Method for establishing duck hepatitis virus antibody ELISA (enzyme-linked immunosorbent assay) detection

Abstract

The invention discloses a method for establishing duck hepatitis virus antibody ELISA (enzyme-linked immuno sorbent assay) detection, which comprises the following steps: firstly, preparing experimental materials, and then cloning and antigenicity analysis of structural genes, inducible expression of positive recombinants in escherichia coli, expression and purification of recombinant proteins, antigenicity analysis of the recombinant proteins and establishment of a recombinant antigen VP3 indirect ELISA method. Finally, VP0, VP3 and VP1 recombinant proteins can react with duck anti-DHV-1 positive serum and have good antigenicity, indirect ELISA results show that under the same coating concentration, the P / N value of the fusion protein GST-VP3 serving as a coating antigen is higher than that of the fusion protein GST-VP3 serving as the coating antigen and that of the fusion protein GST-VP3 serving as the coating antigen, it is indicated that the antigenicity of the fusion protein GST-VP3 is better than that of the fusion protein GST-VP3 serving as the coating antigen and that of the fusion protein GST-VP3 serving as the coating antigen and that of the fusion protein GST-VP3 serving as the coating antigen and that of the fusion protein GST-VP3 serving as the coating antigen and that of the fusion protein and the result is consistent with the prediction result.

Description

Technical Field

[0001] The invention relates to an ELISA detection method, in particular to a method for establishing an ELISA detection method for duck hepatitis virus antibodies. Background Art

[0002] Duck viral hepatitis (DVH) is an acute, highly lethal infectious disease caused by duck hepatitis virus type Ⅰ (DHV). It mainly infects ducklings, seriously endangering the healthy development of the duck farming industry. Duck viral hepatitis (DVH) is a highly lethal, rapidly spreading infectious disease caused by duck hepatitis virus (DHV) in ducklings. The clinical manifestations of the disease are movement disorders in ducklings, opisthotonos after death, and liver enlargement and hemorrhage as the main pathological features. The disease is caused by three viruses with independent taxonomic status, namely duck hepatitis virus type 1 (DHV-1), duck hepatitis virus type 2 (DHV-2) and duck hepatitis virus type 3 (DHV-3). Types I and III belong to the Picornaviridae family, while type II belongs to the Astroviridae family. The three do not overlap in antigenicity, but the symptoms and lesions they cause are very similar (Saif, 2003). Summary of the invention

[0003] The invention provides a method for establishing duck hepatitis virus antibody ELISA detection, which has good specificity, does not cross-react with other viruses, can be blocked by duck hepatitis virus, and also has good sensitivity. Compared with serum neutralization test, the method has a high consistency rate.

[0004] The present invention adopts the following technical scheme: a method for establishing duck hepatitis virus antibody ELISA detection, which comprises the following steps:

[0005] Step 1: Prepare experimental materials, which mainly include experimental animals, virus serum, experimental reagents, instruments and equipment, and synthesize primers;

[0006] Step 2: Experimental testing method:

[0007] 1. Cloning and antigenicity analysis of structural genes: Viral RNA was extracted by TRIzol method, and reverse transcription was performed using Random Primer6mer as specific primer. The structural genes VP0, VP3 and VP1 were amplified by PCR reaction from the synthesized cDNA using the above specific primers. After the PCR reaction, 5 μL of each PCR product was taken and subjected to 10 g / L agarose gel electrophoresis to recover the target bands that matched the expected size. The recovered and purified three structural genes were cloned into pMD18-T vector and transferred into competent cells E. coli TG1, and the positive plasmids were identified by restriction digestion and PCR methods and named T-VP0, T-VP3 and T-VP1, respectively. The sequencing results of the positive T-VP0, T-VP3 and T-VP1 plasmids were compared with the gene sequence of the DHV-1 standard strain, and the hydrophilicity, surface accessibility and antigenicity of each structural protein were analyzed by Protean biological software. The plasmids T-VP0, T-VP3 and T-VP1 were double-digested with EcoRⅠ and XhoⅠ, Bam HI and XhoⅠ, EcoRⅠ and XhoⅠ, respectively. The prokaryotic expression vectors pET-32a(+) and pGEX-6p-1 were also double-digested in the same way, and the restriction digestion target bands were recovered from gel, and the target gene was connected with the linearized vector and transformed into competent cells E.coli TG1. Single colonies on LB plate culture medium were picked, plasmids were extracted, double digestion was performed for identification by restriction endonuclease, and the digestion results were analyzed by agarose gel electrophoresis. The positive recombinant expression vectors were named pET-VP0, pGEX-VP3 and pET-VP1 respectively;

[0008] 2. Induced expression of positive recombinants in E. coli: The recombinant expression plasmid pET-VP0 was transformed into E. coli BL21 and spread on LB agar plates containing ampicillin (100 μg / ml); the recombinant plasmids pGEX-VP3 and pET-VP1 were transformed into E. coli Rosetta-gami (DE3) pLysS, and spread on LB agar plates containing 100 μg / ml ampicillin, 12.5 μg / ml tetracycline, 15 μg / ml kanamycin, and 34 μg / ml chloramphenicol. Single colonies were picked and inoculated into 3 mL of LB liquid culture medium containing corresponding resistance, and cultured at 37°C overnight with shaking. The next day, the cells were inoculated into fresh LB culture medium containing the same concentration of antibiotics at a ratio of 1:100. When the bacterial solution OD 600nmWhen the concentration reached 0.5-0.6, IPTG was added to a final concentration of 1 mmol / L, and the culture was induced for 4 h. At the same time, induced pET-32a(+) and pGEX-6p-1 empty vector host bacteria and uninduced recombinant bacteria were set up as controls. 1 mL of the above culture was taken respectively, centrifuged at 5000 r / min for 10 min, the supernatant was discarded, the bacteria were collected, the precipitate was resuspended in 100 μL PBS, an equal volume of 2×SDS loading buffer was added, and the mixture was boiled in a water bath for 10 min. 15 μL was taken for 12﹪SDS-PAGE gel electrophoresis analysis;

[0009] 3. Expression and purification of recombinant proteins, including purification of recombinant proteins Trx-His-VP0 and Trx-His-VP1 and purification of recombinant protein GST-VP3;

[0010] 4. Antigenicity analysis of recombinant protein:

[0011] First, the Western Blot method was used for analysis. The purified recombinant proteins Trx-His-VP0, GST-VP3 and Trx-His-VP1 were subjected to SDS-PAGE electrophoresis, and the vector tags GST·Tag and Trx-His·Tag were set up as controls. Then, they were transferred to nitrocellulose membranes and blocked with 4% horse serum at 4°C overnight. The next day, they were washed 5 times with PBST, and incubated with DHV-1 positive serum diluted 1:50 with PBST at 37°C for 1.5h. After washing 5 times with PBST, they were incubated with horseradish peroxidase (HRP) labeled goat anti-duck IgG diluted 1:1000 with PBST at 37°C for 1h. After washing 5 times with PBST, DAB was used for color development, and then indirect ELISA was performed for comparative analysis. After appropriate dilutions were taken of partially purified recombinant proteins and empty vector proteins, 2μg per well was coated on 96-well ELISA plates at 4°C overnight, and 3 wells were repeated for each sample. The next day, each well was washed five times with PBST, and positive and negative serum was added at a dilution of 1:100, and incubated at 37°C for 60 min. HRP-labeled goat anti-duck IgG was diluted 1:1000 and incubated at 37°C for 60 min. After adding o-phenylenediamine substrate solution, the reaction was carried out in dark for 15 min, and 2 mol / L sulfuric acid was added to terminate the reaction. The results were measured with an enzyme label tester at a wavelength of 490 nm.

[0012] 5. Establishment of indirect ELISA method for recombinant antigen VP3:

[0013] 5A. First, perform a uniformity test on the ELISA plate: randomly select 8 wells from the ELISA plate, perform an appearance inspection on the plate, and preliminarily evaluate its quality. Then, dilute the secondary antibody 2000 times and coat the plate, 100u1 per well, overnight at 4℃, wash 4 times with PBST, soak for 3 minutes each time; add TMB substrate colorimetric solution, 100u1 per well; color at room temperature for 15 minutes; terminate the reaction with 2M H2SO4, and measure OD 450nm Values, calculate the average value and coefficient of variation between each ELISA well, and determine whether the uniformity of different ELISA plates meets the requirements;

[0014] 5B. Determination of antigen coating concentration and serum dilution: VP3 recombinant protein was diluted with pH 9.6 carbonate buffer and coated in 96-well ELISA plates in five gradients of 30 ng, 60 ng, 90 ng, 120 ng, and 150 ng per well, respectively, in rows A, B, C, D, and E, at 4°C overnight; DHV-1 positive serum was diluted 1:50, 1:100, 1:200, 1:400, and 1:800, respectively, and added to columns 1, 3, 5, 7, and 9 of the ELISA plate, and negative serum was added to columns 2, 4, 6, 8, and 10 at the same dilution for square array test, with serum action time of 1 hour; HRP-goat anti-duck IgG was first diluted 1:2000, and the action time was 1 hour. The OD was determined according to the above 5A determination method. 450nm The result with the largest P / N value is selected as the antigen working amount and serum working concentration;

[0015] 5C. Determination of serum action time: ELISA test was performed with the antigen working amount and serum dilution determined in 5B. The serum working time was 30min, 60min, 90min, 120min and 150min respectively. Three replicates were performed for each positive and negative serum at each action time. The operation was performed according to the method in 5B. The larger P / N value was selected as the primary antibody action time.

[0016] 5D. Determination of the working concentration of enzyme-labeled secondary antibody: Based on the ELISA test conditions determined in 5C, HRP-goat anti-duck IgG was diluted at 1:500, 1:1000, 1:2000, 1:4000, and 1:8000, respectively. Each dilution was repeated 3 times. The ELISA test was performed at 37°C for 60 minutes. The dilution with the largest P / N value was determined as the secondary antibody dilution.

[0017] 5E. Determination of the action time of enzyme-labeled secondary antibody: Based on the ELISA test conditions determined in 5D, HRP-goat anti-duck IgG was diluted 1:4000 and acted at 37℃ for 30min, 45min, 60min, 90min and 120min respectively. The ELISA test was carried out. The one with the largest P / N value was determined as the working time of the secondary antibody.

[0018] 5F. Determination of the best blocking solution and concentration: Based on the ELISA test conditions determined in 5E, 5% skim milk, 8% skim milk, 1% BSA, 2% BSA, 4% horse serum, 8% horse serum, 1% fish gelatin, and 2% fish gelatin were used as blocking agents, respectively. Each blocking solution was repeated 3 times, and the result with the largest P / N was taken to determine the type of blocking agent and working concentration;

[0019] 5G. Determination of substrate color development time: Based on the ELISA test conditions determined in 5F, color development was performed at room temperature for 5 min, 10 min, 15 min, 20 min, and 25 min, respectively. After termination, OD was measured. 450nm The maximum P / N value is defined as the substrate color development time;

[0020] 5H. Determination of positive and negative critical value of indirect ELISA method: Take the prepared negative serum and perform indirect ELISA determination. 450nm The values ​​were converted into S / P values ​​for statistical analysis, and the judgment criteria were determined using the Cut-Off value method;

[0021] 5I. Sensitivity test: This diagnostic method was used to detect DHV-1 positive control serum. The serum was diluted 1:100, 1:200, 1:400, 1:800, 1:1600, and 1:3200 times. Each dilution of serum was repeated three times and the OD was measured. 450nm The value was converted into S / P value to determine the sensitivity of the method to positive samples;

[0022] 5J. Specificity test: First, a cross-reaction test is conducted. The method is applied to detect positive sera of Duckcolibacillosis, AI, RA, DH, RE, AR and MDP. At the same time, DHV negative and positive sera are set as controls to detect its specificity. Then, a blocking test is conducted. Different concentrations of DHV virus solution and PBS are taken, and the standard positive and negative sera are diluted at a ratio of 1:100. After mixing, the mixture is incubated at 37°C for 1 hour. According to the determined conditions, the above-treated samples are subjected to ELISA determination. After the color development is stopped, the OD absorption value is determined at a wavelength of 450nm, and the percentage of OD value decrease is calculated. Six known positive sera and two negative sera are taken, and diluted 1:100 with 80% virus suspension, and ELISA is performed to calculate the percentage of serum OD value decrease. Finally, a comparative test is conducted. ELISA is performed on 10 serum samples to determine the test results, and the results are compared with the serum virus neutralization test results to calculate the compliance rate of the established method with the virus neutralization test.

[0023] Step 3. After analysis, a short peptide with high surface accessibility, hydrophilicity and antigenic index also appeared in 257-276aa of the P1 region of DHV-1, i.e. 1-20aa of the N-terminus of VP3. It is speculated that this region may also be immunogenic like HPeV. In addition, Protean program analysis showed that 433-446aa and 698-716aa of the P1 region were located at 205-223aa of VP3 and 177-190aa of VP1, respectively, with high surface accessibility, hydrophilicity and antigenic index. It is speculated that they may also be the main antigenic sites of VP3 and VP1. Compared with VP3 and VP1, the predicted surface accessibility, hydrophilicity and antigenic index of VP0 are relatively low. It is speculated that the antigenicity of VP0 is not as ideal as that of VP3 and VP1. Western blot was used to identify the main antigenic sites of VP3 and VP1. Blot and indirect ELISA methods were used to analyze the antigenicity of the expressed full-length VP0, VP3 and VP1 recombinant proteins. It was found that the three fusion proteins could react with duck anti-DHV-1 positive serum, indicating that they had good antigenicity. The indirect ELISA results showed that at the same coating concentration, the P / N value of the fusion protein GST-VP3 as the coating antigen was higher than the P / N value of Trx-His-VP0 and Trx-His-VP1 as the coating antigen, indicating that the antigenicity of the fusion protein GST-VP3 was better than that of Trx-His-VP0 and Trx-His-VP1, which was consistent with the predicted results.

[0024] Furthermore, the experimental animals and virus serum preparation process in step 1 of the present invention are: preparing ducks, duck embryos, negative and positive blood of duck viral hepatitis, positive serum of duck viral enteritis, positive serum of duck Pasteurella, positive serum of Riemerella anatipestifer, positive serum of avian influenza, positive serum of duck reticuloendotheliosis, positive serum of duck reovirus disease and positive serum of duck parvovirus disease.

[0025] Further, the experimental reagents in step 1 of the present invention include DHV-1 strain, LA Taq DNA polymerase, restriction endonucleases Bam HI, Xho I, EcoR I, T4 DNA ligase, DNA Marker DL2000, low melting point agarose, IPTG, dNTPs, pMD18-T vector, competent cell strain E. coli TG1 strain, E. coli BL21 (DE3), Rosetta-gami (DE3) pLysS, prokaryotic expression vectors pET-32a (+) and pGEX-6p-1, horseradish peroxidase labeled (HRP) labeled goat anti-duck IgG, 3,3′,5,5′-tetramethylbenzidine (TMB) substrate color development solution, skim milk, 96-well detachable enzyme-linked plate, Tween-20, coating solution, blocking solution, serum diluent and enzyme-labeled secondary antibody diluent, washing solution and stop solution (2M H2SO4). Furthermore, the instruments and equipment in step 1 of the present invention include a desktop low-temperature high-speed centrifuge, an ultra-high-speed centrifuge, a PCR cycler, a clean bench, a biosafety class II operating cabinet, an air bath oscillator, a constant temperature water bath DK-80, a constant temperature incubator, a pH meter, a nucleic acid electrophoresis instrument, an ultrasonic crusher, a low-temperature refrigerator, a DYYIII-31A / 31B electrophoresis tank and a DYYIII-2 constant voltage and constant current electrophoresis instrument, a WFH-201 ultraviolet transmission analyzer, a gel imaging analysis system, a vortex mixer QL-901 and an electronic balance.

[0026] Further, the synthetic primers in step 1 of the present invention are designed with reference to the nucleotide sequences of the structural genes VP0, VP3 and VP1 of the DHV-1 strain (EU753359), and restriction sites and protective bases are inserted therein, and the termination codon TAA is added to the downstream primer for synthesis, and it is diluted to a concentration of 10 pmol / μL before use. The primer sequence for PCR amplification of the structural gene is:

[0027] When the structural gene is VP0, the primer sequence is

[0028] UpperPrime:CCG GAATTC ATGGATACTCTTACCAAAAAC(EcoR I),

[0029] Lower Primer: CCG CTCGAG TTACTGATTGTCAAATGGTCG(Xho I),

[0030] The fragment size is 768 bp;

[0031] When the structural gene is VP3, the primer sequence is

[0032] UpperPrime:CGC GGATCC GGAAAGAGAAAGCCACGC (Bam HI),

[0033] Lower Primer: CCG CTCGAG TTACTGATTATTGGTTGCCAT(Xho I),

[0034] The fragment size is 711 bp;

[0035] When the structural gene is VP1, the primer sequence is

[0036] UpperPrime:CCG GAATTC GGTGATTCCAACCAGTTG(EcoR I),

[0037] Lower Primer: CCG CTCGAG TTATTCAATTTCCAGATTGAG(Xho I),

[0038] The fragment size is 714 bp.

[0039] Furthermore, the PCR reaction parameters in step 2 of the present invention are: denaturation at 95°C for 5 min; denaturation at 94°C for 30 sec, annealing at 50°C for 30 sec, extension at 72°C for 1 min, 30 cycles, and extension at 72°C for 10 min.

[0040] Furthermore, the purification process of the recombinant proteins Trx-His-VP0 and Trx-His-VP1 in step 2 of the present invention is as follows:

[0041] A 100 ml of the precipitate from E. coli culture BL21-pET-VP0 and Rosetta-pET-VP1 was dissolved in resuspension buffer (20 mM Tris-HCl, pH 8.0), subjected to ultrasonic disruption, centrifuged at 12000 r / min, and the precipitate was resuspended in 10 ml of dissolution buffer (8 M urea, 20 mM Tris-HCl, 0.5 M NaCl, 10 mM imidazole, pH 8.0);

[0042] B. Equilibrate the purification column with 10 ml of lysis buffer and repeat twice;

[0043] C. Add 10 mL of the solution for resuspending the precipitate to the treated purification column and suspend the resin on a horizontal shaker to allow the protein to react with Ni. + The resin is fully combined and allowed to react at room temperature for 30 to 60 minutes, and the liquid passing through the column is collected;

[0044] D. Wash the non-specifically bound impurities with 3 column volumes of dissolution buffer, 3 column volumes of elution buffer 1 (8 M urea, 20 mM Tris-HCl, 0.5 M NaCl, 20 mM imidazole, pH 8.0), and 3 column volumes of elution buffer 2 (8 M urea, 20 mM Tris-HCl, 0.5 M NaCl, 40 mM imidazole, pH 8.0), and collect the washings;

[0045] E. Add 8 mL of elution buffer (8 M urea, 20 mM Tris-HCl, 0.5 M NaCl, 500 mM imidazole, pH 8.0), incubate at room temperature for 30 min, and collect in a centrifuge tube;

[0046] After the protein content was determined by UV spectrophotometer, a small amount of the purified product was taken for SDS-PAGE and thin layer scanning to further determine the yield and purity after purification.

[0047] Furthermore, the purification process of the recombinant protein GST-VP3 in step 2 of the present invention is as follows:

[0048] A. Dissolve 100 ml of the precipitate from the E. coli culture Rosetta-pGEX-VP3 in 10 ml of PBS, perform ultrasonic disruption, and centrifuge at 12000 r / min to collect the precipitate.

[0049] B. Resuspend the precipitate in 10 ml of PBS containing 1 M urea, perform ultrasonic disruption, centrifuge at 12000 r / min, and collect the supernatant and precipitate;

[0050] C. Resuspend the precipitate in 10 ml of PBS containing 2 M urea, perform ultrasonic disruption, centrifuge at 12000 r / min, and collect the supernatant and precipitate;

[0051] D. Resuspend the precipitate in 10 ml of PBS containing 8 M urea, perform ultrasonic disruption, and centrifuge at 12000 r / min until the precipitate is completely dissolved;

[0052] E After the protein content was determined by UV spectrophotometer, a small amount of the purified product was taken for SDS-PAGE and thin layer scanning to further determine the yield and purity after purification.

[0053] Furthermore, the calculation formula of the S / P value in step 2 of the present invention is S / P = (sample OD 450nm - Negative control OD 450nm ) / (positive control OD 450nm - Negative control OD 450nm ).

[0054] Furthermore, the specific determination result process in step three of the present invention is:

[0055] 1. Cloning of structural genes and antigenicity analysis

[0056] After RT-PCR amplification, three products of about 750 bp in size were obtained, which was consistent with the expected results. The target gene was cloned into pMD18-T. Agarose gel electrophoresis showed that the positive recombinant plasmids T-VP0, T-VP3 and T-VP1 identified by PCR and restriction endonuclease could obtain three target fragments of about 750 bp in size. The structural genes VP0, VP3 and VP1 were composed of 768, 711 and 714 nucleotides, respectively. Deduced into amino acids, they encoded 256, 237 and 238 amino acids, respectively. After splicing, the complete P1 region sequence was obtained. The surface accessibility, hydrophilicity and antigenic index of the P1 region structural protein were analyzed by the Protean program. It was found that the 257-276aa, 433-444aa and 703-713aa of the structural protein showed higher accessibility, hydrophilicity and antigenic index. The first two sites were located in the VP3 protein, and the third site was located in the VP1 protein.

[0057] 2. Identification of prokaryotic expression vectors of structural genes

[0058] The positive recombinant plasmid pET-VP0 was double-digested with EcoR I / Xho I enzymes to obtain a target fragment of about 750 bp and a vector fragment of about 5900 bp, which was consistent with the expected size;

[0059] The positive recombinant plasmid pGEX-VP3 was double-digested with BamH I / Xho I to obtain a target fragment of about 750 bp and a vector fragment of about 4900 bp, which was consistent with the expected size;

[0060] The positive recombinant plasmid pET-VP1 was double-digested with EcoR I / Xho I to obtain a target fragment of about 750 bp and a vector fragment of about 5900 bp, which was consistent with the expected size;

[0061] The above results prove that the target gene has been inserted into the multiple cloning site of the expression vector;

[0062] 3. SDS-PAGE test results of recombinant protein expression

[0063] pET-VP0 was transformed into expression bacteria BL21, pET-VP1 and pGEX-VP3 were transformed into expression bacteria Rosetta-gami (DE3) pLysS, and after induction, SDS-PAGE detection showed that the specific fusion protein Trx-His-VP0 was expressed at 49kD, the specific fusion protein GST-VP3 was expressed at 52kD, and the specific protein Trx-His-VP1 was expressed at 47kD, respectively. The uninduced bacteria and the empty vector induced control bacteria had no such specific protein bands.

[0064] 4. Purification results of recombinant protein

[0065] After purification, three fusion proteins were obtained. The protein contents of the three fusion proteins Trx-His-VP0, GST-VP3 and Trx-His-VP1 were 0.4 mg / ml, 1.0 mg / ml and 0.2 mg / ml respectively as determined by UV spectrophotometer.

[0066] 5. Antigenicity analysis results of recombinant proteins

[0067] The purified proteins were subjected to SDS-PAGE electrophoresis and then transferred to nitrocellulose membrane for Western Blot analysis. The results showed that all three recombinant proteins could react with DHV-1 positive serum, while the purified vector fusion tag protein had no such reaction band, indicating that the induced expressed DHV-1 recombinant structural protein had good reactivity.

[0068] The three purified recombinant proteins Trx-His-VP0, GST-VP3 and Trx-His-VP1 were coated on ELISA plates at the same dose, and the standard negative and positive serum were detected by indirect ELISA method. Three replicates were made for each recombinant protein to each positive and negative serum, and the average value was calculated. Compared with the tag protein, the recombinant protein reacted more strongly with the positive serum, with a higher P / N ratio, and the tag protein had less effect on the recombinant protein. The expressed recombinant protein had good antigenicity.

[0069] 6. Establishment of indirect ELISA method for DHV-1 antibody

[0070] 6.1. Homogeneity of ELISA plate

[0071] The detachable ELISA plate used has a smooth, flat, transparent surface, no scratches, bubbles or impurities, and a good appearance. The average value of the ELISA plate is 1.343, and the coefficient of variation is 3.1%. The uniformity is good and meets the test requirements.

[0072] 6.2 Determination of Antigen Coating Amount and Serum Dilution

[0073] When the coating antigen concentration is 90 ng / well and the serum is diluted 1:200, the OD of positive serum and negative serum450 The ratio (P / N) is the highest;

[0074] 6.3. Determination of serum action time

[0075] The antigen was coated on the ELISA plate at 90 ng / well, and the serum was diluted 1:200. When the serum was exposed for 60 min, the OD of the positive serum and the negative serum was 450 The ratio was the highest, and the serum action time was determined to be 60 min;

[0076] 6.4. Determination of the working concentration of enzyme-labeled antibodies

[0077] When the working concentration of enzyme-labeled secondary antibody is 1:4000, the OD of positive serum and negative serum 450 The ratio (P / N) was the highest, and the working concentration of the enzyme-labeled secondary antibody was determined to be 1:4000;

[0078] 6.5. Determination of the action time of enzyme-labeled antibodies

[0079] When the enzyme-labeled secondary antibody action time is 60 minutes, the OD of positive serum and negative serum 450 The ratio (P / N) was the highest, and the action time of the enzyme-labeled secondary antibody was determined to be 60 min;

[0080] 6.6. Determination of blocking solution

[0081] When blocked with 5% skim milk, the OD of positive serum and negative serum 450 The ratio (P / N) is the highest, negative serum OD 450nm The value was low, and 5% skim milk was determined as the blocking agent;

[0082] 6.7. Determination of substrate color development time

[0083] When the substrate color development time was 15 minutes, the OD of positive serum and negative serum 450 The ratio (P / N) was the highest, and the substrate color development time was determined to be 15 min;

[0084] 6.8. Determination of the judgment criteria for the indirect ELISA method

[0085] Among the 131 DHV duckling negative serum samples tested by serum neutralization, OD 450 The values ​​were distributed between 0.006 and 0.25, of which 86% of the serum samples were below 0.2. The data were normally distributed and could be used as the basis for establishing the judgment standard. The serum data were statistically processed, and the serum mean and standard deviation were X = 0.122, SD = 0.055, X + 2SD = 0.232, and X + 3SD = 0.287, respectively. According to the principle of statistics, when the serum OD 450When the value is ≥X+3S, it can be judged as positive at the level of 99.7%; when the serum OD 450 When the value is ≤X+2S, it is judged as negative. Therefore, the judgment standard of indirect ELISA is obtained. The S / P value ≥0.75 is judged as positive, and the S / P value ≤0.55 is judged as negative. The value between the two is suspicious and needs to be retested. If the test result is still less than 0.75, it is judged as negative. When the standard positive / negative serum ratio is less than 2.1, the experiment is invalid;

[0086] 6.9. Sensitivity test results

[0087] When the DHV positive control serum was tested, the S / P value was 0.78 when the serum was diluted to 3200 times, and the result was still positive, indicating that the established method has good sensitivity;

[0088] 6.10. Specificity test results

[0089] The positive sera of DP, AI, RA, DEV, RE, AR and MDP were tested, and the results showed that the established ELISA method had no cross reaction with the positive sera of the other 7 duck diseases, and all were negative.

[0090] 6.11 Blocking test

[0091] The standard positive and negative serum were diluted with virus suspension of different concentrations and incubated at 37℃ for 1 hour. The percentage of OD value decrease was calculated by indirect ELISA. The OD value of positive serum decreased significantly with the increase of virus suspension content. The OD value of serum sample completely diluted by virus suspension decreased by 67.85%, while the OD absorption value of negative serum was almost unaffected.

[0092] Take 4 positive sera and 2 negative sera and dilute them with 60% virus solution. Set up untreated controls and detect OD by indirect ELISA. 450 The OD value of positive serum after being treated with virus suspension decreased significantly, but it had no effect on negative serum.

[0093] 6.12 Comparison test results

[0094] Comparing the ELISA test results of 10 sera with the serum neutralization test results, the coincidence rate was 100%.

[0095] The present invention has the following beneficial effects: after adopting the above technical scheme, the present invention expresses the full-length structural proteins VP1, VP0 and VP3 of DHV-1, and experiments prove that the VP3 protein has good serum reactivity. Blot and indirect ELISA tests confirmed that the three recombinant proteins all had good antigenicity; under the premise of the same antigen amount, VP3 had the strongest reaction with DHV-1 positive serum, and a serum antibody ELISA detection method was established using the recombinant VP3 protein as the coating antigen to provide a guarantee for the prevention of duck viral hepatitis. A DHV-1 antibody ELISA detection method was established using the purified VP3 recombinant protein as the diagnostic antigen. The method had good specificity and did not cross-react with duck cholera, duck enteritis virus, duck influenza virus, Riemerella anatipestifer, duck reovirus and Muscovy duck parvovirus sera; the method could be blocked by duck hepatitis virus, the method had good sensitivity, and a comparison study with the serum neutralization test showed a high coincidence rate. The method could be used for epidemiological research on DHV-1. The present invention had good specificity, did not cross-react with other viruses, and could also be blocked by duck hepatitis virus. In addition, the method also had good sensitivity, and a comparison study with the serum neutralization test showed a high coincidence rate. BRIEF DESCRIPTION OF THE DRAWINGS

[0096] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0097] Figure 1 This is an electrophoresis diagram of the RT-PCR amplification results of the structural gene of the present invention, in which M represents the DNA molecular weight standard DL2000; 1 represents the negative control; 2 represents the VP0 PCR amplification product; 3 represents the VP3 PCR amplification product; and 4 represents the VP1 PCR amplification product.

[0098] Figure 2 This is an electrophoresis diagram of the results of enzyme digestion and PCR identification of the recombinant plasmid of the present invention. In the figure, M1 represents the DNA molecular weight standard DL2000; M2 represents the DNA molecular weight standard DL15000; 1 represents the T-VP0 PCR identification result; 2 represents the T-VP03 PCR identification result; 3 represents the T-VP1 PCR identification result; 4 represents the EcoRI / Xho I enzyme digestion identification of T-VP0; 5 represents the BamHI / XhoI enzyme digestion identification of T-VP3; 6 represents the EcoRI / XhoI enzyme digestion identification of T-VP1.

[0099] Figure 3This is a comparative diagram of the hydrophilicity, antigenic index and surface accessibility analysis of the structural protein of the present invention.

[0100] Figure 4 The electrophoresis diagram is the result of enzyme digestion identification of the recombinant expression plasmid of the present invention, in which M represents the DNA molecular weight standard DL15 000; 1 represents the EcoR I / Xho I enzyme digestion identification of pET-VP0; 2 represents the BamH I / Xho I enzyme digestion identification of pGEX-VP3; 3 represents the EcoR I / Xho I enzyme digestion identification of pET-VP1.

[0101] Figure 5 The figure is an SDS-PAGE electrophoresis diagram of the recombinant protein expression of the present invention, in which M represents a low molecular weight standard protein; 1 represents an induced pET-32a vector control bacterium; 2 represents an uninduced pET-VP0 bacterium; 3 represents an induced pET-VP0 bacterium; 4 represents an induced pGEX-6p-1 vector control bacterium; 5 represents an uninduced pGEX-VP3 bacterium; 6 represents an induced pGEX-VP3 bacterium; 7 represents an induced pET-32a vector control bacterium; 8 represents an uninduced pET-VP1 bacterium; and 9 represents an induced pET-VP1 bacterium.

[0102] Figure 6 This is an electrophoresis diagram of the purification result of the recombinant protein of the present invention, in which M represents a low molecular weight protein standard; 1 represents the induced pET-VP0 whole cell; 2 represents the purified Trx-His-VP0; 3 represents the induced pGEX-VP3 whole cell; 4 represents the purified GST-VP3; 5 represents the induced pET-VP1 whole cell; and 6 represents the purified Trx-His-VP1.

[0103] Figure 7 This is an electrophoresis diagram of the Western Blot detection result of the present invention, in which M represents the prestained protein molecular weight standard; 1 represents purified pGEX-VP3; 2 represents purified GST tag; 3 represents purified pET-VP0; 4 represents purified Trx-His fusion tag; and 5 represents purified pET-VP1.

[0104] Figure 8 It is a comparison chart of the indirect ELISA detection results of Trx-His-VP0, GST-VP3, Trx-His-VP1, Trx-His·Tag and GST·Tag of the present invention. DETAILED DESCRIPTION

[0105] The preferred embodiments of the present invention are described in detail below in conjunction with the accompanying drawings so that the advantages and features of the present invention can be more easily understood by those skilled in the art, thereby making a clearer and more definite definition of the protection scope of the present invention.

[0106] The present invention provides a method for establishing duck hepatitis virus antibody ELISA detection, which comprises the following specific steps:

[0107] 1. Materials

[0108] 1.1 Experimental animals and serum

[0109] Ducks and duck embryos were provided. Duck hepatitis (DH) negative and positive sera were purchased from the Chinese Veterinary Drug Review, Inspection and Supervision Agency. Duck virus enteritis (DVE) positive serum, duck pasteurella multocida (DPM) positive serum, Riemerella anatipestifer (RA) positive serum, avian influenza (AI) positive serum, duck reticuloendotheliosis (RE) positive serum, duck reovirus (Reo) positive serum and duck parvovirus (MDP) positive serum were kept by the applicant.

[0110] 1.2 Main Reagents

[0111] DHV-1 strain was isolated and preserved by our company. LATaq DNA polymerase, restriction endonuclease Bam HI, Xho I, EcoR I, T4 DNA ligase, DNA Marker DL2000, low melting point agarose, IPTG, dNTPs, and pMD18-T vector were purchased from Dalian Bao Biotechnology Co., Ltd. The competent cell line E. coli TG1 was purchased from Stratagene; E. coli BL21 (DE3) and Rosetta-gami (DE3) pLysS were purchased from Novagen; the prokaryotic expression vectors pET-32a (+) and pGEX-6p-1 were preserved by our company; horseradish peroxidase-labeled (HRP) goat anti-duck IgG was purchased from KPL; Tris Base and Promega, 3,3′,5,5′-tetramethylbenzidine (TMB) substrate colorimetric solution was a product of Taitianhe Company, skim milk was a product of BD Company, 96-well detachable ELISA plate was a product of JET Co., Ltd., Tween-20 was a product of SIGMA Company, coating solution, blocking solution, serum diluent and enzyme-labeled secondary antibody dilution solution, washing solution and stop solution (2M H2SO4) were all prepared and stored by the applicant.

[0112] 1.3 Main instruments and equipment

[0113] Desktop low-temperature high-speed centrifuge: Beckman Avanti30; ultra-high-speed centrifuge: Beckman; PCR cycler: GeneAmp PE2400; ultra-clean bench: Froma Scientific; biosafety level II operation cabinet (LABLONCOPURIER), air bath oscillator (HZQ-C type, Harbin Donglian Electronics Co., Ltd.); constant temperature water bath DK-80 type, Shanghai Jinghong Experimental Equipment Co., Ltd.; constant temperature incubator, Shanghai Yuejin Medical Equipment Factory No. 1; pH meter, METER; nucleic acid electrophoresis instrument, Beijing Liuyi Instrument Factory; ultrasonic crusher, PARMER; low temperature refrigerator, Revco; DYYIII-31A / 31B electrophoresis tank and DYYIII-2 constant voltage and constant current electrophoresis instrument, Beijing Liuyi Instrument Factory; WFH-201 ultraviolet transmission analyzer, Shanghai Jingliao Industrial Co., Ltd.; Kadak gel imaging analysis system, a product of Kodak Company, USA; vortex mixer QL-901, Jiangsu Haimen Qilin Medical Instrument Factory; electronic balance, Mettler AE240.

[0114] 1.4 Primers

[0115] Primers were designed with reference to the nucleotide sequences of the structural genes VP0, VP3 and VP1 of the DHV-1 strain (EU753359), and restriction sites and protective bases were inserted into them. The stop codon TAA was added to the downstream primers (Table 1-1). The primers were synthesized by Ruibo Xingke Technology Service Co., Ltd. and diluted to a concentration of 10 pmol / μL before use.

[0116] Table 1-1 Primer sequences for PCR amplification of structural genes

[0117] Table 1-1 Primers sequence of structure genes for PCR

[0118]

[0119] 2 Methods

[0120] 2.1 Cloning of structural genes and antigenicity analysis

[0121] Viral RNA was extracted by TRIzol method, and reverse transcription was performed with Random Primer 6mer as primer. The structural genes VP0, VP3 and VP1 were amplified from the synthesized cDNA using the above-mentioned specific primers. The PCR reaction parameters were as follows: denaturation at 95°C for 5 min; denaturation at 94°C for 30 sec, annealing at 50°C for 30 sec, extension at 72°C for 1 min, 30 cycles, and extension at 72°C for 10 min. After the reaction, 5 μL of each PCR product was taken and subjected to 10 g / L agarose gel electrophoresis to recover the target bands that matched the expected size. The recovered and purified three structural genes were cloned into pMD18-T vector and transferred into competent cells E. coli TG1, and positive plasmids were identified by enzyme digestion and PCR, and named T-VP0, T-VP3 and T-VP1, respectively. The sequencing results of the positive T-VP0, T-VP3 and T-VP1 plasmids were compared with the gene sequence of the DHV-1 standard strain, and the hydrophilicity, surface accessibility and antigenicity of each structural protein were analyzed using Protean biological software. The plasmids T-VP0, T-VP3 and T-VP1 were expressed with EcoRⅠ and XhoⅠ, BamⅠ and HI and XhoⅠ, EcoRⅠ and XhoⅠ were double digested, and the prokaryotic expression vectors pET-32a(+) and pGEX-6p-1 were also double digested. The target bands were recovered from the digestion gel, and the target gene was connected to the linearized vector and transformed into competent cells E.coliTG1. Single colonies on the LB plate culture medium were picked, the plasmids were extracted, and double digestion was performed for identification by restriction endonucleases. The digestion results were analyzed by agarose gel electrophoresis, and the positive recombinant expression vectors were named pET-VP0, pGEX-VP3 and pET-VP1, respectively.

[0122] 2.2 Inducible expression of positive recombinants in Escherichia coli

[0123] The recombinant expression plasmid pET-VP0 was transformed into E. coli BL21 and spread on LB agar plates containing ampicillin (100 μg / ml); the recombinant plasmids pGEX-VP3 and pET-VP1 were transformed into E. coli Rosetta-gami (DE3) pLysS and spread on LB agar plates containing 100 μg / ml ampicillin, 12.5 μg / ml tetracycline, 15 μg / ml kanamycin, and 34 μg / ml chloramphenicol. Single colonies were picked and inoculated into 3 mL of LB liquid culture medium containing corresponding resistance, and cultured at 37°C with shaking overnight. The next day, they were inoculated into fresh LB culture medium containing the same concentration of antibiotics at a ratio of 1:100. When the bacterial solution OD 600nmWhen it reaches 0.5-0.6, add IPTG to a final concentration of 1mmol / L and induce culture for 4h. At the same time, set up induced pET-32a(+) and pGEX-6p-1 empty vector host bacteria and uninduced recombinant bacteria as controls. Take 1mL of the above culture respectively, centrifuge at 5000r / min for 10min, discard the supernatant, collect the bacteria, resuspend the precipitate in 100μL PBS, add an equal volume of 2×SDS loading buffer, boil in boiling water bath for 10min, and take 15μL for 12﹪SDS-PAGE gel electrophoresis analysis.

[0124] 2.3 Expression and purification of recombinant proteins

[0125] 2.3.1 Purification of recombinant proteins Trx-His-VP0 and Trx-His-VP1

[0126] A 100 ml of the precipitate from E. coli culture BL21-pET-VP0 and Rosetta-pET-VP1 was dissolved in a resuspension buffer (20 mM Tris-HCl, pH 8.0), subjected to ultrasonic disruption, and centrifuged at 12000 r / min. The precipitate was resuspended in 10 ml of a dissolution buffer (8 M urea, 20 mM Tris-HCl, 0.5 M NaCl, 10 mM imidazole, pH 8.0).

[0127] B. Equilibrate the purification column with 10 ml of lysis buffer, repeat twice.

[0128] C. Add 10 mL of the solution for resuspending the precipitate to the treated purification column and suspend the resin on a horizontal shaker to allow the protein to react with Ni. + The resin is fully combined and allowed to react at room temperature for 30 to 60 minutes. The liquid passing through the column is collected.

[0129] D. The non-specifically bound impurities were washed with 3 column volumes of dissolution buffer, 3 column volumes of elution buffer 1 (8 M urea, 20 mM Tris-HCl, 0.5 M NaCl, 20 mM imidazole, pH 8.0), and 3 column volumes of elution buffer 2 (8 M urea, 20 mM Tris-HCl, 0.5 M NaCl, 40 mM imidazole, pH 8.0), and the washings were collected.

[0130] E. Add 8 mL of elution buffer (8 M urea, 20 mM Tris-HCl, 0.5 M NaCl, 500 mM imidazole, pH 8.0) and incubate at room temperature for 30 min. Collect the solution in a centrifuge tube.

[0131] After the protein content was determined by UV spectrophotometer, a small amount of the purified product was taken for SDS-PAGE and thin layer scanning to further determine the yield and purity after purification.

[0132] 2.3.2 Purification of recombinant protein GST-VP3

[0133] A. Dissolve 100 ml of the precipitate from the E. coli culture Rosetta-pGEX-VP3 in 10 ml of PBS and perform ultrasonic disruption. Centrifuge at 12000 r / min as above and collect the precipitate.

[0134] B. Resuspend the precipitate with 10 ml of PBS containing 1 M urea, perform ultrasonic disruption, centrifuge at 12000 r / min, collect the supernatant and precipitate,

[0135] C. Resuspend the precipitate in 10 ml of PBS containing 2 M urea, perform ultrasonic disruption, centrifuge at 12000 r / min, collect the supernatant and precipitate,

[0136] D. Resuspend the precipitate in 10 ml of PBS containing 8 M urea, perform ultrasonic disruption, and centrifuge at 12000 r / min until the precipitate is completely dissolved.

[0137] E After the protein content was determined by UV spectrophotometer, a small amount of the purified product was taken for SDS-PAGE and thin layer scanning to further determine the yield and purity after purification.

[0138] 2.4 Antigenicity analysis of recombinant proteins

[0139] 2.4.1 Western Blot Analysis

[0140] The purified recombinant proteins Trx-His-VP0, GST-VP3 and Trx-His-VP1 were subjected to SDS-PAGE electrophoresis, and the vector tags GST·Tag and Trx-His·Tag controls were set up, and then transferred to a nitrocellulose membrane, blocked with 4% horse serum at 4°C overnight, and washed five times with PBST the next day. The membrane was incubated with DHV-1 positive serum diluted 1:50 with PBST at 37°C for 1.5h, washed five times with PBST, and then incubated with horseradish peroxidase (HRP)-labeled goat anti-duck IgG diluted 1:1000 with PBST at 37°C for 1h, washed five times with PBST, and finally developed with DAB.

[0141] 2.4.2 Comparative analysis of indirect ELISA

[0142] Partially purified recombinant protein and empty vector protein were appropriately diluted and coated on a 96-well ELISA plate at 2 μg per well overnight at 4°C. Each sample was repeated in triplicate. The next day, each well was washed five times with PBST, and positive and negative serum was added at a dilution of 1:100 and incubated at 37°C for 60 min. HRP-labeled goat anti-duck IgG was diluted 1:1000 and incubated at 37°C for 60 min. After adding o-phenylenediamine substrate solution, the reaction was allowed to react in the dark for 15 min, and 2 mol / L sulfuric acid was added to terminate the reaction. The results were measured at a wavelength of 490 nm using an ELISA tester.

[0143] 2.5 Establishment of indirect ELISA method for recombinant antigen VP3

[0144] 2.5.1 ELISA plate homogeneity test

[0145] Randomly select 8 wells from various brands (Costar, Jincanhua, Jet) of ELISA plates, perform visual inspection on the ELISA plates, and preliminarily evaluate their quality. Then, the ELISA secondary antibody was diluted 2000 times and coated on the ELISA plates, 100u1 per well, overnight at 4℃, washed 4 times with PBST, soaked for 3 minutes each time; TMB substrate colorimetric solution was added, 100u1 per well; color was developed at room temperature for 15min; 2MH2SO4 was used to terminate the reaction, and OD was measured. 450nm The values ​​were calculated, the average values ​​and coefficients of variation among the ELISA wells were calculated, and whether the uniformity of different ELISA plates met the requirements was determined.

[0146] 2.5.2 Determination of Antigen Coating Concentration and Serum Dilution

[0147] VP3 recombinant protein was diluted with pH 9.6 carbonate buffer and coated in 96-well ELISA plates in five gradients of 30ng, 60ng, 90ng, 120ng, and 150ng per well, respectively, in rows A, B, C, D, and E, at 4°C overnight; DHV-1 positive serum was diluted 1:50, 1:100, 1:200, 1:400, and 1:800, respectively, and added to columns 1, 3, 5, 7, and 9 of the ELISA plate, and negative serum was added to columns 2, 4, 6, 8, and 10 at the same dilution for square array test, with serum action time of 1 hour; HRP-goat anti-duck IgG was first diluted 1:2000, and the action time was 1 hour. The OD was determined according to the method of 1.12.1. 450nm The result with the largest P / N value is selected as the antigen working amount and serum working concentration.

[0148] 2.5.3 Determination of serum action time

[0149] Carry out ELISA test with the antigen working amount and serum dilution determined in 2.5.2. The serum working time is 30min, 60min, 90min, 120min and 150min respectively. Three replicates of positive and negative serum are tested at each action time. Operate according to 1.12.1 and select the one with the largest P / N value as the primary antibody action time.

[0150] 2.5.4 Determination of the working concentration of enzyme-labeled secondary antibody

[0151] Based on the ELISA test conditions determined in 2.5.3, HRP-goat anti-duck IgG was diluted at 1:500, 1:1000, 1:2000, 1:4000, and 1:8000, respectively, with 3 replicates for each dilution. The ELISA test was performed at 37°C for 60 min. The dilution with the largest P / N value was determined as the secondary antibody dilution.

[0152] 2.5.5 Determination of the action time of enzyme-labeled secondary antibody

[0153] Based on the ELISA test conditions determined in 2.5.4, HRP-goat anti-duck IgG was diluted 1:4000 and exposed to 37℃ for 30min, 45min, 60min, 90min and 120min respectively for ELISA test. The one with the largest P / N value was determined as the working time of the secondary antibody.

[0154] 2.5.6 Experiment to determine the optimal blocking solution and concentration

[0155] Based on the ELISA test conditions determined in 2.5.5, use 5% skim milk, 8% skim milk, 1% BSA, 2% BSA, 4% horse serum, 8% horse serum, 1% fish gelatin, and 2% fish gelatin as blocking agents, respectively. Repeat 3 times for each blocking solution. Take the result with the largest P / N to determine the type of blocking agent and working concentration.

[0156] 2.5.7 Determination of substrate color development time

[0157] Based on the ELISA test conditions determined in 2.5.6, color development was performed at room temperature for 5 min, 10 min, 15 min, 20 min, and 25 min, and OD was measured after termination. 450nm The maximum P / N value is determined as the substrate color development time.

[0158] 2.5.8 Determination of positive and negative critical values ​​of indirect ELISA method

[0159] 131 negative sera from ducklings (F4 generation) bred in isolators were used for indirect ELISA assay. 450nm The values ​​were converted into S / P values ​​for statistical analysis, and the Cut-Off value method was used to determine the judgment criteria.

[0160] S / P = (sample OD 450nm - Negative control OD 450nm ) / (positive control OD 450nm - Negative control OD 450nm ).

[0161] 2.5.9 Sensitivity test

[0162] The present invention is used to detect DHV-1 positive control serum. The serum is diluted by 1:100, 1:200, 1:400, 1:800, 1:1600, and 1:3200 times. Each dilution of serum is repeated three times to determine OD 450nm The value was converted into S / P value to determine the sensitivity of the method to positive samples.

[0163] 2.5.10 Specificity test

[0164] 1.2.10.1 Cross-reactivity test

[0165] The diagnostic method was applied to detect the positive sera of Duck colibacillosis, AI, RA, DH, RE, AR and MDP, and DHV negative and positive sera were set as controls to test its specificity.

[0166] 1.2.10.2 Blocking test

[0167] Take different concentrations of DHV virus liquid and PBS, dilute the standard positive and negative serum at a ratio of 1:100, mix well and incubate at 37℃ for 1 hour, perform ELISA test on the above treated samples according to the determined conditions, measure the OD absorption value at a wavelength of 450nm after the color development stops, and calculate the percentage of OD value decrease. Take six known positive sera and two negative sera, dilute them 1:100 with 80% virus suspension, perform ELISA test, and calculate the percentage of serum OD value decrease.

[0168] 2.5.11 Comparative test

[0169] ELISA was performed on 10 serum samples to determine the test results, which were then compared with the results of the serum virus neutralization test to calculate the compliance rate of the established diagnostic method with the virus neutralization test.

[0170] 3 Results

[0171] 3.1 Cloning of structural genes and antigenicity analysis

[0172] After RT-PCR amplification, three products with a size of about 750 bp were obtained, which was consistent with the expected results. Figure 1The target gene was cloned into pMD18-T. Agarose gel electrophoresis showed that the positive recombinant plasmids T-VP0, T-VP3 and T-VP1 identified by PCR and restriction endonuclease could obtain three target fragments of about 750 bp. Figure 2 .

[0173] The structural genes VP0, VP3 and VP1 consist of 768, 711 and 714 nucleotides, respectively. Deduced into amino acids, they encode 256, 237 and 238 amino acids, respectively. After splicing, the complete P1 region sequence was obtained. By analyzing the surface accessibility, hydrophilicity and antigenic index of the P1 region structural protein using the Protean program, it was found that the 257-276aa, 433-444aa and 703-713aa of the structural protein showed higher accessibility, hydrophilicity and antigenic index. The first two sites are located in the VP3 protein, and the third site is located in the VP1 protein, see Figure 3 .

[0174] 3.2 Identification of prokaryotic expression vectors of structural genes

[0175] By double digestion of the positive recombinant plasmid pET-VP0 with EcoR I / Xho I enzymes, a target fragment of about 750 bp and a vector fragment of about 5900 bp were obtained, which were consistent with the expected size; double digestion of the positive recombinant plasmid pGEX-VP3 with BamHI / Xho I was performed, and a target fragment of about 750 bp and a vector fragment of about 4900 bp were obtained, which were consistent with the expected size; double digestion of the positive recombinant plasmid pET-VP1 with EcoR I / Xho I was performed, and a target fragment of about 750 bp and a vector fragment of about 5900 bp were obtained, which were consistent with the expected size; the above results proved that the target gene had been inserted into the multiple cloning site of the expression vector, see Figure 4 .

[0176] 3.3 SDS-PAGE detection results of recombinant protein expression

[0177] pET-VP0 was transformed into expression bacteria BL21, pET-VP1 and pGEX-VP3 were transformed into expression bacteria Rosetta-gami (DE3) pLysS. After induction, SDS-PAGE detection showed that the specific fusion protein Trx-His-VP0 was expressed at 49kD, the specific fusion protein GST-VP3 was expressed at 52kD, and the specific protein Trx-His-VP1 was expressed at 47kD. No such specific protein band was seen in the uninduced bacteria and the empty vector induced control bacteria. Figure 5 .

[0178] 3.4 Purification results of recombinant protein

[0179] After purification, three fusion proteins were obtained. The protein contents of the three fusion proteins Trx-His-VP0, GST-VP3 and Trx-His-VP1 were 0.4 mg / ml, 1.0 mg / ml and 0.2 mg / ml respectively as determined by UV spectrophotometer. The results of SDS-PAGE are shown in Figure 3-6 .

[0180] 3.5 Antigenicity analysis results of recombinant proteins

[0181] The purified proteins were subjected to SDS-PAGE electrophoresis and then transferred to a nitrocellulose membrane for Western Blot analysis. The results showed that all three recombinant proteins could react with DHV-1 positive serum, while the purified vector fusion tag protein had no such reaction band, as shown in Figure 2. Figure 7 , indicating that the induced expression of the recombinant structural protein of DHV-1 has good reactivity. The three purified recombinant proteins Trx-His-VP0, GST-VP3 and Trx-His-VP1 were coated on the ELISA plate at the same dose, and the standard negative and positive serum were detected by indirect ELISA method. Three replicates were made for each recombinant protein to each positive and negative serum, and the average value was calculated. Compared with the tag protein, the recombinant protein reacted more strongly with the positive serum, with a high P / N ratio, and the tag protein had less effect on the recombinant protein. The expressed recombinant protein has good antigenicity, see Figure 8 .

[0182] 3.6 Establishment of indirect ELISA method for DHV-1 antibody

[0183] 3.6.1 ELISA plate uniformity

[0184] The detachable ELISA plate used in this experiment has a smooth, flat, transparent surface, no scratches, bubbles or impurities, and has a good appearance. The average value of the ELISA plate produced by Jet is 1.343, the coefficient of variation is 3.1%, and the uniformity is good. It meets the test requirements as shown in Table 3-1.

[0185] Table 3-1 ELISA plate homogeneity test results

[0186]

[0187] 3.6.2 Determination of Antigen Coating Amount and Serum Dilution

[0188] The antigen coating concentration and the dilution ratio of negative and positive serum are shown in Table 3-2. When the coating antigen concentration is 90 ng / well and the serum is diluted 1:200, the OD of positive serum and negative serum is 450 The ratio (P / N) is the highest.

[0189] Table 3-2 Determination of the optimal coating concentration of antigen and the optimal dilution of serum

[0190]

[0191] 3.6.3 Determination of serum action time

[0192] The antigen was coated on the ELISA plate at 90 ng / well, and the serum was diluted 1:200. When the serum was exposed for 60 min, the OD of the positive serum and the negative serum was 450 The ratio is the highest, and the serum action time is determined to be 60 minutes (see Table 3-3).

[0193] Table 3-3 Determination of the optimal action time of serum

[0194]

[0195] 3.6.4 Determination of the working concentration of enzyme-labeled antibodies

[0196] When the working concentration of the enzyme-labeled secondary antibody is 1:4000, the OD450 ratio (P / N) of the positive serum to the negative serum is the highest. The working concentration of the enzyme-labeled secondary antibody is determined to be 1:4000, see Table 3-4.

[0197] Table 3-4 Determination of enzyme-labeled antibody working concentration

[0198]

[0199] 3.6.5 Determination of the action time of enzyme-labeled antibodies

[0200] When the enzyme-labeled secondary antibody action time is 60 minutes, the OD450 ratio (P / N) of the positive serum to the negative serum is the highest. The enzyme-labeled secondary antibody action time is determined to be 60 minutes, see Table 3-5.

[0201] Table 3-5 Determination of the action time of enzyme-labeled antibodies

[0202]

[0203] 3.6.6 Determination of blocking solution

[0204] When blocked with 5% skim milk, the OD of positive serum and negative serum 450 The ratio (P / N) is the highest, negative serum OD 450nm The value is low, and 5% skim milk is determined as the sealing agent, see Table 3-6.

[0205] Table 3-6 ELISA test results for determining blocking solution

[0206]

[0207] 3.6.7 Determination of substrate color development time

[0208] When the substrate color development time was 15 minutes, the OD of positive serum and negative serum 450 The ratio (P / N) is the highest, and the substrate color development time is determined to be 15 minutes, see Table 3-7.

[0209] Table 3-7 Determination of substrate color development time

[0210]

[0211] 3.6.8 Determination of the judgment criteria for the indirect ELISA method

[0212] Among the 131 DHV duckling negative serum samples tested by serum neutralization, OD 450 The values ​​were distributed between 0.006 and 0.25, of which 86% of the serum samples were below 0.2. The data were normally distributed and could be used as the basis for establishing the judgment standard. The serum data were statistically processed, and the serum mean and standard deviation were X = 0.122, SD = 0.055, X + 2SD = 0.232, and X + 3SD = 0.287, respectively. According to the principle of statistics, when the serum OD 450 When the value is ≥X+3S, it can be judged as positive at the level of 99.7%; when the serum OD 450 When the value is ≤X+2S, it is judged as negative. Therefore, the judgment standard of indirect ELISA is obtained. The S / P value ≥0.75 is judged as positive, and the S / P value ≤0.55 is judged as negative. The value between the two is suspicious and needs to be retested. If the test result is still less than 0.75, it is judged as negative. The experiment is invalid when the standard positive / negative serum ratio is less than 2.1.

[0213] 3.6.9 Sensitivity test results

[0214] When the DHV positive control serum was tested, when the serum was diluted to 3200 times, the S / P value was 0.78 and the result was still positive, indicating that the established method has good sensitivity.

[0215] 3.6.10 Specificity test results

[0216] The positive sera of DP, AI, RA, DEV, RE, AR and MDP were tested. The results showed that the established ELISA method had no cross reaction with the positive sera of the other 7 duck diseases, and all were negative, as shown in Table 3-8.

[0217] Table 3-8 Cross-reaction test results

[0218]

[0219] 3.6.11 Blocking test

[0220] Standard positive and negative sera were diluted with virus suspensions of different concentrations and incubated at 37°C for 1 hour. The percentage decrease in OD value was calculated by indirect ELISA (see Table 3-9). The OD value of positive serum decreased significantly with the increase in the content of virus suspension. In the serum sample completely diluted by virus suspension, the OD value decreased by 67.85%, while the OD absorption value of the control negative serum was almost unaffected.

[0221] Take 4 positive sera and 2 negative sera and dilute them with 60% virus solution. Set up untreated controls and detect OD by indirect ELISA. 450 The OD value changes are shown in Table 3-10. After the positive serum was treated with the virus suspension, the OD value decreased significantly, but it had no effect on the negative serum.

[0222] Table 3-9 Virus blocking standard positive serum test results

[0223]

[0224] Table 3-10 Virus blocking reaction test results of serum samples to be tested

[0225]

[0226] 3.6.12 Comparison test results

[0227] Comparing the ELISA test results of 10 serum samples with the serum neutralization test results, the compliance rate is 100%. See Table 3-11.

[0228] Table 3-11 Comparison of DHV indirect ELISA and serum neutralization test

[0229]

[0230] in conclusion:

[0231] In small RNA viruses, the structural proteins of the P1 region (VP0, VP3 and VP1) contain the main antigenic sites of the virus and participate in many important processes of virus replication, including receptor binding and virion packaging. The structural proteins of the P1 region can induce the body's immune response. VP1 to VP3 all play an important role in the antigenic structure of small RNA viruses. In particular, FMDV has been studied more deeply on VP3 and VP1. Its main antigenic sites are mainly located on VP1, but VP0 and VP3 also play an important role in the antigenic structure of viral particles and can participate in the formation of antigenic sites. In human parechovirus (HPeV; Ljunganvirus, LV), the VP3 N-terminus has an amino acid-rich region of 18aa and 21-25aa, respectively (Johansson et al., 2002). This short peptide has a strong immunogenicity in HPeV (Joki-Korpela et al., 2003). al., 2000). The present invention analyzed by biological software that a short peptide with high surface accessibility, hydrophilicity and antigenic index also appeared in 257-276aa of the P1 region of DHV-1, i.e., 1-20aa of the N-terminus of VP3. It is speculated that this region may also have immunogenicity like HPeV. In addition, the analysis of the Protean program showed that 433-446aa and 698-716aa of the P1 region were located at 205-223aa of VP3 and 177-190aa of VP1, respectively, with high surface accessibility, hydrophilicity and antigenic index. It is speculated that they may also be the main antigenic sites of VP3 and VP1. Compared with VP3 and VP1, the predicted surface accessibility, hydrophilicity and antigenic index of VP0 are relatively low. It is speculated that the antigenicity of VP0 is not as ideal as that of VP3 and VP1.

[0232] In the present invention, the antigenicity of the expressed full-length VP0, VP3 and VP1 recombinant proteins was analyzed by Western Blot and indirect ELISA methods, and it was found that the three fusion proteins could react with duck anti-DHV-1 positive serum, indicating that they had good antigenicity. The indirect ELISA results showed that at the same coating concentration, the P / N value of the fusion protein GST-VP3 as the coating antigen was higher than the P / N value of the Trx-His-VP0 and Trx-His-VP1 as the coating antigen, indicating that the antigenicity of the fusion protein GST-VP3 was better than that of Trx-His-VP0 and Trx-His-VP1. Trx-His-VP1, and it is also consistent with the predicted results. The present invention obtains full-length VP0, VP3 and VP1 recombinant structural proteins. The ELISA results show that under the premise of equal antigen amount, GST-VP3 reacts most strongly with DHV-1 positive serum. The full-length VP3 protein is used as the diagnostic antigen, and more antigenic epitopes of the virus are retained. The established ELISA method is verified by specificity test, sensitivity test and coincidence test, meets the requirements of diagnostic reagents, and can serve the epidemiological research of duck hepatitis virus and the evaluation of immune effect of duck flocks.

[0233] Without limitation to this, any changes or substitutions that are not conceived through creative work should be covered within the protection scope of the present invention patent. Therefore, the protection scope of the present invention patent should be based on the protection scope defined in the claims.

Claims

1. A method for setting up duck hepatitis virus antibody ELISA detection, it comprises the following steps: Step 1: Prepare experimental materials, which mainly include experimental animals, virus serum, experimental reagents, instruments and equipment, and synthesize primers; Step 2: Experimental testing method: (1) Cloning and antigenicity analysis of structural genes: Viral RNA was extracted using the TRIzol method and reverse transcribed using Random Primer6mer as a specific primer. The structural genes VP0, VP3 and VP1 were amplified from the synthesized cDNA using PCR reaction using the above specific primers. After the PCR reaction, 5 μL of each PCR product was taken and subjected to 10 g / L agarose gel electrophoresis to recover the target bands that matched the expected size. The recovered and purified three structural genes were cloned into the pMD18-T vector and transferred into competent cells. E. coli TG1, and positive plasmids were identified by enzyme digestion and PCR, and named T-VP0, T-VP3 and T-VP1 respectively. The sequencing results of T-VP0, T-VP3 and T-VP1 plasmids identified as positive were compared with the gene sequence of DHV-1 standard strain, and Protean biological software was used to analyze the hydrophilicity, surface accessibility and antigenicity of each structural protein. Plasmids T-VP0, T-VP3 and T-VP1 were respectively EcoR Ⅰ and XOt Ⅰ. Bam HI and XOt Ⅰ. EcoR Ⅰ and XOt Ⅰ Double enzyme digestion, the prokaryotic expression vector pET-32a (+) and pGEX-6p-1 were also double enzyme digested, and the target band was recovered from the enzyme digestion gel. The target gene was connected to the linearized vector and transformed into competent cells E. coli TG1. Pick a single colony on the LB plate medium, extract the plasmid, perform double digestion identification with restriction endonucleases, analyze the digestion results with agarose gel electrophoresis, and name the positive recombinant expression vectors pET-VP0, pGEX-VP3, and pET-VP1 respectively; (2) Induced expression of positive recombinants in E. coli: The recombinant expression plasmid pET-VP0 was transformed into E. coli BL21 was plated on LB agar plates containing ampicillin (100 μg / ml); the recombinant plasmids pGEX-VP3 and pET-VP1 were transformed E. coli Rosetta-gami(DE3)pLysS was spread on LB agar plates containing 100μg / ml ampicillin, 12.5μg / ml tetracycline, 15μg / ml kanamycin, and 34μg / ml chloramphenicol. Single colonies were picked and inoculated into 3mL LB liquid medium containing corresponding resistances, and cultured at 37℃ with shaking overnight. The next day, the colonies were inoculated into fresh LB medium containing the same concentration of antibiotics at a ratio of 1:

100. When the bacterial solution OD 600nm When the p-value reached 0.5-0.6, IPTG was added to a final concentration of 1 mmol / L, and the culture was induced for 4 h. At the same time, the induced pET-32a(+) and pGEX-6p-1 empty vector host bacteria and the uninduced recombinant bacteria were set up as controls. 1 mL of the above culture was taken respectively, centrifuged at 5000 r / min for 10 min, the supernatant was discarded, the bacteria were collected, the precipitate was resuspended in 100 μL PBS, an equal volume of 2×SDS loading buffer was added, and the mixture was boiled in a water bath for 10 min. 15 μL was taken for 12﹪SDS-PAGE gel electrophoresis analysis; (3) Expression and purification of recombinant proteins, including purification of recombinant proteins Trx-His-VP0 and Trx-His-VP1 and purification of recombinant protein GST-VP3; (4) Antigenicity analysis of recombinant proteins: First, the Western Blot method was used for analysis. The purified recombinant proteins Trx-His-VP0, GST-VP3 and Trx-His-VP1 were subjected to SDS-PAGE electrophoresis, and the vector tags GST·Tag and Trx-His·Tag were set up as controls. Then, they were transferred to nitrocellulose membranes and blocked with 4% horse serum at 4°C overnight. The next day, they were washed 5 times with PBST, and incubated with DHV-1 positive serum diluted 1:50 with PBST at 37°C for 1.5h. After washing 5 times with PBST, they were incubated with horseradish peroxidase (HRP) labeled goat anti-duck IgG diluted 1:1000 with PBST at 37°C for 1h. After washing 5 times with PBST, DAB was used for color development, and then indirect ELISA was performed for comparative analysis. After appropriate dilutions of partially purified recombinant proteins and empty vector proteins, 2μg per well was coated on 96-well ELISA plates at 4°C overnight, and 3 wells were repeated for each sample. The next day, each well was washed five times with PBST, and positive and negative serum was added at a dilution of 1:100, and incubated at 37°C for 60 min. HRP-labeled goat anti-duck IgG was diluted 1:1000 and incubated at 37°C for 60 min. After adding o-phenylenediamine substrate solution, the reaction was carried out in dark for 15 min, and 2 mol / L sulfuric acid was added to terminate the reaction. The results were measured at a wavelength of 490 nm using an enzyme label tester. (5) Establishment of indirect ELISA method for recombinant antigen VP3: (5A) First, perform a uniformity test on the ELISA plate: randomly select 8 wells from the ELISA plate, perform a visual inspection on the plate, and preliminarily evaluate its quality. Then, dilute the secondary antibody 2000 times and coat the plate, 100 u1 per well, incubate at 4°C overnight, wash 4 times with PBST, soak for 3 minutes each time; add TMB substrate colorimetric solution, 100 u1 per well; color develop at room temperature for 15 minutes; terminate the reaction with 2M H2SO4, and measure OD 450nm Values, calculate the average value and coefficient of variation between each ELISA well, and determine whether the uniformity of different ELISA plates meets the requirements; (5B) Determination of antigen coating concentration and serum dilution: VP3 recombinant protein was diluted with pH 9.6 carbonate buffer and coated on rows A, B, C, D, and E of a 96-well ELISA plate at 5 gradients of 30 ng, 60 ng, 90 ng, 120 ng, and 150 ng per well, respectively, and incubated at 4°C overnight; DHV-1 positive serum was diluted 1:50, 1:100, 1:200, 1:400, and 1:800, respectively, and added to columns 1, 3, 5, 7, and 9 of the ELISA plate, and negative serum was added to columns 2, 4, 6, 8, and 10 at the same dilution for a square array test, with a serum action time of 1 hour; HRP-goat anti-duck IgG was first diluted 1:2000 and the action time was 1 hour. The OD was determined according to the above 5A determination method. 450nm The result with the largest P / N value is selected as the antigen working amount and serum working concentration; (5C) Determination of serum action time: ELISA test was performed with the antigen working amount and serum dilution determined in 5B. The serum working times were 30 min, 60 min, 90 min, 120 min and 150 min, respectively. Three replicates were performed for each positive and negative serum action time. The operation was performed according to the method in 5B. The larger P / N value was selected as the primary antibody action time. (5D) Determination of the working concentration of enzyme-labeled secondary antibody: Based on the ELISA test conditions determined in 5C, HRP-goat anti-duck IgG was diluted at 1:500, 1:1000, 1:2000, 1:4000, and 1:8000, respectively. Each dilution was repeated 3 times. The ELISA test was performed at 37°C for 60 min. The dilution with the largest P / N value was determined as the secondary antibody dilution. (5E) Determination of the action time of enzyme-labeled secondary antibody: Based on the ELISA test conditions determined in 5D, HRP-goat anti-duck IgG was diluted 1:4000 and exposed at 37°C for 30 min, 45 min, 60 min, 90 min and 120 min, respectively, to conduct ELISA test. The one with the largest P / N value was determined as the working time of the secondary antibody. (5F) Determination of the best blocking solution and concentration: Based on the ELISA test conditions determined in 5E, 5% skim milk, 8% skim milk, 1% BSA, 2% BSA, 4% horse serum, 8% horse serum, 1% fish gelatin, and 2% fish gelatin were used as blocking agents, respectively. Each blocking solution was repeated 3 times, and the result with the largest P / N was taken to determine the type of blocking agent and working concentration; (5G) Determination of substrate color development time: Based on the ELISA test conditions determined in 5F, color development was performed at room temperature for 5 min, 10 min, 15 min, 20 min, and 25 min, respectively. After termination, OD was measured. 450nm The maximum P / N value is defined as the substrate color development time; (5H) Determination of the positive and negative critical value of the indirect ELISA method: Take the prepared negative serum and perform indirect ELISA determination. 450nm The values ​​were converted into S / P values ​​for statistical analysis, and the judgment criteria were determined using the Cut-Off value method; (5I) Sensitivity test: This diagnostic method was used to detect DHV-1 positive control serum. The serum was diluted 1:100, 1:200, 1:400, 1:800, 1:1600, and 1:3200 times. Each dilution of serum was repeated three times and the OD was measured. 450nm The value was converted into S / P value to determine the sensitivity of the method to positive samples; (5J) Specificity test: First, a cross-reaction test was conducted. The method was applied to detect positive sera of duck colibacillosis, AI, RA, DH, RE, AR and MDP. At the same time, DHV negative and positive sera were set as controls to detect its specificity. Then, a blocking test was conducted. Different concentrations of DHV virus solution and PBS were taken, and the standard positive and negative sera were diluted at a ratio of 1:

100. After mixing, the mixture was incubated at 37°C for 1 hour. According to the determined conditions, the above-treated samples were subjected to ELISA assay. After the color development was stopped, the OD absorption value was measured at a wavelength of 450nm, and the percentage of OD value decrease was calculated. Six known positive sera and two negative sera were taken, and diluted 1:100 with 80% virus suspension, and ELISA assay was performed to calculate the percentage of serum OD value decrease. Finally, a comparative test was conducted. ELISA assay was performed on 10 serum samples to determine the test results. At the same time, the results were compared with the results of serum virus neutralization test, and the compliance rate of the established method with the virus neutralization test was calculated. Step 3. After analysis, a short peptide with high surface accessibility, hydrophilicity and antigenic index also appeared in 257-276aa of the P1 region of DHV-1, i.e. 1-20aa of the N-terminus of VP3. It is speculated that this region may also be immunogenic like HPeV. In addition, Protean program analysis showed that 433-446aa and 698-716aa of the P1 region were located at 205-223aa of VP3 and 177-190aa of VP1, respectively, with high surface accessibility, hydrophilicity and antigenic index. It is speculated that they may also be the main antigenic sites of VP3 and VP1. Compared with VP3 and VP1, the predicted surface accessibility, hydrophilicity and antigenic index of VP0 are relatively low. It is speculated that the antigenicity of VP0 is not as ideal as that of VP3 and VP1. Western blot was used to identify the main antigenic sites of VP3 and VP1. Blot and indirect ELISA methods were used to analyze the antigenicity of the expressed full-length VP0, VP3 and VP1 recombinant proteins. It was found that the three fusion proteins could react with duck anti-DHV-1 positive serum, indicating that they had good antigenicity. The indirect ELISA results showed that at the same coating concentration, the P / N value of the fusion protein GST-VP3 as the coating antigen was higher than the P / N value of Trx-His-VP0 and Trx-His-VP1 as the coating antigen, indicating that the antigenicity of the fusion protein GST-VP3 was better than that of Trx-His-VP0 and Trx-His-VP1, which was consistent with the predicted results.

2. The method for establishing duck hepatitis virus antibody ELISA detection according to claim 1, characterized in that The preparation process of experimental animals and virus serum in step one is: prepare ducks, duck embryos, negative and positive blood of duck viral hepatitis, positive serum of duck viral enteritis, positive serum of duck Pasteurella, positive serum of Riemerella anatipestifer, positive serum of avian influenza, positive serum of duck reticuloendotheliosis, positive serum of duck reovirus disease and positive serum of duck parvovirus disease.

3. The method for establishing duck hepatitis virus antibody ELISA detection according to claim 1, characterized in that The experimental reagents in step 1 include DHV-1 strain, LA Taq DNA polymerase, restriction endonuclease Bam HI, XOt I. EcoR I, T4 DNA ligase, DNA Marker DL2000, low melting point agarose, IPTG, dNTPs, pMD18-T vector, competent cell line E. coli TG1 strain, E. coli BL21(DE3), Rosetta-gami(DE3)pLysS, prokaryotic expression vectors pET-32a(+) and pGEX-6p-1, horseradish peroxidase (HRP)-labeled goat anti-duck IgG, 3,3′,5,5′-tetramethylbenzidine (TMB) substrate colorimetric solution, skim milk, 96-well detachable ELISA plate, Tween-20, coating solution, blocking solution, serum diluent and enzyme-labeled secondary antibody diluent, washing solution and stop solution (2M H2SO4).

4. The method for establishing duck hepatitis virus antibody ELISA detection according to claim 1, characterized in that The instruments and equipment in step one include a desktop low-temperature high-speed centrifuge, an ultra-high-speed centrifuge, a PCR cycler, a clean bench, a biosafety level II operating cabinet, an air bath oscillator, a constant temperature water bath DK-80, a constant temperature incubator, a pH meter, a nucleic acid electrophoresis instrument, an ultrasonic crusher, a low-temperature refrigerator, a DYYIII-31A / 31B electrophoresis tank and a DYYIII-2 constant voltage and constant current electrophoresis instrument, a WFH-201 UV transmission analyzer, a gel imaging analysis system, a vortex mixer QL-901 and an electronic balance.

5. The method for establishing duck hepatitis virus antibody ELISA detection according to claim 1, characterized in that In step 1, the synthetic primers were designed based on the nucleotide sequences of the structural genes VP0, VP3 and VP1 of the DHV-1 strain (EU753359), and restriction sites and protective bases were inserted into them. The termination codon TAA was added to the downstream primers for synthesis. Before use, they were diluted to a concentration of 10 pmol / µL. The sequences of the primers for PCR amplification of the structural genes were as follows: When the structural gene is VP0, the primer sequence is UpperPrime: CCG GAATTC ATGGATACTCTTACCAAAAAC (EcoR I ), LowerPrimer: CCG CTCGAG TTACTGATTGTCAAATGGTCG( XOt I), The fragment size is 768 bp; When the structural gene is VP3, the primer sequence is UpperPrime: CGC GGATCC GGAAAGAGAAAGCCACGC ( Bam HI), LowerPrimer: CCG CTCGAG TTACTGATTATTGGTTGCCAT ( XOt I), The fragment size is 711 bp; When the structural gene is VP1, the primer sequence is UpperPrime: CCG GAATTC GGTGATTCCAACCAGTTG( EcoR I), LowerPrimer: CCG CTCGAG TTATTCAATTTCCAGATTGAG ( XOt I), The fragment size is 714 bp.

6. The method for establishing duck hepatitis virus antibody ELISA detection according to claim 1, characterized in that The PCR reaction parameters in step 2 were: denaturation at 95°C for 5 min; denaturation at 94°C for 30 sec, annealing at 50°C for 30 sec, extension at 72°C for 1 min, 30 cycles, and extension at 72°C for 10 min.

7. The method for establishing duck hepatitis virus antibody ELISA detection according to claim 1, characterized in that The purification process of the recombinant proteins Trx-His-VP0 and Trx-His-VP1 in step 2 is as follows: A 100 ml of the precipitate from E. coli culture BL21-pET-VP0 and Rosetta-pET-VP1 was dissolved in resuspension buffer (20 mM Tris-HCl, pH 8.0), ultrasonically disrupted, centrifuged at 12000 r / min, and the precipitate was resuspended in 10 ml of dissolution buffer (8 M urea, 20 mM Tris-HCl, 0.5 M NaCl, 10 mM imidazole, pH 8.0); B. Equilibrate the purification column with 10 ml of lysis buffer, repeat twice; C. Add 10 mL of the solution for resuspending the precipitate to the treated purification column and suspend the resin on a horizontal shaker to allow the protein to react with Ni. + The resin is fully combined and allowed to react at room temperature for 30 to 60 minutes, and the liquid passing through the column is collected; D. Wash the non-specifically bound proteins with 3 column volumes of dissolution buffer, 3 column volumes of elution buffer 1 (8 M urea, 20 mM Tris-HCl, 0.5 M NaCl, 20 mM imidazole, pH 8.0), and 3 column volumes of elution buffer 2 (8 M urea, 20 mM Tris-HCl, 0.5 M NaCl, 40 mM imidazole, pH 8.0), and collect the washings; E. Add 8 mL of elution buffer (8 M urea, 20 mM Tris-HCl, 0.5 M NaCl, 500 mM imidazole, pH 8.0), incubate at room temperature for 30 min, and collect in a centrifuge tube; F After the protein content was determined by UV spectrophotometer, a small amount of the purified product was taken for SDS-PAGE and TLC scanning to further determine the yield and purity after purification.

8. The method for establishing duck hepatitis virus antibody ELISA detection according to claim 1, characterized in that The purification process of the recombinant protein GST-VP3 in step 2 is as follows: A. Dissolve 100 ml of the precipitate from the E. coli culture Rosetta-pGEX-VP3 in 10 ml of PBS and perform ultrasonic disruption in the same manner as above. Centrifuge at 12000 r / min and collect the precipitate. B. Resuspend the precipitate in 10 ml of PBS containing 1 M urea, perform ultrasonic disruption, centrifuge at 12000 r / min, and collect the supernatant and precipitate; C. Resuspend the precipitate in 10 ml of PBS containing 2 M urea, perform ultrasonic disruption, centrifuge at 12000 r / min, and collect the supernatant and precipitate; D. Resuspend the precipitate in 10 ml of PBS containing 8 M urea, perform ultrasonic disruption, and centrifuge at 12000 r / min until the precipitate is completely dissolved; E After the protein content was determined by UV spectrophotometer, a small amount of the purified product was taken for SDS-PAGE and TLC scanning to further determine the yield and purity after purification.

9. The method for establishing duck hepatitis virus antibody ELISA detection according to claim 1, characterized in that The calculation formula of S / P value in step 2 is S / P=(sample OD 450nm - Negative control OD 450nm ) / (positive control OD 450nm - Negative control OD 450nm ).

10. The method for establishing duck hepatitis virus antibody ELISA detection according to claim 1, characterized in that The specific determination process in step 3 is as follows: (1) Cloning of structural genes and antigenicity analysis After RT-PCR amplification, three products of about 750 bp in size were obtained, which was consistent with the expected results. The target gene was cloned into pMD18-T. Agarose gel electrophoresis showed that the positive recombinant plasmids T-VP0, T-VP3 and T-VP1 identified by PCR and restriction endonuclease could obtain three target fragments of about 750 bp in size. The structural genes VP0, VP3 and VP1 were composed of 768, 711 and 714 nucleotides, respectively. Deduced into amino acids, they encoded 256, 237 and 238 amino acids, respectively. After splicing, the complete P1 region sequence was obtained. The surface accessibility, hydrophilicity and antigenic index of the P1 region structural protein were analyzed by the Protean program. It was found that the 257-276aa, 433-444aa and 703-713aa of the structural protein showed higher accessibility, hydrophilicity and antigenic index. The first two sites were located in the VP3 protein, and the third site was located in the VP1 protein. (2) Identification of prokaryotic expression vectors of structural genes By using EcoR I / XOt I enzyme was used to double-digest the positive recombinant plasmid pET-VP0, and a target fragment of about 750 bp and a vector fragment of about 5900 bp were obtained, which were consistent with the expected size; use Bam HI / XOt I performed double restriction enzyme digestion on the positive recombinant plasmid pGEX-VP3 to obtain a target fragment of about 750 bp and a vector fragment of about 4900 bp, which was consistent with the expected size; use EcoR I / XOt I performed double restriction enzyme digestion on the positive recombinant plasmid pET-VP1 to obtain a target fragment of about 750 bp and a vector fragment of about 5900 bp, which was consistent with the expected size; The above results prove that the target gene has been inserted into the multiple cloning site of the expression vector; (3) SDS-PAGE detection results of recombinant protein expression pET-VP0 was transformed into expression bacteria BL21, pET-VP1 and pGEX-VP3 were transformed into expression bacteria Rosetta-gami (DE3) pLysS, and after induction, SDS-PAGE detection showed that the specific fusion protein Trx-His-VP0 was expressed at 49kD, the specific fusion protein GST-VP3 was expressed at 52kD, and the specific protein Trx-His-VP1 was expressed at 47kD, respectively. The uninduced bacteria and the empty vector induced control bacteria had no such specific protein bands. (4) Purification results of recombinant protein After purification, three fusion proteins were obtained. The protein contents of the three fusion proteins Trx-His-VP0, GST-VP3 and Trx-His-VP1 were 0.4 mg / ml, 1.0 mg / ml and 0.2 mg / ml respectively as determined by UV spectrophotometer. (5) Antigenicity analysis results of recombinant proteins The purified proteins were subjected to SDS-PAGE electrophoresis and then transferred to nitrocellulose membrane for Western Blot analysis. The results showed that all three recombinant proteins could react with DHV-1 positive serum, while the purified vector fusion tag protein had no such reaction band, indicating that the induced expressed DHV-1 recombinant structural protein had good reactivity. The three purified recombinant proteins Trx-His-VP0, GST-VP3 and Trx-His-VP1 were coated on ELISA plates at the same dose, and the standard negative and positive serum were detected by indirect ELISA method. Three replicates were made for each recombinant protein to each positive and negative serum, and the average value was calculated. Compared with the tag protein, the recombinant protein reacted more strongly with the positive serum, with a higher P / N ratio, and the tag protein had less effect on the recombinant protein. The expressed recombinant protein had good antigenicity. (6) Establishment of indirect ELISA method for DHV-1 antibody (6.1) ELISA plate uniformity The detachable ELISA plate used has a smooth, flat, transparent surface, no scratches, bubbles or impurities, and a good appearance. The average value of the ELISA plate is 1.343, and the coefficient of variation is 3.1%. The uniformity is good and meets the test requirements. (6.2) Determination of antigen coating amount and serum dilution When the coating antigen concentration is 90 ng / well and the serum is diluted 1:200, the OD of positive serum and negative serum 450 The ratio (P / N) is the highest; (6.3) Determination of serum action time The antigen was coated on the ELISA plate at 90 ng / well, and the serum was diluted 1:

200. When the serum was exposed for 60 min, the OD of the positive serum and the negative serum was 450 The ratio was the highest, and the serum action time was determined to be 60 min; (6.4) Determination of the working concentration of enzyme-labeled antibodies When the working concentration of enzyme-labeled secondary antibody is 1:4000, the OD of positive serum and negative serum 450 The ratio (P / N) was the highest, and the working concentration of the enzyme-labeled secondary antibody was determined to be 1:4000; (6.5) Determination of the action time of enzyme-labeled antibodies When the enzyme-labeled secondary antibody action time is 60 minutes, the OD of positive serum and negative serum 450 The ratio (P / N) was the highest, and the action time of the enzyme-labeled secondary antibody was determined to be 60 min; (6.6) Determination of blocking solution When blocked with 5% skim milk, the OD of positive serum and negative serum 450 The ratio (P / N) is the highest, negative serum OD 450nm The value was low, and 5% skim milk was determined as the blocking agent; (6.7) Determination of substrate color development time When the substrate color development time was 15 minutes, the OD of positive serum and negative serum 450 The ratio (P / N) was the highest, and the substrate color development time was determined to be 15 min; (6.8) Determination of the judgment criteria for the indirect ELISA method Among the 131 DHV duckling negative serum samples tested by serum neutralization, OD 450 The values ​​were distributed between 0.006 and 0.25, of which 86% of the serum samples were below 0.

2. The data were normally distributed and could be used as the basis for establishing the judgment standard. The serum data were statistically processed, and the serum mean and standard deviation were X = 0.122, SD = 0.055, X + 2SD = 0.232, and X + 3SD = 0.

287. According to the principle of statistics, when the serum OD 450 When the value is ≥X+ 3S, it can be judged as positive at the level of 99.7%; 450 When the value is ≤X+ 2S, it is judged as negative. Therefore, the judgment standard of indirect ELISA is obtained. The S / P value ≥0.75 is judged as positive, and the S / P value ≤0.55 is judged as negative. The values ​​between the two are suspicious and need to be retested. If the test result is still less than 0.75, it is judged as negative. When the standard positive / negative serum ratio is less than 2.1, the experiment is invalid. (6.9) Sensitivity test results When the DHV positive control serum was tested, the S / P value was 0.78 when the serum was diluted to 3200 times, and the result was still positive, indicating that the established method has good sensitivity; (6.10) Specificity test results The positive sera of DP, AI, RA, DEV, RE, AR and MDP were tested, and the results showed that the established ELISA method had no cross reaction with the positive sera of the other 7 duck diseases, and all were negative. (6.11) Blocking test The standard positive and negative serum was diluted with virus suspension of different concentrations and incubated at 37℃ for 1 hour. The percentage of OD value decrease was calculated by indirect ELISA. The OD value of positive serum decreased significantly with the increase of virus suspension content. The OD value of serum sample completely diluted by virus suspension decreased by 67.85%, while the OD absorption value of negative serum was almost unaffected. Take 4 positive sera and 2 negative sera and dilute them with 60% virus solution. Set up untreated controls and detect OD by indirect ELISA. 450 The OD value of positive serum after being treated with virus suspension decreased significantly, but it had no effect on negative serum. (6.12) Comparison test results Comparing the ELISA test results of 10 sera with the serum neutralization test results, the consistency rate was 100%.

Images