SgRNA for detecting salmonella pullorum and application of sgRNA in RPA-CRISPR / Cas12b detection

Abstract

The invention discloses sgRNA for detecting salmonella pullorum and application of the sgRNA in RPA-CRISPR / Cas12b detection, and belongs to the technical field of biology. According to the invention, the group3798 gene is taken as a specific target, and the designed sgRNA has good sensitivity, specificity and repeatability when being used for detecting the salmonella pullorum, does not depend on large-scale experimental equipment, can visually display the result, and provides a method for rapidly detecting the salmonella pullorum on site for the poultry breeding industry.

Description

Technical Field

[0001] The present invention relates to an sgRNA for detecting Salmonella pullorum and application thereof in RPA-CRISPR / Cas12b detection, belonging to the field of biotechnology. Background Art

[0002] Pullorum is an acute systemic disease caused by Salmonella Pullorum, which occurs mostly in chicks within 2-3 weeks of age. Adult chickens can also be infected. It can be transmitted vertically and horizontally, with a very high mortality rate and is difficult to cure, which seriously affects the development of my country's poultry industry. In my country, purifying pullorum through breeding poultry is the key means of preventing and controlling pullorum, and the core of purification lies in accurately detecting infected individuals.

[0003] At present, the detection methods of Salmonella pullorum mainly include traditional bacterial isolation and identification, as well as detection technologies based on immunology and molecular biology, such as glass plate agglutination and PCR. Although methods such as polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA) have made significant progress, they are still limited in their use scenarios because they require higher operating levels and complex equipment, are cumbersome to operate, and are therefore very difficult to use. Therefore, it is urgent to develop a rapid on-site detection method for Salmonella pullorum with strong specificity and sensitivity.

[0004] In recent years, clustered regularly interspaced short palindromic repeats (CRISPR) have shown significant advantages in rapid detection technology. The CRISPR-Cas (clustered regularly interspaced shortpalindromic repeats, Crispr-associated proteins) detection system developed based on Cas12b protein is a new detection method that shows good application prospects in the field of nucleic acid detection. Under the guidance of sgRNA, the Cas12b protein activates its trans-cutting activity after identifying the matching target sequence, that is, it indiscriminately cuts single-stranded nonspecific nucleic acid sequences. Therefore, the target DNA can be detected by detecting the fluorescence of nonspecific single-stranded DNA fluorescent groups. However, in nucleic acid detection, before performing the Cas protein cutting reaction, it is necessary to amplify a small amount of target fragments in the sample, which can further improve the sensitivity of the detection.

[0005] Recombinase Polymerase Amplification (RPA) is a new isothermal nucleic acid amplification technology developed by Piepenburg et al. in 2006. Compared with conventional PCR methods, RPA amplification is more sensitive, simpler, and takes less time. Under constant temperature conditions of 37-45°C, only a small amount of nucleic acid sample is needed to complete the amplification. Its simple operation and tolerance to samples show great potential in rapid on-site testing. Combining RPA technology with CRISPR / Cas technology can enable instant on-site testing.

[0006] The Salmonella pullorum detection method established based on the PRA-CRISPR / Cas12b detection system can achieve rapid and convenient detection, and has the characteristics of high sensitivity and high specificity. It is expected to provide strong technical support and efficient detection means for the quarantine and purification of Salmonella pullorum. Summary of the invention

[0007] Purpose of the invention: The purpose of the present invention is to provide an application of group_3798 gene as a specific target in the detection of Salmonella pullorum, as well as sgRNA designed for group_3798 gene for the detection of Salmonella pullorum and its application.

[0008] Technical solution: The present invention provides an application of group_3798 gene as a specific target in detecting Salmonella pullorum, and the nucleotide sequence of the group_3798 gene is shown in SEQ ID NO.1.

[0009] The present invention also provides an sgRNA for detecting Salmonella pullorum, wherein the sgRNA comprises a specific target sequence as shown in SEQ ID NO.2.

[0010] Furthermore, the nucleotide sequence of the sgRNA is shown in SEQ ID NO.3.

[0011] The present invention also provides the use of the above-mentioned sgRNA in preparing a kit for detecting Salmonella pullorum.

[0012] The present invention also provides a Salmonella pullorum RPA-CRISPR / Cas12b detection kit, which comprises an sgRNA of a Salmonella pullorum target sequence as shown in SEQ ID NO.2, and a primer pair for amplifying the Salmonella pullorum target sequence as shown in SEQ ID NO.2.

[0013] Furthermore, the nucleotide sequence of the primer pair is shown in SEQ ID NOs. 4-5.

[0014] Furthermore, the kit also includes RPA amplification reagents and CRISPR / Cas12b detection reagents, positive and negative controls.

[0015] Furthermore, the RPA amplification reagent includes polymerase dry powder, Buffer A, Buffer B, and ddH2O.

[0016] Furthermore, the CRISPR / Cas12b detection reagent includes a detection buffer 10×HOLMES Buffer, a fluorescent signal reporter molecule, ddH2O, and a Cas12b protein.

[0017] The present invention also provides a RPA-CRISPR / Cas12b detection method for Salmonella pullorum, wherein the sample to be tested is first subjected to RPA amplification, and the nucleotide sequences of the primers used are shown in SEQ ID NOs.6 to 7; then the RPA amplification product is subjected to CRISPR / Cas12b detection using the above-mentioned sgRNA, and after the CRISPR / Cas12b detection is completed, the fluorescent signal is read with the naked eye under 485nm excitation light, if there is a fluorescent signal, the sample to be tested contains Salmonella pullorum, and if there is no fluorescent signal, the sample to be tested does not contain Salmonella pullorum.

[0018] Beneficial effects: Compared with the prior art, the present invention has the following outstanding advantages: the present invention uses the group_3798 gene as a specific target, and the designed sgRNA can obtain the test results within 1 hour without the aid of a variety of complex instruments and equipment when used to detect Salmonella pullorum, and can detect as low as 10 0 CFU of Salmonella pullorum samples. It has many technical advantages such as simple operation, rapid response, excellent sensitivity, etc., which can meet the needs of on-site instant detection applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the electrophoresis of the amplified products of the RPA primer screening test for Salmonella pullorum. Lane M is DL2000 DNA Marker (Novagen Biotech Co., Ltd.); Lane 1 is the amplified product of RPA-F1 / R1 primers; Lane 2 is the amplified product of RPA-F2 / R2 primers; Lane 3 is the amplified product of RPA-F3 / R3 primers; Lane 4 is the amplified product of RPA-F / R primers.

[0020] Figure 2 This is the performance verification result of the RPA-CRISPR / Cas12b detection kit. 1 is a positive reaction tube containing the target bacteria Salmonella pullorum DNA, 2 is a negative control without sgRNA, 3 is a negative control without Cas12b protein, 4 is a negative control without target DNA, and 5 is a negative control with only the fluorescent reporter gene.

[0021] Figure 3 This is the result diagram of the optimal detection time of the RPA-CRISPR / Cas12b detection system.

[0022] Figure 4 This is the result of the specific determination of the RPA-CRISPR / Cas12b detection system for different serotypes of Salmonella strains and non-Salmonella strains. Tube 1 is Salmonella pullorum, tubes 2-10 are non-target bacteria, including Salmonella Enteritidis, Salmonella Typhimurium, Salmonella Kentucky, Salmonella Infantis, Salmonella Indiana, Salmonella London, Salmonella Agona, Escherichia coli, and Citrobacter rodentium, tube 11 is a negative control without target DNA, and tube 12 is a negative control with only fluorescent reporter gene.

[0023] Figure 5 This is the result of the sensitivity evaluation of the RPA-CRISPR / Cas12b detection system. Figure 5 a Using the Salmonella pullorum genome as the detection template, the concentrations of the Salmonella pullorum genome in tubes 1-7 were 250 ng / μL, 25 ng / μL, 2.5 ng / μL, 2.5×10 -1 ng / μL, 2.5×10 -2 ng / μL, 2.5×10 -3 ng / μL, 2.5×10 -4 ng / μL, tube 8 was the negative control; Figure 5 b Using Salmonella pullorum liquid DNA as the detection template, the concentrations of Salmonella pullorum liquid in tubes 1-6 were 10 5 CFU / mL, 10 4 CFU / mL, 10 3 CFU / mL, 10 2 CFU / mL, 10 1 CFU / mL, 10 0 CFU / mL, tube 7 is the negative control.

[0024] Figure 6 This is the test result of the RPA CRISPR / Cas12b detection system for clinical isolates of Salmonella pullorum. Tubes 1-3 are standard strains of Salmonella pullorum, tubes 4-59 are isolates of Salmonella pullorum, and tube 60 is a negative control.

[0025] Figure 7 This is the result of using the RPA-CRISPR / Cas12b detection kit to detect Salmonella pullorum in simulated fecal samples. Figure 7 a. Detection of Salmonella pullorum in fecal simulation samples without enrichment culture; Figure 7b. Detection of Salmonella pullorum in fecal simulated samples after enrichment culture, where tubes 1-6 are 10 5 CFU / mL, 10 4 CFU / mL, 10 3 CFU / mL, 10 2 CFU / mL, 10 1 CFU / mL, 10 0 CFU / mL of Salmonella pullorum and feces mixed sample test, tube 7 is the feces sample test, and tube 8 is the negative control. DETAILED DESCRIPTION

[0026] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0027] Example 1 Screening of specific genes of Salmonella pullorum

[0028] In order to screen for Salmonella pullorum-specific genes, 100 strains of Salmonella serotypes that are widely prevalent in poultry were selected, including Salmonella pullorum, Salmonella typhimurium, Salmonella enteritidis, Salmonella infantis, Salmonella Kentucky, Salmonella Indiana, Salmonella Argonne, and Salmonella London, as well as non-Salmonella strains such as Escherichia coli, Citrobacter rodentium, Shigella dysenteriae, Vibrio parahaemolyticus, and Staphylococcus aureus, and genomic comparative analysis was performed to screen for Salmonella pullorum-specific genes. All the above genomic information was obtained from the EnteroBase website ( https: / / enterobase.warwick.ac.uk ).

[0029] The results are shown in Table 1. Group_3798 (Sequence ID: CP126324.1) is specific to Salmonella pullorum (100%), while the gene is not found in other serotypes of Salmonella and non-Salmonella prevalent in poultry, indicating that the group_3798 gene can be used as a specific gene for detecting Salmonella pullorum. The nucleotide sequence of the group_3798 gene is shown in SEQ ID NO.1:

[0030] ATGAATCGCCTGATATCAGCCTTCTGTATTACATTCTGTTGTCATGCTTACGCTATAACCCTAGATGCCAGTATTACTGATTTTACGGTACTATTTGGGCAACATATGGGGCACAGTGCTTGTGTAGGCAAATTTCCACAAGGTGCTCCACCCAGTACTTTTGTAGGATGCCGATCGAATGGTGATTTTTCAATGTATAATTCATTTACCTCAAAAGTCATCATTACTCGGTTGCCCGACAAAGTATCCGCTGCACATGGTGAGAGTCTGCCATGTACAGTTCCCTCGTTGAGGGTCCGGGGAGGGTTAGAATTCGCTAAGTCAACCTCCGATGCAGGAATAGTCGAAACTATTGATATTAGTGGAATGAATGTAGGTGAAAGCCGGACAGGGGAGATTAAAAATGCCAAATATATTGCCCTTACGCCCGGAACTGTTATCAGCCTAGAGGCGCTTCAGTGTGATTACAGTGCTGGTTCGCTTTTTGGCGATACATCTGCTCGAGTCTCTGCTAATTATTCAATAGAAATGCCTGATAGTAATTTCAGCACCTCGGTACTATATGAGGTACTGGCTAAAATTGACAAAATTGGGAGCAAACCCGACTTTACTTTGTCACCGACTTATGTCAGGTGTGTAGGTAACACTGCGTCCGGGTGCATGACTGAACCTGTGACAGTAAGCGTAAAAGATGTAACTAATGGTCACAGAATTCAAGTCACTGGTCTGGTAACTGGAGGGGATTTATCATATATATCAAATACTGGCCGTGTCGACCTGCCCGAGGGTAAGTTGACAAATCTTGTCAACACCGTCTCTTCTGGGGGAATACAGCAAGTGACATCAGGGCGTTTTGTTATCCCGGGAGGAGGAACTGAAGGGACCCGATTCTATACGGTGAACTACACTTTAACCGTAGAATAA

[0031] Table 1 Screening of specific genes of Salmonella pullorum

[0032]

[0033] Example 2 Design and screening of sgRNA and RPA primers and establishment of RPA-CRISPR / Cas12b detection system

[0034] 1. Design of sgRNA

[0035] The specific gene group_3798 of Salmonella pullorum screened in Example 1 was used as the target, and the PAM sequence recognition preference of Cas12b protein was combined. The Blastn online alignment software (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) was used in NCBI to search for the gene-specific and conservative sequence as the pre-spacer sequence to ensure that it can distinguish avian Salmonella pullorum from other serotypes of Salmonella and non-Salmonella. Finally, a 20bp gene sequence (SEQ ID NO.2) was selected as the specific detection target of Salmonella pullorum.

[0036] The targeting recognition sequence on sgRNA was designed according to the specific conservative sequence of Salmonella pullorum, and combined with the sgRNA fixed sequence, the specific sgRNA sequence of Salmonella pullorum was designed as shown in SEQ ID No.3. Among them, the 1st to 19th positions of SEQ ID No.3 are the T7 promoter sequence, the 20th to 111th positions are the scaffold sequence of sgRNA, and the 112th to 131st positions are the specific detection target sequence of Salmonella pullorum. The recombinant plasmid pUC18-sgRNA containing the specific sgRNA sequence was constructed, and the sgRNA sequence amplification primers (SEQ ID NO.4-5) were designed. The pUC18-sgRNA recombinant plasmid was synthesized by Sangon Biotechnology Co., Ltd., and the sgRNA sequence amplification primers were synthesized by Qingke Biotechnology Co., Ltd.

[0037] 2. RPA Primer Design and Screening

[0038] 1. Primer design and synthesis: According to the specific conservative sequences of Salmonella pullorum obtained by screening and the requirements for RPA primer design, RPA primers (SEQ ID NO. 6-13) were artificially designed. RPA primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0039] 2.RPA primer screening:

[0040] 2.1 Genome extraction

[0041] The genome of Salmonella pullorum S06004 was extracted using a genomic DNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.), and the extracted DNA was accurately quantified using a Nanodrop ultra-micro-volume spectrophotometer (Thermo Fisher Scientific).

[0042] 2.2 Primer amplification

[0043] The RPA amplification reaction was performed using the DNA isothermal amplification kit of Ampu Future Biotech Co., Ltd. The reaction system was as follows: 29.4 μL Buffer A, 5 μL template DNA, 9.1 μL ddH2O, 2 μL each of upstream and downstream primers (10 μM) were added to the RPA enzyme lyophilized powder, and finally 2.5 μL Buffer B was added, inverted 8-10 times, and placed in a PCR instrument after a brief centrifugation, and incubated at 41°C for 30 minutes. 10 μL of the amplified product was analyzed by agarose gel electrophoresis, and RPA primers with higher concentration and strong specificity were screened.

[0044] RPA primer pairs F / R, F1 / R1, F2 / R2, and F3 / R3 were used for RPA amplification, respectively. Under the same conditions of template concentration, reaction time, primer concentration, etc., the amplification was performed at 41°C for 30 minutes. After the reaction, 10 μL of the amplified product was taken for agarose gel electrophoresis analysis. The nucleotide sequences of the sgRNA sequence and RPA primers are shown in Table 2:

[0045] Table 2 Sequences of RPA amplification primers and sgRNA transcription templates

[0046]

[0047] like Figure 1 As shown in the figure, the amplified bands of primer pairs RPA-F1 / R1 and F2 / R2 are light in color, indicating that the primer amplification efficiency is low; the amplified product bands of RPA-F3 / R3 are darker and have non-specific bands, indicating that the primer specificity is not strong; the amplified bands of the F / R primer pair are brighter and the amplified bands are single, indicating that the primer amplification efficiency is high. In subsequent experiments, unless otherwise specified, RPA primers use the RPA-F / R primer pair.

[0048] 3. Establishment of RPA-CRISPR / Cas12b detection system

[0049] 1. sgRNA in vitro transcription and purification

[0050] The pUC18-sgRNA recombinant plasmid was constructed by Sangon Biotechnology Co., Ltd. The plasmid was used as a template for amplification, and the Thermo Fisher Scientific TranscriptAid T7 High Yield Transcription Kit and Novozyme VAHTS RNA Clean Beads were used for in vitro transcription and purification. The specific process is shown below.

[0051] 1.1 Preparation of DNA transcription template

[0052] The primer pair sgRNA-F / R was used to amplify the sgRNA specific to Salmonella pullorum by PCR. The total volume of the PCR system was 50 μL, including 22 μL 2×Taq Master Mix, 22 μL ddH2O, 2 μL of each sgRNA-F / R primer with a final concentration of 0.4 μM, and 2 μL of DNA template. The PCR reaction program was: (a) 95°C pre-denaturation for 3 min, (b) 95°C denaturation for 30 s, (c) 56.1°C annealing for 30 s, (d) 72°C extension for 1 min, (b)-(d) cycles for 30 times, (e) 72°C extension for 5 min. The PCR products were analyzed by 1% agarose gel electrophoresis, and the products were recovered and purified by agarose gel DNA recovery kit (purchased from TIANGEN, catalog number DP219-03).

[0053] 1.2 sgRNA in vitro transcription

[0054] (1) Mix the DNA transcription template (0.5 μg), 5× Transcript Max reaction buffer (4 μL), Transcript Max Enzyme Mix (2 μL), NTP mix (8 μL), and nuclease-free water (to 20 μL), mix thoroughly, centrifuge briefly, and incubate at 37°C for 10-12 h for in vitro transcription.

[0055] (2) After the incubation at 37°C, add 1 μL of DNase I reaction solution to 20 μL of in vitro transcription product and incubate at 37°C for 30 min to remove the residual DNA template in the transcription system.

[0056] (3) Purification of sgRNA transcripts:

[0057] a. First, take the magnetic beads out of the 4°C refrigerator and place them at room temperature for about 30 minutes to allow the temperature to equilibrate to room temperature. Invert or vortex to mix the magnetic beads thoroughly, pipette 1.8 times the volume of magnetic beads into the sgRNA sample to be purified, and mix thoroughly with a pipette.

[0058] b. Incubate at room temperature for 5 minutes to allow the RNA to bind to the magnetic beads.

[0059] c. Place the sample on the magnetic rack for 5 minutes. After the solution becomes clear, carefully remove the supernatant.

[0060] d. Keep the sample on the magnetic rack, add 200 μL of freshly prepared 80% ethanol, rinse the magnetic beads, incubate at room temperature for 30 seconds, and carefully remove the supernatant.

[0061] e. Repeat step d, rinsing 2 times in total.

[0062] f. Keep the sample on the magnetic rack at all times and open the lid to air-dry the magnetic beads for 5 minutes.

[0063] g. Remove the sample from the magnetic rack, add 32 μL of nuclease-free water, pipette to mix thoroughly, and let stand at room temperature for 5 minutes.

[0064] h. Place the sample on a magnetic rack for 5 minutes. After the solution is clarified, carefully transfer the supernatant to a new nuclease-free centrifuge tube to obtain the purified sgRNA.

[0065] 2. Establishment of RPA-CRISPR / Cas12b detection system

[0066] (1) The RPA-CRISPR / Cas12b detection system includes: Buffer A, RPA upstream and downstream primers (10 μM), Buffer B, Cas12b protein (5 μM), sgRNA (5 μM), fluorescent reporter gene (FAM-N12-BHQ 1, 5 μM), Buffer, and ddH2O.

[0067] (2) First, RPA amplification was performed, including: adding 29.4 μL Buffer A, 5 μL template DNA, 9.1 μL ddH2O, and 2 μL each of RPA-F / R primer (10 μM) to the RPA enzyme lyophilized powder, and finally adding 2.5 μL Buffer B, inverting 8-10 times, briefly centrifuging, placing in a metal bath, and amplifying at 41°C for 30 min.

[0068] (3) The above amplified product was then used for CRISPR / Cas12b detection, specifically including: 1 μL Cas12b protein (5 μM), 1 μL sgRNA (5 μM), 1 μL of the above RPA amplified product, 1 μL of fluorescent signal reporter gene (5 μM), 2 μL Buffer, and ddH2O to make up to 20 μL, mixed and placed in a metal bath.

[0069] (4) Reaction procedure: 48°C for 30 min in PCR instrument.

[0070] (5) The results showed that when the reaction solution was irradiated with 485nm blue light, it could be clearly seen that the color of the reaction tube where the probe sequence was cut turned green, and there was a color difference with the control group, indicating that the CRISPR / Cas12b protein had a cutting reaction and the detection system was working normally.

[0071] Example 3 Performance Verification of RPA-CRISPR / Cas12b Detection Kit

[0072] The feasibility of the kit reaction procedure was verified using the RPA-CRISPR / Cas12b detection method described in Example 2.

[0073] 1. Extract the genome of the standard strain of Salmonella pullorum S06004 as a detection template and perform RPA amplification.

[0074] 2. Pipette 1 μL of the above RPA amplification product and add it to the CRISPR / Cas12b detection system for detection.

[0075] 3. According to Figure 2 It can be seen that compared with the negative control tube 2 without sgRNA, the negative control tube 3 without Cas12b protein, the negative control tube 4 without target DNA, and the negative control tube 5 with only fluorescent reporter gene, the positive reaction tube 1 containing the target bacteria Salmonella pullorum DNA showed a strong fluorescent signal observable by the naked eye, indicating that the system can detect Salmonella pullorum, and the Cas12b protein exerts trans-cutting activity to generate fluorescent signals, indicating that the detection system is feasible.

[0076] Example 4 Optimization of the optimal detection time of the RPA-CRISPR / Cas12b detection system

[0077] The RPA-CRISPR / Cas12b detection method described in Example 2 was used to optimize the optimal detection time.

[0078] 1. Extract the genome of the standard strain of Salmonella pullorum S06004 as a detection template and perform RPA amplification.

[0079] 2. Pipette 1 μL of the above RPA amplification product and add it to the CRISPR / Cas12b detection system. Mix well and place it in the qPCR instrument. Collect fluorescence every 1 minute for 100 minutes.

[0080] 3. According to Figure 3 It can be seen that the fluorescence value reaches its peak value at 30 minutes of detection, and there is no obvious change in the fluorescence value when the detection time is extended. Therefore, the optimal detection time is selected as 30 minutes.

[0081] Example 5 Specificity detection of RPA CRISPR / Cas12b detection system

[0082] The RPA-CRISPR / Cas12b detection method described in Example 2 was used to detect the specificity of the RPA-CRISPR / Cas12b kit using avian Salmonella and non-Salmonella genomes (Table 3) as templates.

[0083] Table 3 Avian-derived Salmonella and non-Salmonella used in the experiments

[0084] Serial number bacteria Strain No. 1 Salmonella Pullorum S06004 2 Salmonella Enteritidis C50041 3 Salmonella Typhimurium SL1344 4 Salmonella Kentucky 0613-J8 5 Salmonella Infantis 308 6 Salmonella Indiana 606 7 Salmonella London P167 8 Salmonella Agona 3802 9 Escherichia coli K12 10 Citrobacter YZ19VE7

[0085] The results show that Figure 4 ), the reaction solution will only produce a fluorescent signal when the Salmonella pullorum genomic DNA is used as a template (tube 1), while tubes 2-10 do not contain the Salmonella pullorum genome and no fluorescent signal is produced.

[0086] Example 6 Sensitivity evaluation of RPA-CRISPR / Cas12b detection system

[0087] 1. Using the RPA-CRISPR / Cas12b detection method described in Example 2, the genome of Salmonella pullorum S06004 was detected

[0088] After determining the genome concentration of Salmonella pullorum S06004, the concentrations were diluted to 250 ng / μL, 25 ng / μL, 2.5 ng / μL, 2.5×10 -1 ng / μL, 2.5×10 -2 ng / μL, 2.5×10 -3 ng / μL, 2.5×10 -4 ng / μL, and the diluted genome was used as template for detection.

[0089] according to Figure 5 a It can be seen that PCR tubes 1-6 all produce fluorescence, while the genome concentration of PCR tube 7 is 2.5 x 10 -4 ng / μL, no fluorescence signal was observed. Therefore, this detection method can detect the concentration of 2.5×10 -3 ng / μL and above for detection of Salmonella pullorum genome.

[0090] 2. Using the RPA-CRISPR / Cas12b detection method described in Example 2, the Salmonella pullorum S06004 bacterial solution was detected

[0091] The OD of Salmonella pullorum solution was 600 Adjust to 1, dilute in 10-fold gradients and count by plating. After counting, use PBS buffer to dilute the bacterial solution in a gradient to 10 5 , 10 4 , 10 3 , 10 2 , 10 1 , 10 0 CFU / mL, the DNA template was obtained by high temperature lysis method for detection.

[0092] The results show that Figure 5 b), PCR tubes 1-6 all produced fluorescence, indicating that this detection method can detect Salmonella pullorum with a concentration of 10 0 CFU / mL.

[0093] Example 7 Detection of Salmonella pullorum isolates by RPA-CRISPR / Cas12b detection system

[0094] 1. Resuscitate the clinical isolates of Salmonella pullorum (56 strains) isolated in the laboratory in the early stage, and extract their genomes for future use. The strains used in this experiment are shown in Table 4.

[0095] Table 4 Standard strains and clinical isolates of Salmonella pullorum

[0096]

[0097]

[0098]

[0099] 2. Using the above-mentioned Salmonella pullorum standard strain and isolate genome as detection template, detection was performed using the method described in Example 2.

[0100] according to Figure 6 It can be seen that PCR tubes 1-59 all produced obvious fluorescent signals, indicating that this detection method can be used to detect Salmonella pullorum isolates.

[0101] Example 8 Detection of Salmonella pullorum in fecal simulation samples using RPA-CRISPR / Cas12b detection method

[0102] 1. OD of overnight cultured Salmonella pullorum S06004 600 Adjust to 1, and use PBS to dilute it to a concentration of 10 5 -10 0 CFU / mL.

[0103] 2. Treatment of unenriched samples: Add 1 g of feces to 9 mL of enrichment solution BPW, take 1 mL of bacterial solution of different concentrations and mix them evenly with 9 mL of feces sample, then take 1 mL of each to extract the genome, and after genome extraction, perform RPA amplification according to the method described in Example 2, and detect by CRISPR / Cas12b fluorescence method.

[0104] 3. Enrichment sample treatment: At the same time, the remaining simulated contaminated samples were enriched and cultured at 37°C and 180r / min. After 24 hours, 1 mL was taken from each sample to extract the genome. After the genome was extracted, RPA amplification was performed according to the method described in Example 2, and CRISPR / Cas12b was used for detection.

[0105] 4. The genomic DNA of the simulated contaminated samples and control samples without and after enrichment were tested simultaneously using the qPCR method in the "Procedure for the Purification of Salmonella Pullorum in Breeder Farms" GB / T 43173-2023, and the compliance rates of the two methods were compared.

[0106] The results showed that the RPA-CRISPR / Cas12b method of the present invention can detect simulated contaminated fecal samples, and after bacterial enrichment, the detection limit of RPA-CRISPR / Cas12b in simulated contamination detection reached 10 0 CFU / mL (such as Figure 7 At the same time, the qPCR method in the national standard was used for detection, and the results were consistent with those of the RPA-CRISPR / Cas12b method (as shown in Table 5), indicating that the RPA-CRISPR / Cas12b method has good sensitivity and practicality.

[0107] This specific implementation method detects the extracted sample DNA and can produce test results within 1 hour. It has strong specificity and can detect 10 0 CFU / mL of Salmonella pullorum, and can be used for the detection of samples such as poultry feces and anal swabs.

[0108] Table 5 Comparison of the detection results of fecal simulated contaminated samples by RPA-CRISPR / Cas12b and national standard method

[0109]

Claims

1. An application of group_3798 gene as a specific target in detecting Salmonella pullorum, characterized in that: The nucleotide sequence of the group_3798 gene is shown in SEQ ID NO.

1.

2. A sgRNA for detecting Salmonella pullorum, characterized in that: The sgRNA comprises a specific target sequence as shown in SEQ ID NO.

2.

3. The sgRNA for detecting Salmonella pullorum according to claim 2, characterized in that The nucleotide sequence of the sgRNA is shown in SEQ ID NO.

3.

4. Use of the sgRNA according to any one of claims 2 to 3 in preparing a kit for detecting Salmonella pullorum.

5. A Salmonella pullorum RPA-CRISPR / Cas12b detection kit, characterized in that: The kit includes an sgRNA of a Salmonella pullorum target sequence as shown in SEQ ID NO.2, and a primer pair for amplifying a Salmonella pullorum target sequence as shown in SEQ ID NO.

2.

6. The detection kit according to claim 5, characterized in that The nucleotide sequences of the primer pairs are shown in SEQ ID NOs. 4-5.

7. The detection kit according to claim 5, characterized in that The kit also includes RPA amplification reagents and CRISPR / Cas12b detection reagents, positive and negative controls.

8. The detection kit according to claim 7, characterized in that The RPA amplification reagent includes polymerase dry powder, Buffer A, Buffer B, and ddH2O.

9. The detection kit according to claim 7, characterized in that The CRISPR / Cas12b detection reagent includes a detection buffer 10×HOLMES Buffer, a fluorescent signal reporter molecule, ddH2O, and a Cas12b protein.

10. A Salmonella pullorum RPA-CRISPR / Cas12b detection method, characterized in that: First, the sample to be tested is subjected to RPA amplification, and the nucleotide sequences of the primers used are shown in SEQ ID NOs. 6 to 7; then, the RPA amplification product is subjected to CRISPR / Cas12b detection using the sgRNA described in any one of claims 2 to 3, and after the CRISPR / Cas12b detection is completed, the fluorescent signal is read by the naked eye under 485nm excitation light. If there is a fluorescent signal, the sample to be tested contains Salmonella pullorum, and if there is no fluorescent signal, the sample to be tested does not contain Salmonella pullorum.

Images