Separated Actin5C promoter as well as construction method and expression vector thereof

Abstract

The invention provides a separated Actin5C promoter as well as a construction method and an expression vector thereof, the separated Actin5C promoter is a partial region of a wild Actin5C promoter, and the partial region comprises a region from the 94th site in the downstream direction of a transcription start site to 400bp-600bp in the upstream direction. The separated Actin5C promoter is short in length, so that the expression vector containing the Actin5C promoter is small in size and high in transfection efficiency. By utilizing the expression vector provided by the invention, the target protein yield of in-vitro insect S2 cells can be remarkably improved, and the scientific research and clinical application values are high.

Description

Technical Field

[0001] The present application relates to the biological field, and in particular, to an isolated Actin5C promoter and a construction method and expression vector thereof. Background Art

[0002] Gene expression is a nucleic acid tool that uses physical, chemical, and other technical methods to introduce exogenous genes into host cells and enable them to complete transcription, translation, and expression. By cloning the target gene into a corresponding vector, the regulatory elements on the vector backbone are used to enable the gene to be transcribed and translated in large quantities in the host cell, thereby achieving overexpression of the target gene. Gene expression vectors typically include promoter elements, enhancer elements, and 3' untranslated regions (UTRs), and are of great significance in biomedical research and industrial applications. Through gene expression systems, exogenous genes can be introduced into target cells and caused to produce the desired protein. This has a wide range of important applications in studying gene function, drug development, and industrial production.

[0003] Drosophila, a commonly used model animal, plays an important role in studying gene function due to its stable genetic background and highly conserved genetic and cellular signaling pathways with humans. Genetic manipulation using in vitro cultured Drosophila Schneider 2 (S2) cells is a common method for studying gene function. S2 cells are a type of blood and lymphoid cell lineage differentiated from Drosophila embryos. Currently, constitutive gene expression vectors used in S2 cells primarily contain constitutive promoters such as Actin5C and OpIE2, while the 3'-UTR is primarily derived from the simian virus SV40. Existing gene expression vectors suffer from major issues such as large vector size, low protein expression, and low transfection efficiency, which remain to be studied. Summary of the Invention

[0004] This application aims to, at least to some extent, address the technical problems existing in the prior art. To this end, this application proposes an isolated Actin5C promoter, its construction method, expression vector, recombinant cells, applications, and methods for regulating gene expression in Drosophila or Drosophila cells. The expression vector constructed using the isolated Actin5C promoter of this application is small in size and has high transfection efficiency. The expression vector of this application can significantly increase the yield of target proteins in insect S2 cells in vitro, and has high value for scientific research and clinical applications.

[0005] In a first aspect of the present application, an isolated Actin5C promoter is provided. According to an embodiment of the present application, the isolated Actin5C promoter is a partial region of the wild-type Actin5C promoter, comprising a region extending from position 94 downstream of the transcription start site to 400 to 600 bp upstream.

[0006] The isolated Actin5C promoter described in the examples of the present application is a specific DNA sequence truncated from the wild-type Actin5C promoter. This truncated Actin5C promoter is shorter, which helps reduce the size of the entire expression vector, accommodates larger exogenous gene fragments, and is more easily taken up and processed by cells, thereby improving its transfection efficiency in host cells. Furthermore, this truncated Actin5C promoter can efficiently initiate and regulate gene expression, thereby increasing the yield of the target protein.

[0007] According to the embodiments of the present application, the isolated Actin5C promoter may also have the following additional technical features:

[0008] According to an embodiment of the present application, the wild-type Actin5C promoter has a nucleotide sequence as shown in SEQ ID NO: 1.

[0009] According to an embodiment of the present application, the partial region includes a region starting from the 94th position in the downstream direction of the transcription start site to 450 bp to 550 bp in the upstream direction.

[0010] According to an embodiment of the present application, the isolated Actin5C promoter has a nucleotide sequence as shown in SEQ ID NO: 2 or a nucleotide sequence with at least 80% homology thereof.

[0011] In a second aspect of the present application, the present application provides an expression vector. According to an embodiment of the present application, the expression vector comprises: the isolated Actin5C promoter described in the first aspect.

[0012] According to an embodiment of the present application, the expression vector further comprises: a 3'-UTR sequence, wherein the 3'-UTR sequence comprises the 3'-UTR sequence of SV40 virus, the 3'-UTR sequence of P10 baculovirus or the 3'-UTR sequence of Drosophila K10 gene.

[0013] According to an embodiment of the present application, the 3'-UTR sequence has a nucleotide sequence as shown in SEQ ID NO: 3 or a nucleotide sequence with at least 80% homology thereto.

[0014] In a third aspect of the present application, the present application provides a recombinant cell. According to an embodiment of the present application, the recombinant cell comprises: the expression vector described in the second aspect.

[0015] According to an embodiment of the present application, the recombinant cell is selected from Drosophila S2 cells.

[0016] In a fourth aspect of the present application, a method for constructing the expression vector described in the second aspect is provided. According to an embodiment of the present application, the method comprises: providing an initial expression vector comprising a wild-type Actin5C promoter; and truncating the wild-type Actin5C promoter to obtain the isolated Actin5C promoter.

[0017] According to an embodiment of the present application, the initial expression vector further comprises: a 3'-UTR sequence derived from SV40 virus; the method further comprises: replacing the 3'-UTR sequence derived from SV40 virus with a 3'-UTR sequence of P10 baculovirus.

[0018] In the fourth aspect of the present application, the present application proposes the use of the aforementioned isolated Actin5C promoter and expression vector in regulating gene expression in Drosophila or Drosophila cells.

[0019] In a fifth aspect of the present application, a method for regulating gene expression in Drosophila or Drosophila cells is provided. According to an embodiment of the present application, the method comprises the steps of using the aforementioned isolated Actin5C promoter, expression vector, and recombinant cells.

[0020] Additional aspects and advantages of the present application will be given in part in the description below, and in part will become obvious from the description below, or will be learned through practice of the present application. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The above and / or additional aspects and advantages of the present application will become apparent and easily understood from the description of the embodiments in conjunction with the following drawings, in which:

[0022] Figure 1 shows a fluorescence microscopy image according to one embodiment of the present application;

[0023] Figure 2 A schematic diagram showing the expression of Luciferase protein by an expression vector according to one embodiment of the present application is shown;

[0024] Figure 3 Schematic diagram showing the protein expression content of expression vectors containing the combination of Actin5C (301 bp) + p10 and the combination of Actin5C (494 bp) + p10 according to one embodiment of the present application. DETAILED DESCRIPTION

[0025] The following embodiments of the technical solution of the present application are described in detail. The following embodiments are only used to more clearly illustrate the technical solution of the present application and are therefore only used as examples and are not intended to limit the scope of protection of the present application.

[0026] References herein to "embodiments" mean that a particular feature, structure, or characteristic described in connection with the embodiments may be included in at least one embodiment of the present application. The appearance of this phrase in various places in the specification does not necessarily refer to the same embodiment, nor does it constitute an independent or alternative embodiment that is mutually exclusive of other embodiments. It is understood, both explicitly and implicitly, by those skilled in the art that the embodiments described herein may be combined with other embodiments.

[0027] " scope " disclosed in the present application is limited in the form of lower limit and upper limit, and given range is limited by selecting a lower limit and an upper limit, and selected lower limit and upper limit define the boundary of special range.The scope that this mode limits can be to include end value, and can be combined arbitrarily, and promptly any lower limit can form a scope with any upper limit combination.For example, if the scope of 60-120 and 80-110 is listed for specific parameter, it is understood that the scope of 60-110 and 80-120 is also expected.In addition, if the minimum range value 1 and 2 listed, and if the maximum range value 3,4 and 5 are listed, then the following scope can all be expected: 1-3, 1-4, 1-5, 2-3, 2-4 and 2-5.In the present application, unless otherwise specified, numerical range " ab " represents the abbreviation of any real number combination between a and b, wherein a and b are real numbers, and the scope that this mode limits can be to include end value a and b. For example, a numerical range of "0-5" indicates that all real numbers between "0-5" are listed herein, and "0-5" is simply an abbreviation for these numerical combinations. Furthermore, when a parameter is expressed as an integer ≥ 2, this is equivalent to disclosing that the parameter is, for example, an integer of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, etc.

[0028] Unless otherwise specified, all embodiments and optional embodiments of the present application can be combined with each other to form a new technical solution.

[0029] Unless otherwise specified, all technical features and optional technical features of this application can be combined with each other to form a new technical solution.

[0030] Unless otherwise specified, all steps of the present application may be performed sequentially or randomly, preferably sequentially. For example, the method includes steps (a) and (b), indicating that the method may include steps (a) and (b) performed sequentially, or may include steps (b) and (a) performed sequentially. For example, the method may further include step (c), indicating that step (c) may be added to the method in any order, for example, the method may include steps (a), (b) and (c), or may include steps (a), (c) and (b), or may include steps (c), (a) and (b), etc.

[0031] The present application proposes an isolated Actin5C promoter, an expression vector, a recombinant cell, and a method for constructing the expression vector, which will be described in detail below.

[0032] Isolated Actin5C promoter

[0033] In a first aspect of the present application, an isolated Actin5C promoter is provided. According to an embodiment of the present application, the isolated Actin5C promoter is a partial region of the wild-type Actin5C promoter, comprising a region from position 94 downstream of the transcription start site to 400 to 600 bp upstream (e.g., 400 bp, 420 bp, 430, 440 bp, 450 bp, 460 bp, 470, 480 bp, 490, 500 bp, 520 bp, 540 bp, 550 bp, 560 bp, 580 bp, or 600 bp).

[0034] Gene expression vectors have relatively personalized designs according to different experimental requirements, but they all contain basic elements such as replication origin, selection marker, promoter, multiple cloning site and terminator. Currently, the constitutive gene expression vectors commonly used for Drosophila S2 cells mainly use the following promoters: Actin5C and OpIE2.

[0035] S2 cell gene expression vectors using the OpIE2 promoter exhibit lower expression efficiency than gene expression vectors using the Actin5C promoter. Actin5C is widely involved in various types of cell motility and is ubiquitously expressed in all eukaryotic cells. The Actin5C promoter is a vector element used for in vitro protein expression in insect cells. The Actin5C promoter is relatively long, resulting in a larger vector and lower transfection efficiency. Therefore, the inventors attempted to shorten the Actin5C promoter in the vector and investigate whether this shortening would improve gene expression efficiency. Ultimately, they screened and identified a specific region of the wild-type Actin5C promoter, stretching from position 94 downstream of the transcription start site to 400-600 bp upstream. This region, spanning from the downstream end of the wild-type Actin5C promoter to 400-600 bp upstream, is shorter, helping to reduce the overall size of the expression vector, accommodating larger exogenous gene fragments and facilitating cellular uptake and processing, thereby improving transfection efficiency in host cells. In addition, this truncated Actin5C promoter can efficiently initiate and regulate gene expression, thereby increasing the production of target proteins.

[0036] In this article, the 3' end direction of a certain site is regarded as the downstream direction, and the 5' end direction is regarded as the upstream direction.

[0037] In some embodiments, the partial region includes a region from the 94th position downstream of the transcription start site to 450 bp to 550 bp upstream. For example, the partial region includes a region from the 94th position downstream of the transcription start site to 494 bp upstream. This truncated Actin5C promoter can efficiently initiate and regulate gene expression, thereby increasing the yield of the target protein.

[0038] It should be noted that the term "wild-type Actin5C promoter" in this application refers to the original promoter, that is, the untruncated promoter, which has a nucleotide sequence as shown in SEQ ID NO: 1, wherein the T base at position 2416 (bold + underline) is the transcription start site.

[0039] CATGAATGGCATCAACTCTGAATCAAATCTTTGCAGATGCACCTACTTCTCATTTCCAC

[0040] TGTCACATCATTTTTCCAGATCTCGCTGCCTGTTATGTGGCCCAAAACCAAGACACGT

[0041] TTTATGGCCATTAAAGCTGGCTGATCGTCGCCAAACACCAAATACATAATGAATATGTA

[0042] CACATTCGAGAAAGAAGCGATCAAAGAAGCGTCTTCGGGCGGAGTAGGAGAATGCG

[0043] GAGGAGAAGGAGAACGAGCTGATCTAGTATCTCTCCACAATCCAATGCCAACTGACC

[0044] AACTGGCCATATTCGGAGCAATTTGAAGCCAATTTCCATCGCCTGGCGATCGCTCATT

[0045] CTTGGCTATATGTTTTTCACCGTTACCCGGGGCCATTTTCAAAGACTCGTCGGCAAGAT

[0046] AAGATTGTGTCACTCGCTGTCTCTCTTCATTTGTCGAAGAATGCTGAGGAATTTCGCGA

[0047] TGACGTCGGCGAGTATTTTGAAGAATGAGAATAATTTGTATTTATACGAAAATCAGTTA

[0048] GTGGAATTTTCTACAAAAACATGTTATCTATAGATAATTTTGTTGCAAAATATGTTGACT

[0049] ATGACAAAGATTGTATGTATATACCTTTAATGTATTCTCATTTTCTTATGTATTTATAATGG

[0050] CAATGATGATACTGATGATATTTTAAGATGATGCCAGACCAAAAGGCTTGAATTTCTGC

[0051] GTCTTTTGCCGAACGCAGTGCATGTGCAATTGTTGTTTTTTGGAATATTCAATTTTCGG

[0052] ACTGTCCGCTTTGATTTCAGTTTCTTGGCTTATTCAAAAAGCAAAGTAAAGCCAAAAA

[0053] AGCGAGATGGCAATACCAAATGCGGCAAAACGGTAGTGGAAGGAAAGGGGTGCGGG

[0054] GCAGCGGAAGGAAGGGTGGGGCGGGGCGTGGCGGGGTCTGTGGCTGGGCGCGACGT

[0055] CACCGACGTTGGAGCCACTCCTTTGACCATGTGTGCGTGTGTGTATTATTCGTGTCTCG

[0056] CCACTCGCCGGTTGTTTTTTTCTTTTTATGCTGCGCTCTCTCTAGCGCCATCTCGCTTAC

[0057] GCATGCTCAACGCACCGCATGTTGCCGTTTCCTTTTATGCGTCATTTTGGCTCGAAATA

[0058] GGCAATTATTTAAACAAAGATTAGTCAACGAAAACGCTAAAATAAATAAGTCTACAATA

[0059] TGGTTACTTATTGCCATGTGTGTGCAGCCAACGATAGCAACAAAAGCAACAACACAG

[0060] GTGGCTTTCCCTCTTTCACTTTTTGTTTGCAAGCCGCGTGCGAGCAAGACGGCACGAC

[0061] CGGCAAACGCAATTACGCTGACAAAGAGCAGACGAAGTTTTGGCGAAAAACATCAA

[0062] GGCGCCTGATACGAATGCATTTGCAATAACAATTGCGATATTTAATATTGTTTATGAAGC

[0063] TGTTTGACTTCAAAACACACAAAAAAAAAAATAAAACAAATTATTTGAAAGAGAATT

[0064] AGGAATCGGACGCTTATCGTTAGGGTAACAACAAGAAATGCTTACTGAGTCACAGCCT

[0065] CTGGAAAACTGCCGCAAGCCAGAGAGAGAGAGAAAAAGAGGGAGAGCAGCTTAGA

[0066] CCGCATGTGCTTGTGTGTGAGGCGTCTCTCTCTTCGTCTCTGTTGCGCAAACGCATAG

[0067] ACTGCACTGAAAAAATCGATTACCTATTTTTTATGAATGAATATTTGCACTATTACTATT

[0068] CAAAACTATTAAGATAGCAATCACATTCAATAGCCAAATACTATACCACCTGAGCGATG

[0069] CAACGAAATGATCAATTTGAGCAAAAATGCTGCATATTTAGGACGGCATCATTATAGAA

[0070] ATGCTTCTTGCTGTGTACTTTTCTCTCGTCTGGCAGCTGTTTCGCCGTTATTGTTAAAAC

[0071] CGGCTTAAGTTAGGTGTGTTTTCTACGACTAGTGAATGCCCTACTAGAAGATGTGTGTT

[0072] GCACAAAATGTCCCTGGAATAACCAATTTGAAGTGCAGATAGCAGTAAACGTAAGCTA

[0073] ATATGAATATTATTTAACTGTAATGTTTTAATATCGCTGGACATTACTAATAAACCCACTA

[0074] TAAACACATGTACATATGTATGTTTTGGCATACAATGAGTAGTTGGGGAAAATGTGT

[0075] AAAAGCACCGTGACCATCACAGCATAAAGATAACCAGCTGAAGTATCGAATATGAGTA

[0076] ACCCCCAAATTGAATCACATGCCGCAACTGATAGGACCCATGGAAGTACACTCTTCAT

[0077] GGCGATATACAAGACACACACAAGCACGAACACCCAGTTGCGGAGGAAATTCTCCGT

[0078] AAATGAAAACCCAATCGGCGAACAATTCATACCCATATATGGTAAAAGTTTTGAACGC

[0079] GACTTGAGAGCGGAGAGCATTGCGGCTGATAAGGTTTTAGCGCTAAGCGGGCTTTATA

[0080] AAACGGGCTGCGGGACCAG T TTTCATATCACTACCGTTTGAGTTCTTGTGCTGTGTGG

[0081] ATACTCCTCCCGACACAAAGCCGCTCCATCAGCCAGCAGTCGTCTAATCCAGAGAC (SEQ ID NO: 1, 5'→3')

[0082] According to the examples of the present application, the isolated ACTIN5C promoter has the nucleotide sequence shown in SEQ ID NO: 2, or a nucleotide sequence with at least 80% homology thereto. Thus, the isolated ACTIN5C promoter fragment is relatively short and has better regulation and activation of the target gene. The expression vector constructed with it is compact and has high transfection efficiency, effectively increasing protein expression and having high application value.

[0083] AATATCGCTGGACATTACTAATAAACCCACTATAAACACATGTACATATGTATGTTTTGG

[0084] CATACAATGAGTAGTTGGGGAAAAAATGTGTAAAAGCACCGTGACCATCACAGCATA

[0085] AAGATAACCAGCTGAAGTATCGAATATGAGTAACCCCCAAATTGAATCACATGCCGCA

[0086] ACTGATAGGACCCATGGAAGTACACTCTTCATGGCGATATACAAGACACACACAAGCA

[0087] CGAACACCCAGTTGCGGAGGAAATTCTCCGTAAATGAAAACCCAATCGGCGAACAAT

[0088] TCATACCCATATATGGTAAAAGTTTTGAACGCGACTTGAGAGCGGAGAGCATTGCGGC

[0089] TGATAAGGTTTTAGCGCTAAGCGGGCTTTATAAAACGGGCTGCGGGACCAGTTTTCAT

[0090] ATCACTACCGTTTGAGTTCTTGTGCTGTGTGGATACTCCTCCCGACACAAAGCCGCTCCATCAGCCAGCAGTCGTCTAATCCAGAGAC (SEQ ID NO: 2)

[0091] As used herein, the term "homology" is used to describe an amino acid sequence or a nucleic acid sequence relative to a reference sequence, and the percentage of identical amino acids or nucleotides between two amino acid sequences or nucleic acid sequences is determined by conventional methods, for example, see Ausubel et al., eds. (1995), Current Protocols in Molecular Biology, Chapter 19 (Greene Publishing and Wiley-Interscience, New York); and the ALIGN program (Dayhoff (1978), Atlas of Protein Sequence and Structure 5: Suppl. 3 (National Biomedical Research Foundation, Washington, DC). There are many algorithms for aligning sequences and determining sequence homology, including the homology alignment algorithm of Needleman et al. (1970) J. Mol. Biol. 48: 443; the local homology algorithm of Smith et al. (1981) Adv. Appl. Math. 2: 482; the similarity search method of Pearson et al. (1988) Proc. Natl. Acad. Sci. 85: 2444; the Smith-Waterman algorithm (Meth. Mol. Biol. 70: 173-187 (1997); and BLASTP, BLASTN, and BLASTX algorithms (see Altschul et al. (1990) J. Mol. Biol. 215:403-410). Computer programs that utilize these algorithms are also available and include, but are not limited to, ALIGN or Megalign (DNASTAR) software, or WU-BLAST-2 (Altschul et al., Meth. Enzym., 266:460-480 (1996)); or GAP, BESTFIT, BLAST Altschul et al., supra, FASTA, and TFASTA, available in the Genetics Computing Group (GCG) package, Version 8, Madison, Wisconsin, USA; and CLUSTAL in the PC / Gene program provided by Intelligenetics, Mountain View, California.

[0092] As used herein, the term "at least 80% homology" refers to a sequence that is at least 80%, 82%, 84%, 85%, 86%, 88%, 90%, 92%, 94%, 95%, 96%, 98%, 99%, or 100% homologous to its corresponding reference sequence.

[0093] expression vector

[0094] In a second aspect, this application provides an expression vector. According to embodiments of this application, the expression vector comprises the isolated Actin5C promoter described in the first aspect. As previously mentioned, the isolated Actin5C promoter of this application is relatively short, resulting in a smaller expression vector, making it easier for cells to take up and process it, thereby improving its transfection efficiency in host cells. Furthermore, this expression vector can better regulate and initiate transcription of downstream genes, thereby increasing the production of the target protein.

[0095] According to an embodiment of the present application, the expression vector further comprises: a 3'-UTR sequence, wherein the 3'-UTR sequence comprises the 3'-UTR sequence of SV40 virus, the 3'-UTR sequence of P10 baculovirus or the 3'-UTR sequence of Drosophila K10 gene.

[0096] The 3'-UTR sequence is the untranslated region at the 3' end of the mRNA, typically including a polyA sequence. The 3'-UTR sequence from the aforementioned sources protects the mRNA from degradation by related nucleases and also serves as a regulatory element for ribosome recognition of the corresponding transcript, thereby stabilizing the mRNA and promoting translation initiation. Of the three sources mentioned above, the 3'-UTR sequence from P10 baculovirus is the most effective, effectively improving protein expression efficiency from expression vectors.

[0097] According to an embodiment of the present application, the 3'-UTR sequence has a nucleotide sequence as shown in SEQ ID NO: 3 or a nucleotide sequence with at least 80% homology thereto. Thus, the expression vector having the above 3'-UTR sequence has a higher target gene expression efficiency.

[0098] ATGAATCGTTTTAAAATAACAAATGAATTGTTTTATAATATTCGTACGATTCTTTGATTA

[0099] TGTAATAAAATGTGATCATATTAGGAAGATTACGAAAAATATAAAAAATATGAGTTCTGTG

[0100] TGTATAACAAATGCTGTAAACGCCAGAATTGTGTTTGTTGCAAATAAACCCATGATTAT

[0101] TTGATTAAAATTGTTGTTTTCTTTGTTCATATACAATAGTGTGTTTTGCCTAAACGTGTA

[0102] CTGCATAAACTCCATGCGAGTGTATAGCGAGCTAGTGGCTAACGCTTGCCCCACCAAA

[0103] GTAGATTCGTCAAAATCCTCAATTTCATCACCCTCCTCCAAGTTTAACATTTGGCCGTC

[0104] GGAATTAACTTCTAAAGATGCCACATAATCTAATAAAATGAAATAGAGATTCAAACGTGG

[0105] CGTCATCGTCCGTTTCGACCATTTCCGAAAAGAACTCGGGCATAAACTCTATGATTTCT

[0106] CTGGACGTGGTGTTGTCGAAACTCTCAAAGTACGCAGTCAGGAACGTGCGCGACATG

[0107] TCGTCGGGAAAACTCGCGCGGAAACATGTTGTTGTAACCGAACGGGTCCCATAGCGCC

[0108] AAAACCAAATCTGCCAGCGTCAATAGAATGAGCACGATGCCGACAATGGAGCTGGCTTGGATAGCGATTCGA (SEQ ID NO: 3)

[0109] It should be noted that the features and advantages described above for the isolated ACTIN5C promoter are also applicable to this expression vector and will not be described in detail here.

[0110] recombinant cells

[0111] In a third aspect of the present application, a recombinant cell is provided. According to an embodiment of the present application, the recombinant cell comprises the expression vector described in the second aspect. Thus, the recombinant cell containing the expression vector can efficiently express the target protein.

[0112] It should be noted that the term "recombinant cell" in this application refers to a cell obtained by introducing an expression vector into the cell. The gene on the expression vector can be recombined into the cell's genome or exist in a free form within the cell. Specifically, the recombinant cells in this application do not include germ cells, fertilized eggs, or embryonic cells.

[0113] According to an embodiment of the present application, the recombinant cell is selected from Drosophila S2 cells.

[0114] It should be noted that the features and advantages described above for the expression vector are also applicable to the recombinant cell and will not be repeated here.

[0115] Method for constructing expression vector

[0116] In the fourth aspect of the present application, the present application proposes a method for constructing the expression vector described in the second aspect. According to an embodiment of the present application, the method includes: providing an initial expression vector, wherein the initial expression vector includes a wild-type Actin5C promoter; truncating the wild-type Actin5C promoter to obtain the isolated Actin5C promoter. Thus, the isolated Actin5C promoter obtained by the method of the present application is shorter, which helps to reduce the size of the entire expression vector, can accommodate larger exogenous gene fragments, and is more easily taken up and processed by cells, thereby improving its transfection efficiency in host cells. In addition, this truncated Actin5C promoter is more effective in maintaining its function of initiating and regulating gene expression, and can more effectively promote the transcription of downstream genes, thereby increasing the yield of the target protein.

[0117] In some embodiments, the truncation method may include: using the initial expression vector as a template, amplifying the isolated Actin5C promoter, enzymatically digesting the initial expression vector to remove the wild-type Actin5C promoter, and inserting the isolated Actin5C promoter into the digested expression vector to obtain a target expression vector. In some embodiments, the initial expression vector is the plasmid T6-pAC5.1 mEGFP-EcoRV (Plasmid #206489) from Addgene.

[0118] According to an embodiment of the present application, the initial expression vector further comprises a 3'-UTR sequence derived from the SV40 virus; and the method further comprises replacing the 3'-UTR sequence derived from the SV40 virus with a 3'-UTR sequence from the P10 baculovirus. This can further effectively improve protein expression efficiency.

[0119] In some embodiments, the replacement method comprises: enzymatically removing the 3'-UTR sequence of the SV40 virus on the expression vector, and then inserting the 3'-UTR sequence of the P10 baculovirus.

[0120] It should be noted that the features and advantages described above for the expression vector are also applicable to this method and will not be repeated here.

[0121] Applications and Methods

[0122] In a fourth aspect of the present application, the present application proposes the use of the aforementioned isolated Actin5C promoter, expression vector, and recombinant cells for regulating gene expression in Drosophila or Drosophila cells. As previously mentioned, the isolated Actin5C promoter of the present application is relatively short, which helps to reduce the size of the entire expression vector, accommodates larger exogenous gene fragments, and is more easily taken up and processed by cells, thereby improving its transfection efficiency in host cells. In addition, this truncated Actin5C promoter is more effective in maintaining its function of initiating and regulating gene expression, and can more effectively promote the transcription of downstream genes.

[0123] In the fifth aspect of the present application, the present application proposes a method for regulating gene expression in Drosophila or Drosophila cells. According to an embodiment of the present application, the method comprises the steps of using the aforementioned isolated Actin5C promoter, expression vector, and recombinant cells. As mentioned above, the isolated Actin5C promoter of the present application is shorter, which helps to reduce the size of the entire expression vector, can accommodate larger exogenous gene fragments, and is more easily taken up and processed by cells, thereby improving its transfection efficiency in host cells. In addition, this truncated Actin5C promoter is more effective in maintaining its function of initiating and regulating gene expression, and can more effectively promote the transcription of downstream genes.

[0124] It should be noted that the features and advantages described above for the isolated Actin5C promoter, expression vector, and recombinant cells are also applicable to this application and method and will not be described in detail here.

[0125] Below in conjunction with embodiment, the scheme of the application will be explained. Those skilled in the art will appreciate that the following examples are merely for illustration of the application and should not be considered as limiting the scope of the application. Where specific techniques or conditions are not indicated in the examples, they are carried out according to the techniques or conditions described in the literature in this area or according to the product specifications. Reagents used or instruments not indicated by the manufacturer are conventional products that can be obtained commercially.

[0126] Example 1

[0127] The expression vector was constructed as follows:

[0128] 1) Using Addgene's plasmid T6-pAC5.1 mEGFP-EcoRV (Plasmid #206489), which carries 2510 bp of Actin5c (SEQ ID NO: 1) and 135 bp of SV40 polyA (SEQ ID NO: 4), as a template, Actin5C (494, SEQ ID NO: 2) was amplified using the following specific oligonucleotide primers. The amplified product was digested with BamHI, and the vector plasmid pVAM was also digested with BamHI. After gel recovery, Actin5C (494) was inserted into the pVAM backbone using enzyme digestion and ligation to obtain pVAM-Actin5C (494). The specific oligonucleotide primers were:

[0129] 5'-TGTCTAGAGCGGATCCAATATCGCTGGACATTACTAATAAACCCAC-3' (SEQ ID NO: 5)

[0130] 5'-GCCTCGAGTGGATCCGTCTCTGGATTAGACGAC-3' (SEQ ID NO: 6)

[0131] GATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGT

[0132] GAAAAAAATGCTTTATTTGTGAAATTTGGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTT (SEQ ID NO: 4)

[0133] 2) Using Addgene's plasmid T6-pAC5.1 mEGFP-EcoRV (Plasmid #206489) as a template, Actin5C (301, SEQ ID NO: 7) was amplified using the following specific oligonucleotide primers. The amplified product was digested with BamHI, and the vector plasmid pVAM was digested with BamHI. After gel recovery, Actin5C (301) was inserted into the pVAM backbone using enzyme digestion and ligation to obtain pVAM-Actin5C (301). The specific oligonucleotide primers are:

[0134] 5'-TGTCTAGAGCGGATCCAGTACACTCTTCATGGCGATATACAAGAC-3' (SEQ ID NO: 8)

[0135] 5'-GGCCTCGAGTGGATCTCTCTGGATTAGACGACTGCTGGC-3'(SEQ ID NO: 9)AGTACACTCTTCATGGCGATATACAAGACACACACAAGCACGAACACCCAGTTGCGGAGGAAATTCTCCGTAAATGAAAACCCAATCGGCGAACAATTCATACCCATATATGGTAAAAGTTTTGAACGCGACTTGAGAGCGGAGAGCATT GCGGCTGATAAGGTTTTAGCGCTAAGCGGCTTTAATAAAACGGGCTGCGGGACCAGTTTTCATATCACTACCGTTTGAGTTCTTGTGCTGTGTGGATACTCCTCCCGACACAAAGCCGCTCCATCAGCCAGCAGTCGTCTAATCCAGAGA(SEQ ID NO:7)

[0136] 3) eGFP-P10 (SEQ ID NO: 3) was amplified using the following specific oligonucleotide primers. The amplified product was digested with XhoI. The vector plasmids pVAM-Actin5C (494) and pVAM-Actin5C (301) were also digested with XhoI. After gel recovery, eGFP-P10 was inserted into the pVAM-Actin5C (494) and pVAM-Actin5C (301) backbones using enzyme digestion and ligation, respectively, to obtain pVAM-Actin5C (494)-eGFP-P10 and pVAM-Actin5C (301)-eGFP-P10. The specific oligonucleotide primers were:

[0137] 5'-CGGATCCACTCGAGGCCACCATGGTGAGCAAG-3' (SEQ ID NO: 14)

[0138] 5'-GCTGGAGCTCGAGTCGAATCGCTATCCAAGCCAG-3' (SEQ ID NO: 15)

[0139] 4) The OpIE2 promoter (SEQ ID NO: 10) was amplified using specific oligonucleotide primers on a template (Invitrogen's pIB / V5-His vector). The amplified product was digested with BamHI. The vector plasmid pVAM was also digested with BamHI. After gel recovery, the product was ligated using enzyme digestion to obtain pVAM-OpIE2. The specific oligonucleotide primers were:

[0140] 5'-GTCTAGAGCGGATCCTTGATAATCTCATGATGA-3' (SEQ ID NO: 11)

[0141] 5'-GGCCTCGAGTGGATCCTTTAAATTCGAACAGATGCT-3' (SEQ ID NO: 12)

[0142] (SEQ ID NO: 10)

[0143] 5) Using specific oligonucleotide primers, eGFP-polyA (OpIE2, SEQ ID NO: 13) was amplified on a template (Invitrogen's pIB / V5-His vector). The amplified product was digested with XhoI. Simultaneously, the vector plasmid pVAM-OpIE2 was digested with XhoI. After gel recovery, the eGFP-polyA (OpIE2) was inserted into the pVAM-OpIE2 backbone using enzyme digestion and ligation to obtain pVAM-OpIE2-eGFP-polyA (OpIE2). The specific oligonucleotide primers were:

[0144] 5'-GGATCCACTCGAGGCCACCATGGTGAGCAAG-3' (SEQ ID NO: 16)

[0145] 5'-ACCGCTCGAGCACGCGCTTTGAAAGGAG-3' (SEQ ID NO: 17)

[0146] ATCTTAGTTTGTATTGTCATGTTTTAATACAATATGTTATGTTTAAATATGTTTTTAAT AAATTTTATAAAATAATTTCAACTTTTATTGTAACAACATTGTCCATTTACACACTCCTT TCAAGCGCGTG (SEQ ID NO: 13)

[0147] 6) The constructed vector was transfected into Escherichia coli and cultured at 37°C for 16 hours. The plasmid was extracted and then transfected into Drosophila S2 cells. After 24 hours of cell culture, the expression of green fluorescent protein (GFP) and red fluorescent protein (mCherry) was observed using a fluorescence microscope. The results are as follows: Figure 1 and Figure 2 shown.

[0148] Determination of luciferase: After 24 hours of cell culture, remove the cell supernatant, add cell lysis buffer, lyse for 5 minutes, collect the lysate and centrifuge for 5 minutes, add luciferin and react for 5 minutes, and use a fluorescence meter to measure the fluorescence intensity released during the oxidation of luciferin. The results are as follows: Figure 3 shown.

[0149] Depend on Figure 1 It can be seen that compared with the combination of OplE2+PolyA and the combination of Actin5C(2510bp)+SV40, the expression levels of mcherry protein and GFP protein in the combination of Actin5C(494bp)+p10 were higher. Figure 2 It can be seen that compared with the combination of Op1E2+PolyA and the combination of Actin5C(2510bp)+SV40, the expression level of luciferase protein in the combination of Actin5C(494bp)+p10 is higher. Figure 3It can be seen that compared to Actin5C truncated to 301bp, Actin5C truncated to 494bp helps to more efficiently regulate and start the expression of the luciferase gene, thereby increasing the output of the luciferase protein. In addition, the inventors have also compared the Actin5C (494bp) + p10 combination and the Actin5C (494bp) + SV40 combination. The mcherry protein and GFP protein expression levels of the Actin5C (494bp) + p10 combination are higher, and the output of the luciferase protein is also higher. This shows that the promoter of Actin5C truncated to 494bp and p10 as a constitutive expression vector of polyA can achieve very high efficiency in its in vitro insect S2 cell exogenous gene expression.

[0150] Although the embodiments of the present application have been shown and described above, it can be understood that the above embodiments are exemplary and cannot be understood as limitations on the present application. Ordinary technicians in this field can change, modify, replace and modify the above embodiments within the scope of the present application.

Claims

1. An isolated Actin5C promoter, characterized in that The isolated Actin5C promoter is a partial region of the wild-type Actin5C promoter, and the partial region includes a region from the 94th position in the downstream direction of the transcription start site to 400 bp to 600 bp in the upstream direction.

2. The isolated Actin5C promoter according to claim 1, characterized in that The wild-type Actin5C promoter has a nucleotide sequence as shown in SEQ ID NO: 1; Optionally, the partial region includes a region from the 94th position in the downstream direction of the transcription start site to 450 bp to 550 bp in the upstream direction; Optionally, the isolated Actin5C promoter has a nucleotide sequence as shown in SEQ ID NO: 2 or a nucleotide sequence at least 80% homologous thereto.

3. An expression vector, characterized in that: include: The isolated Actin5C promoter according to claim 1 or 2.

4. The expression vector according to claim 3, characterized in that Further including: 3'-UTR sequence, wherein the 3'-UTR sequence includes the 3'-UTR sequence of SV40 virus, the 3'-UTR sequence of P10 baculovirus or the 3'-UTR sequence of Drosophila K10 gene; Optionally, the 3'-UTR sequence has a nucleotide sequence as shown in SEQ ID NO: 3 or a nucleotide sequence at least 80% homologous thereto.

5. A recombinant cell, characterized in that include: The expression vector according to claim 3 or 4.

6. The recombinant cell according to claim 5, characterized in that The recombinant cells are selected from Drosophila S2 cells.

7. A method for constructing the expression vector according to claim 3 or 4, characterized in that: include: Providing an initial expression vector, wherein the initial expression vector comprises a wild-type Actin5C promoter; The wild-type Actin5C promoter is truncated into the isolated Actin5C promoter to obtain a target expression vector.

8. The method according to claim 7, characterized in that The initial expression vector further comprises: a 3'-UTR sequence derived from SV40 virus; The method further comprises: replacing the 3'-UTR sequence derived from the SV40 virus with the 3'-UTR sequence of the P10 baculovirus.

9. Use of the isolated Actin5C promoter according to claim 1 or 2, or the expression vector according to claim 3 or 4 in regulating gene expression in Drosophila or Drosophila cells.

10. A method for regulating gene expression in Drosophila or Drosophila cells, characterized in that: include: The step of using the isolated Actin5C promoter according to claim 1 or 2, the expression vector according to claim 3 or 4, and the recombinant cell according to claim 5.

Images