.), DL2000 DNA Marker (purchased from Vazyme), bacterial genomic DNA extraction kit (purchased from Tiangen Biochemical Technology Co., Ltd.)

[0066] Example 1

[0067] (I) Primer design: Based on the apxIVA gene of Actinobacillus pleuropneumoniae, kmt1 gene of Pasteurella multocida, and gdh gene of Streptococcus suis published in GenBank, specific primers for Actinobacillus pleuropneumoniae, Pasteurella multocida, and Streptococcus suis were designed, respectively, and synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0068] The relevant specific primer combination information in Table 1 is as follows:

[0069]

[0070]

[0071] (II) Single PCR amplification and specificity:

[0072] The specific primers designed in Table 1 were used to perform single PCR amplification on porcine Actinobacillus pleuropneumoniae, Pasteurella multocida, and Streptococcus suis.

[0073] The single PCR amplification system was 25 μL: 2×Taq Master Mix 12.5 μL; DNA template 2 μL; upstream and downstream primers 1 μL each; ddH2O was added to 25 μL.

[0074] Reaction program: 95°C for 5 min; 94°C for 45 s; 57°C for 45 s; 72°C for 45 s, 35 cycles; 72°C for 10 min.

[0075] Figure 1The electrophoresis results of single PCR amplification of porcine Actinobacillus pleuropneumoniae, Pasteurella multocida, and Streptococcus suis by the multiplex PCR detection primer combination provided in this embodiment are shown.

[0076] Figure 1 In the middle, M is DL2000 DNA Maker, N is blank control, and lanes 1-3 are apxIVA gene, kmt1 gene, and gdh gene, respectively.

[0077] Depend on Figure 1 The electrophoresis results showed that the sizes of the amplified fragments of apxⅣA, kmt1 and gdh genes were consistent with the expectations, which were 882 bp, 628 bp and 410 bp respectively.

[0078] (III) Optimization of multiplex PCR amplification reaction system and conditions:

[0079] The multiplex PCR amplification reaction system and reaction conditions were optimized.

[0080] 1. By adjusting the primer concentrations of APP, PM, and SS and their template amounts, the optimal triple PCR reaction system was obtained as shown in Table 2.

[0081] Table 2:

[0082]

[0083]

[0084] 2. Optimization of reaction conditions includes optimizing annealing time (35s-45s), optimizing annealing temperature (51℃-63℃), and optimizing the number of cycles to determine the best reaction system.

[0085] Figure 2 This is a graph showing the optimization results of the annealing time for the multiplex PCR amplification reaction provided in this example. Figure 2 In the figure, M is DL2000 DNA Maker, N is blank control, and lanes 1-8 are annealing times of 35s, 37s, 39s, 41s, 43s, and 45s, respectively.

[0086] Figure 3 This is a graph showing the optimization results of the annealing temperature for the multiplex PCR amplification reaction provided in this example. Figure 3 In the figure, M is DL2000 DNA Maker, N is blank control, and lanes 1-7 are annealing temperatures of 51°C, 53°C, 55°C, 57°C, 59°C, 61°C, and 63°C, respectively.

[0087] Figure 4 This is a graph showing the optimization results of amplification of different cycle numbers of the multiple PCR amplification reaction provided in this example. Figure 4M in the middle is DL2000 DNA Maker, N is blank control, and lanes 1-6 are amplification cycles of 20 times, 25 times, 30 times, 35 times, 40 times, and 45 times, respectively.

[0088] By the above Figure 2 to Figure 4 Through the annealing time gradient test, annealing temperature gradient test, and cycle number gradient test, the optimal reaction conditions for the multiple PCR amplification reaction of the present invention are obtained as follows:

[0089] Pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, annealing at 59°C for 45 s, extension at 72°C for 45 s, 40 cycles, and then extension at 72°C for 10 min.

[0090] (IV) Specificity test:

[0091] Specific primers of three pathogens, 2×Taq Master Mix and ddH2O were added to 8 reaction tubes, and the extracted genomic DNA of porcine Actinobacillus pleuropneumoniae, Pasteurella multocida, Streptococcus suis, Escherichia coli, Staphylococcus aureus, Salmonella, Proteus mirabilis and Haemophilus parasuis were added for amplification to detect the specificity of the triple PCR method.

[0092] Figure 5 This is a graph showing the specificity test results of the multiplex PCR detection primer combination provided in this example.

[0093] Figure 5 M in the middle is DL2000 DNA Maker, N is blank control, and lanes 1-8 are Actinobacillus pleuropneumoniae, Pasteurella, Streptococcus suis, Escherichia coli, Staphylococcus aureus, Salmonella, Proteus mirabilis, and Haemophilus parasuis, respectively.

[0094] Depend on Figure 5 It can be seen that the multiplex PCR can amplify the target bands for porcine Actinobacillus pleuropneumoniae, Pasteurella multocida, and Streptococcus suis, and there are no other nonspecific reactions. The amplification results for the genomes of Escherichia coli, Staphylococcus aureus, Salmonella, Proteus mirabilis, and Haemophilus parasuis are negative, indicating that the primers have good specificity.

[0095] (V) Sensitivity test: Determine the concentration of genomic DNA of Actinobacillus pleuropneumoniae, Pasteurella multocida, and Streptococcus suis. Use deionized water to adjust the DNA concentration to 10 ng / μL, then use deionized water to make a 10-fold dilution and use the established multiplex PCR method for detection. Perform 1% nucleic acid agarose gel electrophoresis on the PCR product and observe the target band to detect the sensitivity of the method.

[0096] Figure 6This is a graph showing the sensitivity test results of the multiplex PCR detection primer combination provided in this example.

[0097] Figure 6 M in the figure is DL2000 DNA Maker, N is blank control, and lanes 1-7 are 1×10 1 ng / μL, 1×10 0 ng / μL, 1×10 -1 ng / μL, 1×10 -2 ng / μL, 1×10 -3 ng / μL, 1×10 -4 ng / μL, 1×10 -5 ng / μL.

[0098] Depend on Figure 6 It can be seen that the minimum detection amount of multiplex PCR for porcine Actinobacillus pleuropneumoniae, Pasteurella multocida, and Streptococcus suis is 10 pg / μL.

[0099] In summary, since porcine Actinobacillus pleuropneumoniae, Pasteurella multocida and Streptococcus suis often co-infect in clinical practice, conventional detection methods are relatively time-consuming and labor-intensive, and the detection cost is high, which is not conducive to the efficient development of detection work. Based on the need for rapid and accurate diagnosis of mixed infection pathogens, the present invention utilizes the advantages of multiplex PCR detection, which is simple to operate, rapid, specific, and highly sensitive, and is particularly suitable for rapid diagnosis of a large number of clinical samples with mixed infections. A rapid, specific and sensitive multiplex PCR diagnostic method for three porcine respiratory pathogens is established, and clinical samples with single or multiple mixed infections of the three pathogens of porcine Actinobacillus pleuropneumoniae, Pasteurella multocida and Streptococcus suis can be differentially diagnosed at the same time, thereby prescribing the right medicine for the disease, reducing the labor intensity of detection personnel, and achieving rapid, accurate and sensitive detection and diagnosis of these diseases.

[0100] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A multiplex PCR primer combination for detecting porcine respiratory diseases, characterized in that: The detection primer combination consists of a first primer pair, a second primer pair and a third primer pair; The first primer pair consists of an upstream primer having a base sequence shown in SEQ ID NO.1 and a downstream primer having a base sequence shown in SEQ ID NO.2; The second primer pair consists of an upstream primer having a base sequence shown in SEQ ID NO.3 and a downstream primer having a base sequence shown in SEQ ID NO.4; The third primer pair consists of an upstream primer having a base sequence shown in SEQ ID NO.5 and a downstream primer having a base sequence shown in SEQ ID NO.

6.

2. The multiplex PCR detection primer combination for detecting porcine respiratory diseases according to claim 1, characterized in that: The detection target gene of the first primer pair is the apxIVA gene, and the size of the primer amplification product is 882 bp; And / or, the detection target gene of the second primer pair is kmt1 gene, and the size of the primer amplification product is 628 bp; And / or, the detection target gene of the third primer pair is the gdh gene, and the size of the primer amplification product is 410 bp.

3. A method for detecting porcine respiratory diseases, characterized in that: The following steps are involved: DNA of the pig respiratory tract sample to be tested is extracted as a template, the DNA is amplified using the first primer pair, the second primer pair and the third primer, and the product is subjected to electrophoresis detection and analysis after the amplification.

4. The method for detecting porcine respiratory diseases according to claim 3, characterized in that: The DNA amplification is PCR amplification, and the reaction system of the PCR amplification is: 2× Taq Master Mix 12.5 μL; 0.5 μL for the first primer pair; 0.5 μL for the second primer pair; 2 μL for the third primer pair; Actinobacillus pleuropneumoniae genomic DNA 1 μL; Pasteurella multocida bacterial genomic DNA 1 μL; 1 μL of Streptococcus suis bacterial genomic DNA; ddH2O 0.5μL.

5. The method for detecting porcine respiratory diseases according to claim 3, characterized in that: The electrophoresis detection analysis is agarose gel electrophoresis analysis.

6. The method for detecting porcine respiratory diseases according to claim 5, characterized in that: The electrophoresis detection and analysis method comprises: If a band of 882 bp appears in the DNA of the pig respiratory tract sample to be tested, the sample is infected with Actinobacillus pleuropneumoniae; If a 628 bp band appears in the DNA of the pig respiratory tract sample to be tested, the sample is infected with Pasteurella multocida; If a 410 bp band appears in the DNA of the pig respiratory tract sample to be tested, the sample is infected with Streptococcus suis.

7. A kit comprising the multiplex PCR detection primer combination for detecting porcine respiratory diseases according to claim 1 or 2.

Images