Infectious polynucleotide, recombinant virus, viral vector, composition and application

Abstract

The invention discloses an infectious polynucleotide, a recombinant virus, a virus vector, a composition and application. The invention relates to a recombinant virus obtained by homologous recombination, a virus vector, a composition, a method and application, and aims to overcome the defects of low expression and high serum positive rate of an hAd5 cell receptor.

Description

Technical Field

[0001] The present application relates to the field of oncolytic virus technology, and specifically to infectious polynucleotides, recombinant viruses, viral vectors, compositions and applications. Background Art

[0002] Oncolytic viruses (OVs) are viruses that can selectively replicate and kill tumor cells but have no effect on normal cells, and can be used as anti-tumor drugs. Among them, oncolytic adenoviruses obtained by adenovirus modification are the most important type. Adenoviruses have stable genetic material and high-fidelity DNA polymerase, making them an oncolytic virus with excellent performance. In addition, compared with enveloped viruses, non-enveloped adenoviruses are more likely to proliferate and kill tumor cells in damaged tumor cells.

[0003] To date, 116 human adenoviruses have been identified based on their hemagglutination properties, carcinogenicity in rodents, and DNA homology. Among them, the most widely used oncolytic adenovirus is human adenovirus type 5 (hAd5). hAd5 can effectively infect target cells in vivo and in vitro. However, the efficacy of hAd5 is often affected by neutralizing antibodies, and the past immunity rate in some populations is as high as 90%, which may cause the human type 5 oncolytic virus in the body to be rapidly cleared and limit its bioavailability for targeting tumors after systemic administration. In addition, the availability of hAd5 receptors (Coxsackie and Adenovirus Receptor, CAR) also limits its tumor-targeting activity. Studies have shown that the expression level of CAR in many primary tumor cells and cancer cell lines is quite low or even undetectable. hAd5 can interact with blood factors. For example, hAd5 can interact with coagulation factors, which can lead to its liver orientation. In addition, hAd5 may also bind to platelet factor 4 to increase the risk of thrombosis. However, although other subtypes of oncolytic adenovirus (such as type 3 and type 35) can compensate for the limitations of CAR to a certain extent, their oncolytic effects are not satisfactory.

[0004] Therefore, the low expression of the major receptor of hAd5 on tumor cells and the high seropositivity of hAd5 in human serum limit its therapeutic effect as an oncolytic virus. Summary of the invention

[0005] The inventors of the present application creatively carried out genetic recombination on human adenoviruses to obtain a class of recombinant adenoviruses. These recombinant adenoviruses can overcome the defects of low expression of hAd5 receptors and high serum positivity rate, and can be used as oncolytic viruses and anti-tumor drugs.

[0006] To this end, this application discloses at least the following technical solutions:

[0007] 1. Infectious polynucleotides

[0008] In one aspect, the present application discloses an isolated infectious polynucleotide, which carries at least one recombinant adenovirus genome. The recombinant adenovirus genome is formed by replacing the promoter of the E1A gene, the E3gp19K gene, and the promoter of the E1B gene and its partial sequence in the wild genome of non-type 5 human adenovirus. The infectious polynucleotide is introduced into cells and can produce infectious virus particles through passage, and the infectious virus particles produced can infect and kill tumor cells. In addition, the infectious virus particles produced can overcome the defects of low expression of hAd5 receptor and high seropositivity rate.

[0009] 2. Viral vectors

[0010] On the one hand, the present application discloses a viral vector. The viral vector carries at least one recombinant adenovirus genome. The recombinant adenovirus genome is formed by replacing the promoter of the E1A gene in the wild genome of non-type 5 human adenovirus, replacing the E3gp19K gene, replacing the promoter of the E1B19K gene, the promoter of the E1B gene and their partial sequences. The viral vector is introduced into cells and can produce infectious virus particles through passage, and the infectious virus particles produced can infect and kill tumor cells. In addition, the infectious virus particles produced can overcome the defects of low expression of hAd5 receptor and high seropositivity rate.

[0011] On the one hand, the present application discloses a viral vector. The viral vector carries at least one recombinant adenovirus genome. The recombinant adenovirus genome is formed by replacing the promoter of the E1A gene in the wild genome of non-type 5 human adenovirus. The viral vector is introduced into cells and can produce infectious virus particles through passage, and the infectious virus particles produced can infect and kill tumor cells. In addition, the infectious virus particles produced can overcome the defects of low expression of hAd5 receptor and high seropositivity rate.

[0012] On the one hand, the present application discloses a viral vector. The viral vector carries at least one recombinant adenovirus genome. The recombinant adenovirus genome is formed by replacing the promoter of the E1A gene and the E3gp19K gene in the wild genome of non-type 5 human adenovirus. The viral vector is introduced into cells and can produce infectious virus particles through passage, and the infectious virus particles produced can infect and kill tumor cells. In addition, the infectious virus particles produced can overcome the defects of low expression of hAd5 receptor and high seropositivity rate.

[0013] On the one hand, the present application discloses a viral vector. The viral vector carries at least one recombinant adenovirus genome. The recombinant adenovirus genome is formed by replacing the promoter of the E1A gene in the wild genome of non-type 5 human adenovirus, and replacing the promoter of the E1B gene and its partial sequence. The viral vector is introduced into cells and can produce infectious virus particles through passage, and the infectious virus particles produced can infect and kill tumor cells. In addition, the infectious virus particles produced can overcome the defects of low expression of hAd5 receptor and high seropositivity rate.

[0014] On the one hand, the present application discloses a viral vector. The viral vector carries at least one recombinant adenovirus genome. The recombinant adenovirus genome is formed by replacing the promoter of the E1A gene in the wild genome of non-type 5 human adenovirus, replacing the E3gp19K gene, and replacing the promoter of the E1B gene and its partial sequence. The viral vector is introduced into cells and can produce infectious virus particles through passage, and the infectious virus particles produced can infect and kill tumor cells. In addition, the infectious virus particles produced can overcome the defects of low expression of hAd5 receptor and high seropositivity rate.

[0015] 3. Viruses

[0016] In one aspect, the present application discloses a recombinant adenovirus. The recombinant adenovirus is obtained by transfecting cells with the viral vector described in any embodiment of the present application. The viral particles can infect and kill tumor cells, and effectively overcome the defects of low expression of hAd5 receptor and high seropositivity rate.

[0017] On the one hand, the present application discloses an oncolytic virus. The oncolytic virus is obtained by packaging cells transfected with a viral vector described in any embodiment of the present application. The viral particles can infect and kill tumor cells, and effectively overcome the defects of low expression of hAd5 receptors and high seropositivity.

[0018] 4. Composition

[0019] On the one hand, the present application discloses a composition, including a combination of infectious polynucleotides produced by any embodiment of the present application, to effectively overcome the defects of low expression of hAd5 receptor and high seropositivity, and to improve the anti-tumor efficacy of the virus.

[0020] In one aspect, the present application discloses a composition comprising a combination of viral vectors produced by any embodiment of the present application, for improving the anti-tumor efficacy of the virus.

[0021] In one aspect, the present application discloses a composition comprising a combination of viruses produced by any embodiment of the present application, for improving the anti-tumor efficacy of the viruses.

[0022] 5. Methods

[0023] On the one hand, the present application discloses a method for preparing a viral vector produced by any embodiment of the present application. The preparation method comprises providing a basic vector carrying the wild genome; inserting the hTERT promoter into the basic vector to replace the promoter of the E1A gene of the wild genome by homologous recombination, or inserting the first expression cassette into the basic vector to replace the E3gp19K gene of the wild genome, or inserting the second expression cassette into the basic vector to replace the promoter of the E1B gene of the wild genome and its partial sequence.

[0024] In one aspect, the present application discloses a method for preparing a virus produced by any embodiment of the present application. The preparation method comprises providing a viral vector produced by any embodiment of the present application; transfecting the viral vector into a host cell, assembling and replicating in the cell to obtain the virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Schematic diagram of the structure of the wild genome and recombinant genome (first to fourth genome) provided for the implementation plan. In the figure, "E1A", "E1B-part", and "E3gp19K" respectively represent the E1A gene, partial sequence of the E1B gene, and the E3gp19K gene in the wild genome. "ITR" represents the inverted terminal repeat sequence, "E1Ap" represents the promoter of the E1A gene, and "E1Bp" represents the promoter of the E1B gene in the wild genome. "FirstEX" represents the first expression cassette, and "SecondEX" represents the second expression cassette.

[0026] Figure 2 CAR and CD46 expression result diagram provided for the implementation plan. Figure 2 A is a graph showing the results of flow cytometry detection of CAR and CD46 expression in different tumor cells. In the graph, red represents unstained cell populations, orange represents CAR-positive cells, blue represents CD46-positive cells, the y-axis shows the cell number, and the x-axis shows the fluorescence intensity. Figure 2 B is a statistical chart of CAR expression results in healthy breast tissue and breast cancer tissue. Figure 2 C is a statistical graph of CD46 expression results in healthy breast tissue and breast cancer tissue.

[0027] Figure 3 A graph showing the test results of viral proliferation ability after different recombinant adenoviruses infect cancer cell lines in an implementation plan.

[0028] Figure 4 The fluorescent labeling method provided in the embodiment tests the lysis curves of cancer cells infected with different recombinant adenoviruses.

[0029] Figure 5 The CCK-8 method provided in the implementation scheme tests the survival curve of cancer cells infected with different recombinant adenoviruses.

[0030] Figure 6 The statistical results of neutralizing antibody tests for Ad5-hTERT, Ad34-hTERT and Ad35-hTERT provided for the implementation scheme are shown in Figure 1. 1 / 125 to 1 / 16000 (orange) were used to fight against Ad5-hTERT infection, and 1 / 125-1 / 1000 (yellow and green) were used to fight against Ad34-hTERT and Ad35-hTERT infection.

[0031] Figure 7 The flowchart of the oncolytic test of different recombinant adenoviruses on A549 cell xenograft mice provided in the implementation scheme. 6 A549 cells were implanted subcutaneously on the left and right hind flanks of nu / nuNMR1 / FoxN1 mice. On days 12 and 15 after A549 cell transplantation, mice were injected intratumorally with 10 9 On day 27, mice were sacrificed.

[0032] Figure 8 The results of the oncolytic test of different recombinant adenoviruses on A549 cell xenograft mice provided in the implementation plan. Two-way ANOVA was used to analyze the significant difference, "***" means p<0.001, and "****" means p<0.0001.

[0033] Fig. 9 Luciferase (fLuc) activity detection results after intravenous injection of different recombinant adenoviruses expressing luciferase (Ad5-hTERT-fLuc, Ad34-hTERT-fLuc, A) provided in the implementation plan (B) and quantitative detection of viruses in different tissues and organs (left side of the dotted line) and inside tumors (right side of the dotted line) (C). Fig. 9 In C, the left ordinate is the number of viral genome copies per 10,000 mouse cells, and the right ordinate is the number of viral genome copies per 10,000 tumor cells. DETAILED DESCRIPTION

[0034] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application is further described in detail in combination with the implementation scheme. It should be understood that the specific implementation scheme described herein is only used to explain the present application and is not used to limit the present application. The reagents not described in detail in the present application are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0035] It should be understood that the terms "first", "second", "third", "fourth", etc. in the embodiments of the present application are only used to distinguish the description and cannot be understood as indicating or implying relative importance or order.

[0036] Infectious polynucleotide

[0037] The present application discloses an isolated infectious polynucleotide, which contains at least one recombinant adenovirus genome. The recombinant adenovirus genome is obtained by recombining a wild genome of a non-type 5 human adenovirus. The recombinant adenovirus genome is formed by replacing at least one of the promoter of the E1A gene, the E3gp19K gene, and the promoter of the E1B gene and its partial sequence in the wild genome of a non-type 5 human adenovirus. The term "replacement" refers to replacing a wild gene or region with a gene or nucleic acid region with a similar function or a different function, such as replacing a wild-type promoter in an adenovirus genome with an exogenous promoter; for example, replacing the E3gp19K gene in an adenovirus genome with a first expression cassette.

[0038] The term "infectious polynucleotide" as used herein is a polynucleotide having two or more nucleotides, which refers to a polynucleotide sequence that can be replicated in a host (e.g., a prokaryotic cell or a eukaryotic cell). When the infectious polynucleotide of adenovirus infects and introduces into a host, it can replicate in the cell and produce infectious virus particles. Therefore, the recombinant adenovirus genome can contain these "infectious polynucleotides", which can be present in a vector in the form of DNA, in a virus particle in the form of DNA, or in the form of isolated DNA or RNA. The term "polynucleotide" refers to a polymer of nucleotides of any length, whether ribonucleotides or deoxyribonucleotides, including double-stranded or single-stranded DNA, and double-stranded or single-stranded RNA. Unless otherwise indicated, polynucleotides include their complementary forms. Those skilled in the art can easily determine the complementary nucleotide sequence of a polynucleotide. Polynucleotides may include nucleotide sequences with different functions, including, for example, coding sequences and non-coding sequences (e.g., regulatory sequences and / or untranslated regions). Polynucleotides may be obtained directly from natural sources, or prepared by means of recombinant, enzymatic or chemical techniques. Polynucleotides may be linear or circular in topology. A polynucleotide may be, for example, a component or fragment of a vector (eg, an expression vector or a cloning vector).

[0039] If naturally occurring, a polynucleotide is preferably "isolated," and more preferably purified. An "isolated" compound (e.g., a polynucleotide, protein, or viral particle) is one that is separated and isolated from its natural environment. A "purified" compound is at least 60% free from other components with which it is naturally associated, preferably 75% and most preferably 90% free from other components with which it is naturally associated. Compounds such as polynucleotides and polypeptides that are produced outside of a native organism (e.g., by chemical or recombinant methods) are by definition considered isolated and purified because they do not occur in their natural environment.

[0040] In some embodiments, the recombinant adenovirus genome is formed by replacing the promoter of the E1A gene in the genome of a wild non-type 5 human adenovirus. Infectious polynucleotides carrying the recombinant adenovirus genome are introduced into cells and infectious virus particles can be produced through passage. The infectious virus particles produced can infect and kill tumor cells and effectively overcome the defects of low expression of hAd5 receptors and high seropositivity.

[0041] In some embodiments, the recombinant adenovirus genome is formed by replacing the promoter of the E1A gene and the E3gp19K gene in the genome of a wild non-type 5 human adenovirus. Infectious polynucleotides carrying the recombinant adenovirus genome are introduced into cells and infectious virus particles can be produced through passage. The infectious virus particles produced can infect and kill tumor cells and effectively overcome the defects of low expression of hAd5 receptors and high seropositivity.

[0042] In some embodiments, the recombinant adenovirus genome is formed by replacing the promoter of the E1A gene in the genome of wild non-type 5 human adenovirus, and replacing the promoter of the E1B gene and its partial sequence. Infectious polynucleotides carrying the recombinant adenovirus genome are introduced into cells and can produce infectious virus particles through passage. The generated infectious virus particles can infect and kill tumor cells, and effectively overcome the defects of low expression of hAd5 receptors and high seropositivity.

[0043] In some embodiments, the recombinant adenovirus genome is formed by replacing the promoter of the E1A gene, the E3gp19K gene, the promoter of the E1B gene and its partial sequence in the genome of wild non-type 5 human adenovirus. Infectious polynucleotides carrying the recombinant adenovirus genome are introduced into cells and infectious virus particles can be produced by passage. The infectious virus particles produced can infect and kill tumor cells and effectively overcome the defects of low expression of hAd5 receptors and high seropositivity.

[0044] In some embodiments, the infectious polynucleotide may carry multiple copies of the recombinant adenovirus genome to improve its infectivity or virus rescue efficiency. The infectious polynucleotide is introduced into cells and can produce infectious virus particles through passage. The infectious virus particles produced can infect and kill tumor cells and effectively overcome the defects of low expression of hAd5 receptors and high seropositivity.

[0045] Thus, in some embodiments, when the infectious polynucleotide is introduced into a cell, the infectious polynucleotide is transcribed, the viral genome is replicated, and infectious viral particles are produced.

[0046] In some embodiments, the infectious polynucleotide is present as genomic cDNA in a prokaryotic host cell.

[0047] In some embodiments, the infectious genomic cDNA is present in a vector.

[0048] In some embodiments, the infectious polynucleotide is transcribed to produce a viral genome present in a viral particle.

[0049] In some embodiments, the infectious polynucleotide is cloned into a plasmid, and the plasmid containing the infectious polynucleotide is used to transfect cells to produce virus.

[0050] In some embodiments, the wild non-type 5 human adenovirus is selected from human adenovirus type 4, human adenovirus type 7, human adenovirus type 11, human adenovirus type 14, human adenovirus type 17, human adenovirus type 21, human adenovirus type 34, human adenovirus type 35, human adenovirus type 37 and human adenovirus type 50.

[0051] In some embodiments, the genome of the wild non-type 5 human adenovirus is selected from the genome of human adenovirus type 4, the genome of human adenovirus type 7, the genome of human adenovirus type 11, the genome of human adenovirus type 14, the genome of human adenovirus type 17, the genome of human adenovirus type 21, the genome of human adenovirus type 34, the genome of human adenovirus type 35, the genome of human adenovirus type 37 and the genome of human adenovirus type 50. As shown in Table 1, the serum positivity rates of these adenoviruses are all low. The data come from "Wang X, Kerkmann L, Hetzel M, Windmann S, Trilling M, Zhang W, Ehrhardt A, Bayer W. Analysis of the Prevalence of Binding and Neutralizing Antibodies against 39 Human Adenovirus Types in Student Cohorts Reveals Low-Prevalence Types and a Decline in Binding Antibody Levels during the SARS-CoV-2 Pandemi c. J Virol. 2022 Nov 23; 96(22): e0113322. doi: 10.1128 / jvi.01133-22. Epub 2022 Nov 7. PMID: 36342295; PMCID: PMC9682995".

[0052] Table 1

[0053] Different types of adenovirus Ad4 Ad7 Ad11 Ad14 Ad17 Ad21 Ad34 Ad35 Ad37 Ad50 Serum positivity rate (%, 1:10 dilution) <25 <20 <20 <15 <15 <10 <5 <5 <5 <10 Serum positivity rate (%, 1:250 dilution) <10 <5 <5 <5 <5 <5 <1 <1 <1 <1

[0054] Figure 1 The schematic diagram of the structure of the wild genome and the recombinant genome (the first to the fourth genome) is shown. In the figure, the wild genome mainly shows the E1A gene, the partial sequence of the E1B gene and the E3gp19K gene, and also shows the promoter E1Ap of the E1A gene and the promoter E1Bp of the E1B gene, and also shows the ITR (inverted terminal repeat sequence) at the 5' end and the ITR at the 3' end. The first genome includes the promoter hTERTp that replaces the promoter E1Ap. The second genome includes the promoter hTERTp that replaces the promoter E1Ap and the first expression cassette that replaces the E3gp19K gene. The third genome includes the promoter hTERTp that replaces the promoter E1Ap, and the second expression cassette that replaces the E1Bp promoter and the partial sequence of the E1B gene. The fourth genome includes the promoter hTERTp that replaces the promoter E1Ap, the second expression cassette that replaces the E1B gene promoter and the partial sequence of the E1B gene, and the first expression cassette that replaces the E3gp19K gene.

[0055] In some embodiments, the promoter used to replace the E1A gene is the hTERT promoter, as shown in SEQ ID NO:1.

[0056] In some embodiments, the first expression cassette is as shown in SEQ ID NO:2.

[0057] In some embodiments, the second expression cassette is as shown in SEQ ID NO:3.

[0058] Viral vectors

[0059] "Viral vector" refers to a recombinant DNA or RNA plasmid or virus containing a heterologous polynucleotide to be delivered to a target cell in vitro or in vivo. For the purpose of prevention or treatment, the heterologous polynucleotide may include an infectious polynucleotide or a recombinant adenoviral genome provided in the embodiments, and may optionally be present in the form of an expression cassette. The term includes cloning vectors and viral vectors. For example, the vector of the present application can be a gene delivery vector, a vaccine vector, an antisense delivery vector, or a gene therapy vector.

[0060] The terms "nucleic acid" and "nucleic acid sequence" refer to nucleotide oligonucleotide polynucleotides or any fragments thereof. These terms also refer to DNA or RNA of genomic or synthetic origin, which can be single-stranded or double-stranded, and can represent the sense or antisense strand of peptide nucleic acid (PNA) or any DNA-like or RNA-like material. The term "operably linked" refers to a situation in which a first nucleic acid sequence amino acid sequence or ligand is in a functional relationship with a second nucleic acid sequence amino acid sequence or ligand. For example, if a promoter affects the transcription or expression of a coding sequence, the promoter is operably linked to a coding sequence. An operably linked DNA sequence or protein or ligand can be in close proximity or contiguous, and two protein coding regions are linked in the same reading frame when necessary.

[0061] Some embodiments disclose a viral vector. The viral vector carries at least one recombinant adenovirus genome. The recombinant adenovirus genome is formed by replacing the promoter of the E1A gene, the E3gp19K gene, and the promoter of the E1B gene and its partial sequence in the wild genome of non-type 5 human adenovirus. The viral vector is introduced into cells and can produce infectious virus particles through passaging. The infectious virus particles produced can infect and kill tumor cells, and effectively overcome the defects of low expression of hAd5 receptor and high seropositivity rate.

[0062] Some embodiments disclose a viral vector. The viral vector carries at least one recombinant adenovirus genome. The recombinant adenovirus genome is formed by replacing the promoter of the E1A gene in the genome of a wild non-type 5 human adenovirus. The viral vector is introduced into cells and can produce infectious viral particles through passage. The infectious viral particles produced can infect and kill tumor cells and effectively overcome the defects of low expression of hAd5 receptors and high seropositivity.

[0063] Some embodiments disclose a viral vector. The viral vector carries at least one recombinant adenovirus genome. The recombinant adenovirus genome is formed by replacing the promoter of the E1A gene and the E3gp19K gene in the genome of a wild non-type 5 human adenovirus. The viral vector is introduced into cells and can produce infectious viral particles through passaging. The infectious viral particles produced can infect and kill tumor cells, and effectively overcome the defects of low expression of hAd5 receptors and high seropositivity.

[0064] Some embodiments disclose a viral vector. The viral vector carries at least one recombinant adenovirus genome. The recombinant adenovirus genome is formed by replacing the promoter of the E1A gene in the genome of a wild non-type 5 human adenovirus, and replacing the promoter of the E1B gene and its partial sequence. The viral vector is introduced into cells and can produce infectious virus particles through passage. The infectious virus particles produced can infect and kill tumor cells, and effectively overcome the defects of low expression of hAd5 receptors and high seropositivity.

[0065] Some embodiments disclose a viral vector. The viral vector carries at least one recombinant adenovirus genome. The recombinant adenovirus genome is formed by replacing the promoter of the E1A gene, the E3gp19K gene, the promoter of the E1B gene and its partial sequence in the genome of a wild non-type 5 human adenovirus. The viral vector is introduced into cells and can produce infectious virus particles through passage. The infectious virus particles produced can infect and kill tumor cells, and effectively overcome the defects of low expression of hAd5 receptors and high seropositivity.

[0066] In some embodiments, the viral vector comprises a base vector and a recombinant adenovirus genome inserted into the base vector. The base vector is selected from pBR322, pUC18, pUC19, pBluescript, pcDNA3.1, p15A (SEQ ID NO: 4) or pR6K-SM (SEQ ID NO: 5).

[0067] Virus

[0068] In one aspect, the present application discloses a recombinant adenovirus. The recombinant adenovirus is obtained by transfecting cells with the viral vector described in any aspect. The viral particles can infect and kill tumor cells, and effectively overcome the defects of low expression of hAd5 receptor and high serum positivity rate.

[0069] In one aspect, the present application discloses an oncolytic virus. The oncolytic virus is obtained by transfecting cells with the viral vector described in any aspect. The viral particles can infect and kill tumor cells, and effectively overcome the defects of low expression of hAd5 receptor and high seropositivity rate.

[0070] The term "recombinant" means a polynucleotide of semisynthetic or synthetic origin that does not occur in nature or is linked to another polynucleotide in an arrangement not found in nature. The term "recombinant" with respect to a viral vector refers to a vector, e.g., a viral genome that has been manipulated in vitro, e.g., using recombinant nucleic acid technology to express heterologous viral nucleic acid sequences.

[0071] Composition

[0072] On the one hand, the present application discloses a combination of infectious polynucleotides produced by any embodiment of the present application to effectively overcome the defects of low expression of hAd5 receptor and high seropositivity rate, so as to improve the anti-tumor efficacy of the virus.

[0073] In one aspect, the present application discloses a combination of viral vectors produced by any embodiment of the present application, which is used to improve the anti-tumor efficacy of the virus.

[0074] In one aspect, the present application discloses a combination of viruses produced by any embodiment of the present application, for improving the anti-tumor efficacy of the viruses.

[0075] The composition of the present application comprises at least one type of vector or virus of the present application. In addition, the composition may comprise at least two, three or four different vectors or viruses of the present application. In addition to the vector of the present application, the composition may also comprise any other vector, such as other adenovirus vectors, such as other therapeutically effective agents, any other agents such as pharmaceutically acceptable carriers, buffers, excipients, adjuvants, antiseptics, fillers, stabilizers or thickeners and / or any components commonly found in corresponding products.

[0076] The composition may be in any form suitable for administration, such as solid, semi-solid or liquid form. The formulation may be selected from, but not limited to, solutions, emulsions, suspensions, tablets, pills and capsules.

[0077] The compositions are immunogenic and / or antigenic compositions. The immunogenic and / or antigenic compositions provided herein can be prophylactic (to prevent infection), post-exposure (to treat after infection but before illness), or therapeutic (to treat disease).

[0078] The composition may include one or more other active agents, such as anti-inflammatory agents (e.g., p38 inhibitors, glutamate receptor antagonists, or calcium channel antagonists), AMPA receptor antagonists, chemotherapeutic agents, and / or antiproliferative agents. The composition may also include one or more antibacterial compounds. Examples of suitable antibacterial compounds include rifampicin, isoniazid, ethambutol, and pyrazinamide.

[0079] Suitable carriers and / or diluents are well known in the art and include pharmaceutical grades of starch, mannitol, lactose, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose (or other sugars), magnesium carbonate, gelatin, oils, alcohols, detergents, emulsifiers or water (preferably sterile). The composition may be a mixed preparation of the composition or may be a combined preparation for simultaneous, separate or sequential use (including administration).

[0080] The compositions of the present application for the above indications can be administered by any convenient method, for example by oral (including by inhalation), parenteral, mucosal (eg buccal, sublingual, nasal), rectal or transdermal administration, and the compositions can be adapted accordingly.

[0081] For oral administration, the composition can be formulated as liquid or solid, such as solutions, syrups, suspensions or emulsions, tablets, capsules and lozenges.

[0082] Liquid preparations are usually composed of suspensions or solutions of the compound or physiologically acceptable salt in a suitable aqueous or non-aqueous liquid carrier (e.g., water, ethanol, glycerol, polyethylene glycol or oil). The preparations may also contain suspending agents, preservatives, flavoring agents or coloring agents.

[0083] The composition in tablet form can be prepared using any suitable pharmaceutical carrier conventionally used for preparing solid dosage forms. Examples of such carriers include magnesium stearate, starch, lactose, sucrose and microcrystalline cellulose.

[0084] The composition in capsule form can be prepared using conventional encapsulation methods. For example, powders, granules or pellets containing the active ingredient can be prepared using standard carriers and then filled into hard gelatin capsules; alternatively, dispersions or suspensions can be prepared using any suitable pharmaceutical carrier (e.g., aqueous gums, celluloses, silicates or oils) and then filled into soft gelatin capsules.

[0085] Compositions for oral administration may be designed to protect the active ingredient from degradation as it passes through the digestive tract, for example by an outer coating of the formulation on a tablet or capsule.

[0086] Typical parenteral compositions consist of solutions or suspensions of the compound or a physiologically acceptable salt in a sterile aqueous or non-aqueous carrier or a parenterally acceptable oil (e.g., polyethylene glycol, polyvinyl pyrrolidone, lecithin, peanut oil or sesame oil). Alternatively, the solution may be lyophilized and then reconstituted with a suitable solvent prior to administration.

[0087] Compositions for nasal or oral administration can be conveniently formulated into aerosols, drops, gels and powders. Aerosol preparations typically contain solutions or fine suspensions of active substances in physiologically acceptable aqueous or non-aqueous solvents, and are typically present in a sealed container in a sterile form in single or multiple doses, which can be in the form of a cartridge or refilled with an atomizing device. Alternatively, the sealed container can be an integral dispensing device, such as a single-dose nasal inhaler or an aerosol dispenser equipped with a metering valve, which is discarded once the container contents are exhausted. When the dosage form includes an aerosol dispenser, it will contain a pharmaceutically acceptable propellant. Aerosol dosage forms can also be in the form of a pump-sprayer.

[0088] Compositions suitable for buccal or sublingual administration include tablets, lozenges and pastilles, wherein the active ingredient is formulated with a carrier such as sugar and acacia, tragacanth, or gelatin and glycerin.

[0089] Compositions for rectal or vaginal administration are conveniently in the form of suppositories (containing a conventional suppository base such as cocoa butter), pessaries, vaginal patches, foams or enemas.

[0090] Compositions suitable for transdermal administration include ointments, gels, patches and injections (including powder injections).

[0091] The composition is conveniently in unit dosage form such as tablets, capsules or ampoules.

[0092] Preferably the pharmaceutical composition is sterile. Preferably it is pyrogen-free. Preferably it is buffered, for example, between pH 6 and pH 8, typically about pH 7. Preferably the composition is substantially isotonic with the human body.

[0093] Preferably, the pharmaceutical composition of the present application delivers immunogenic or pharmaceutically effective viral vectors to the patient. "Immunogenic or pharmaceutically effective" as used herein means that the dosage (as a single dose or as a series of doses) to the individual is effective for preventing or treating a disease or condition. In particular, the phrase means that a sufficient amount of viral vectors are delivered to the patient within a suitable time frame, so that the patient's cells produce a sufficient amount of antigens to stimulate an immune response that is effective for preventing or treating a disease or condition. The amount varies according to the health and physical condition of the individual to be treated, age, the ability of the individual immune system, the degree of protection required, vaccine formulations, the doctor's assessment of the medical condition and other relevant factors.

[0094] Typically, a pharmaceutically effective dose contains 1×10 7 Up to 1×10 12 Virus particles (vp), preferably 1×10 7 Up to 1×10 11 More preferably, the pharmaceutically effective dose contains 2.5×10 10 vp to 5×10 10 A vp.

[0095] The pharmaceutical composition can be produced by any conventional method known in the art, for example by utilizing any of the following methods: batch, fed-batch and perfusion culture modes, column chromatography purification, CsCl gradient purification and perfusion mode utilizing a low shear cell retention device.

[0096] Application

[0097] The infectious polynucleotide, viral vector, virus or pharmaceutical composition of the present application can be administered to any eukaryotic subject selected from plants, animals and humans. In a preferred embodiment of the present application, the subject is a human or an animal.

[0098] Any conventional method can be used to administer the infectious polynucleotide, viral vector, virus or pharmaceutical composition to the subject. The route of administration depends on the formulation or form of the composition, the disease, tumor location, patient, comorbidities and other factors. In a preferred embodiment of the present application, administration is performed by intratumoral, intramuscular, intraarterial, intravenous, intrapleural, intravascular, intracavitary or intraperitoneal injection or oral administration.

[0099] Only one administration of the oncolytic adenoviral vector of the present application may have a therapeutic effect. However, in a preferred embodiment of the present application, an oncolytic adenoviral vector, virus or pharmaceutical composition is administered several times during treatment. An oncolytic adenoviral vector, virus or pharmaceutical composition may be administered, for example, 1 to 10 times in the first 2 weeks, 4 weeks, monthly or during treatment. In one embodiment of the present application, 3 to 7 times are administered in the first 2 weeks, then in the 4th week, and then monthly. In a specific embodiment of the present application, 4 times are administered in the first 2 weeks, then in the 4th week, and then monthly. The length of the treatment period may vary, for example, it may last for 2 to 12 months or longer. The infectious polynucleotides, viral vectors, viruses or pharmaceutical compositions provided in the present application can effectively avoid neutralizing antibodies in subjects and improve anti-tumor efficiency.

[0100] The oncolytic virus therapy provided in the present application is effective alone, but the combination of oncolytic virus therapy and any other therapy, such as conventional therapy, is more effective than any single therapy. For example, each agent of the combination therapy can work independently in tumor tissue, and adenovirus vectors can make cells sensitive to chemotherapy or radiotherapy and / or chemotherapeutic agents can increase the level of viral replication or affect the receptor state of target cells. Alternatively, the combination can regulate the subject's immune system in a manner that is beneficial for the efficacy of treatment. For example, chemotherapy can be used to downregulate suppressor cells such as regulatory T cells. Alternatively, chemotherapy can be used after oncolytic virus therapy to enhance immune response (by killing tumor cells and subsequently releasing epitopes and / or viruses). Chemotherapy can also sensitize tumor cells to oncolytic viruses, and vice versa. The reagent of the combined therapy can be administered simultaneously or successively. In a preferred embodiment of the present application, the patient receives cyclophosphamide at the same time to enhance the immune effect of treatment.

[0101] In a preferred embodiment of the present application, the method or use further comprises administering concurrent radiotherapy to the subject. In another preferred embodiment of the present application, the method or use further comprises administering concurrent chemotherapy to the subject. In another preferred embodiment of the present application, the method or use further comprises administering other oncolytic adenoviruses or vaccine viruses to the subject. The administration of the vector may be simultaneous or sequential.

[0102] As used herein, "synchronous" refers to a therapy administered before, after, or simultaneously with the gene therapy of the present application. The time period of synchronous therapy can vary from a few minutes to a few weeks. Preferably, synchronous therapy lasts for several hours. In one embodiment, cyclophosphamide is administered by intravenous bolus and oral administration in a rhythmic manner.

[0103] Agents suitable for combination therapy include, but are not limited to, all trans-retinoic acid, azacitidine, azathioprine, bleomycin, carboplatin, capecitabine, cisplatin, chlorambucil, cyclophosphamide, cytarabine, daunorubicin, docetaxel, doxifluridine, doxorubicin, epirubicin, aboxilone, etoposide, fluorouracil, gemcitabine, hydroxyurea, idarubicin, imatinib, nitrogen mustard, mercaptopurine, methotrexate, mitoxantrone, oxaliplatin, paclitaxel, pemetrexed, temozolomide, teniposide, thioguanine, valrubicin, vinblastine, vincristine, vindesine, and vinorelbine.

[0104] In a preferred embodiment of the present application, the method or use further comprises administering verapamil or another calcium channel blocker to the subject. "Calcium channel blocker" refers to a drug and a natural substance that disrupts the conduction of calcium channels, which can be selected from verapamil, dihydropyridine, gallopamil, diltiazem, mirapamil, bepridil, fluspirin and fendiline.

[0105] In a preferred embodiment of the present application, the method or use further comprises administering an autophagy inducer to the subject. Autophagy refers to a catalytic process involving degradation of the cell's own components by a lysosomal mechanism. "Autophagy inducer" refers to an agent capable of inducing autophagy, which may be selected from, but not limited to, mTOR inhibitors, PI3K inhibitors, lithium, tamoxifen, chloroquine, bafilomycin, temsirolimus, sirolimus and temozolomide. In a specific embodiment of the present application, the method further comprises administering temozolomide to the subject. Temozolomide may be oral or intravenous temozolomide. An autophagy inducer may be combined with an immunomodulator. In one embodiment, an oncolytic adenovirus encoding an anti-CTLA4mAb is combined with temozolomide and cyclophosphamide.

[0106] Any method or use of the present application may be an in vivo, ex vivo or in vitro method or use.

[0107] Herein, the tumor or cancer is selected from the group consisting of nasopharyngeal carcinoma, synovial cancer, hepatocellular carcinoma, renal cancer, cancer of connective tissue, melanoma, lung cancer, intestinal cancer, colon cancer, rectal cancer, colorectal cancer, brain cancer, laryngeal cancer, oral cancer, liver cancer, bone cancer, pancreatic cancer, choriocarcinoma, gastrinoma, pheochromocytoma, prolactinoma, T-cell leukemia / lymphoma, neuroma, von Hippel-Lindaudiase disease, Zollinger-Ellison syndrome ), adrenal cancer, anal cancer, bile duct cancer, bladder cancer, ureteral cancer, oligodendroglioma, neuroblastoma, meningioma, spinal cord tumor, osteochondroma, chondrosarcoma, Ewing's sarcoma, cancer of unknown primary site, carcinoid, gastrointestinal carcinoid, fibrosarcoma, breast cancer, Paget's disease, cervical cancer, esophageal cancer, gallbladder cancer, head cancer ), eye cancer, neck cancer, kidney cancer, Wilms' tumor, Kaposi's sarcoma, prostate cancer, testicular cancer, Hodgkin's disease, non-Hodgkin's lymphoma, skin cancer, mesothelioma, multiple myeloma, ovarian cancer, endocrine pancreatic cancer, glucagonoma, pancreatic cancer, parathyroid cancer, penile cancer, pituitary cancer, soft tissue sarcoma, retinoblastoma, small intestine cancer, stomach cancer, thymus cancer, thyroid cancer, trophoblastic cancer, Hydatidiform mole, uterine cancer, endometrial cancer, vaginal cancer, vulvar cancer, acoustic neuroma, mycosis fungoides, insulinoma, carcinoid syndrome, somatostatinoma, gum cancer, heart cancer, lip cancer, meninges cancer, oral cancer, nerve cancer, palate cancer, parotid cancer, peritoneal cancer, pharyngeal cancer, pleural cancer, salivary gland cancer, tongue cancer and tonsil cancer.

[0108] First vector and first virus

[0109] The embodiment provides a first vector and a first virus carrying a first genome. Figure 1As shown, the first genome is a genome obtained by replacing the E1Ap promoter of the wild genome with the hTERTp promoter (SEQ ID NO: 1). In some embodiments, the wild genome is selected from the genome of human adenovirus type 4, the genome of human adenovirus type 7, the genome of human adenovirus type 11, the genome of human adenovirus type 14, the genome of human adenovirus type 17, the genome of human adenovirus type 21, the genome of human adenovirus type 34, the genome of human adenovirus type 35, the genome of human adenovirus type 37, and the genome of human adenovirus type 50.

[0110] In some embodiments, the first genome is a genome in which the 469-575 nt region of GenBank:AY487947.1 (a known genome sequence of human adenovirus type 4 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1.

[0111] In some embodiments, the first genome is a genome in which the 480-575 nt region of GenBank: KC857700.1 (a known genome sequence of human adenovirus type 7 in the NCBI database) is replaced with the sequence shown in SEQ ID NO: 1.

[0112] In some embodiments, the first genome is a genome in which the 471-567 nt region of GenBank: AF532578.1 (a known genome sequence of human adenovirus type 11 in the NCBI database) is replaced with the sequence shown in SEQ ID NO: 1.

[0113] In some embodiments, the first genome is a genome in which the 494-586 nt region of GenBank: AY803294.1 (a known genome sequence of human adenovirus type 14 in the NCBI database) is replaced with the sequence shown in SEQ ID NO: 1.

[0114] In some embodiments, the first genome is a genome in which the 446-559 nt region of GenBank: HQ910407.1 (a known genome sequence of human adenovirus type 17 in the NCBI database) is replaced with the sequence shown in SEQ ID NO: 1.

[0115] In some embodiments, the first genome is a genome in which the 458-571 nt region of GenBank: KF528688.1 (a known genome sequence of human adenovirus type 21 in the NCBI database) is replaced with the sequence shown in SEQ ID NO: 1.

[0116] In some embodiments, the first genome is a genome in which the 477-568 nt region of GenBank: AY737797.1 (a known genome sequence of human adenovirus type 34 in the NCBI database) is replaced with the sequence shown in SEQ ID NO: 1.

[0117] In some embodiments, the first genome is a genome in which the 477-568 nt region of GenBank: AY271307.1 (a known genome sequence of human adenovirus type 35 in the NCBI database) is replaced with the sequence shown in SEQ ID NO: 1.

[0118] In some embodiments, the first genome is a genome in which the 480-569 nt region of GenBank: AB448778.1 (a known genome sequence of human adenovirus type 37 in the NCBI database) is replaced with the sequence shown in SEQ ID NO: 1.

[0119] In some embodiments, the first genome is a genome in which the 477-572 nt region of GenBank:AY737798.1 (a known genome sequence of human adenovirus type 50 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1.

[0120] In some embodiments, the method for preparing the first carrier comprises:

[0121] 1) Obtain a vector carrying a wild genome and a first SM expression cassette. The first SM expression cassette includes a first upstream homology arm (HAF), an SM screening marker, and a first downstream homology arm (HAR). The first upstream homology arm is homologous to the upstream of the wild genome E1Ap promoter. The first downstream homology arm is homologous to the downstream of the wild genome E1Ap promoter. The SM screening marker includes a sequence consisting of a sequentially connected IPpol restriction site, an ampicillin resistance gene promoter, an ampicillin resistance gene, a ccdB toxic gene promoter, a ccdB toxic gene, and a terminator. The SM screening marker is shown in SEQ ID NO:6.

[0122] 2) The vector of step 1) and the first SM expression cassette are co-transformed into Escherichia coli for linear-circular homologous recombination (LCHR) so that the SM selection marker replaces the E1Ap promoter of the wild genome.

[0123] 3) The vector obtained in step 2) is linearized and transferred into Escherichia coli together with a sequence consisting of a first upstream homology arm, an hTERTp promoter and a first downstream homology arm for linear-linear homologous recombination (LLHR), so that the promoter hTERTp replaces the first SM expression cassette to form a first genome and obtain a first vector.

[0124] In which, step 2) can use a host E. coli capable of linear-circular homologous recombination, such as E. coli GB Red-GyrA462 (Gene Bridges GmbH, Heidelberg, Germany). Step 3) can use a host E. coli capable of linear-linear homologous recombination (LLHR), such as E. coli GB05-Dir (Gene Bridges GmbH, Heidelberg, Germany).

[0125] In some embodiments, the method for preparing the first virus includes: releasing the first genome from the first vector, transfecting a host cell with the first genome, replicating the first genome in the host cell, transcribing and translating the first genome to obtain viral proteins, and assembling the viral proteins to obtain the first virus.

[0126] In some embodiments, the host cell can be any cell that can be infected and replicated by the first genome, such as nasopharyngeal carcinoma cells, synovial carcinoma cells, liver cancer cells, kidney cancer cells, cancer cells of connective tissue, melanoma cells, lung cancer cells, intestinal cancer cells, colon cancer cells, rectal cancer cells, colorectal cancer cells, brain cancer cells, laryngeal cancer cells, oral cancer cells, liver cancer cells, bone cancer cells, pancreatic cancer cells, choriocarcinoma cells, gastrinoma cells, pheochromoma cells, prolactinoma cells, T-cell leukemia / lymphoma cells, neuroma cells, adrenal cancer cells, anal cancer cells, bile duct cancer cells, bladder cancer cells, ureteral cancer cells, oligodendroglioma cells, neuroblastoma cells, meningioma cells, spinal cord tumor cells, osteochondroma cells, chondrosarcoma cells, Ewing's sarcoma cells, cancer cells of unknown primary site, carcinoid cells, gastrointestinal carcinoma cells, fibrosarcoma cells, breast cancer cells, cervical cancer cells, esophageal cancer cells, gallbladder cancer cells, head cancer cells, eye cancer cells, neck cancer cells, kidney cancer cells, Wilms' tumor cells, Kaposi's sarcoma cells, prostate cancer cells adenocarcinoma cell, testicular cancer cell, Hodgkin's disease cell, non-Hodgkin's lymphoma cell, skin cancer cell, mesothelioma cell, multiple myeloma cell, ovarian cancer cell, endocrine pancreatic cancer cell, glucagonoma cell, pancreatic cancer cell, parathyroid cancer cell, penis cancer cell, pituitary cancer cell, soft tissue sarcoma cell, retinoblastoma cell, small intestine cancer cell, gastric cancer cell, thymus cancer cell, thyroid cancer cell, trophoblast cancer cell, uterine cancer cell, endometrial cancer cell, vaginal cancer cell, vulvar cancer cell, acoustic neuroma cell, insulinoma cell, somatostatinoma cell, heart cancer cell, lip cancer cell, meningeal cancer cell, oral cancer cell, neural cancer cell, palate cancer cell, parotid cancer cell, peritoneal cancer cell, pharyngeal cancer cell, pleural cancer cell, salivary gland cancer cell, tongue cancer cell and tonsil cancer cell, for another example, the host cell is selected from HEK293 cell, Ad293 cell, Ad293-E3 cell, A549 cell, SKBr3 cell, MCF-7 cell, MDA-MB-231 cell or Hs578T cell.

[0127] Second vector and second virus

[0128] The embodiment provides a second vector and a second virus carrying a second genome. The second genome is a genome formed by replacing the E1Ap promoter of the wild genome with the hTERTp promoter and the E3gp19K gene with the first expression cassette. In some embodiments, the wild genome is selected from the genome of human adenovirus type 4, the genome of human adenovirus type 7, the genome of human adenovirus type 11, the genome of human adenovirus type 14, the genome of human adenovirus type 17, the genome of human adenovirus type 21, the genome of human adenovirus type 34, the genome of human adenovirus type 35, the genome of human adenovirus type 37, and the genome of human adenovirus type 50.

[0129] In some embodiments, the second genome is a genome in which the 469-575nt region of GenBank:AY487947.1 (known genome sequence of human adenovirus type 4 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, and the 27,893...28,417nt region is replaced with the sequence shown in SEQ ID NO:2.

[0130] In some embodiments, the second genome is a genome in which the 480-575nt region of GenBank: KC857700.1 (known genome sequence of human adenovirus type 7 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, and the 28,054...28,572nt region is replaced with the sequence shown in SEQ ID NO:2.

[0131] In some embodiments, the second genome is a genome in which the 471-567nt region of GenBank: AF532578.1 (known genome sequence of human adenovirus type 11 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, and the 27,836...28,336nt region is replaced with the sequence shown in SEQ ID NO:2.

[0132] In some embodiments, the second genome is a genome in which the 494-586nt region of GenBank:AY803294.1 (known genome sequence of human adenovirus type 14 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, and the 27,823...28,323nt region is replaced with the sequence shown in SEQ ID NO:2.

[0133] In some embodiments, the second genome is a genome in which the 446-559nt region of GenBank: HQ910407.1 (known genome sequence of human adenovirus type 17 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, and the 27,052...27,525nt region is replaced with the sequence shown in SEQ ID NO:2.

[0134] In some embodiments, the second genome is a genome in which the 458-571nt region of GenBank: KF528688.1 (known genome sequence of human adenovirus type 21 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, and the 28,151...28,669nt region is replaced with the sequence shown in SEQ ID NO:2.

[0135] In some embodiments, the second genome is a genome in which the 477-568nt region of GenBank:AY737797.1 (known genome sequence of human adenovirus type 34 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, and the 27,836...28,336nt region is replaced with the sequence shown in SEQ ID NO:2.

[0136] In some embodiments, the second genome is a genome in which the 477-568nt region of GenBank:AY271307.1 (known genome sequence of human adenovirus type 35 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, and the 27,850...28,350nt region is replaced with the sequence shown in SEQ ID NO:2.

[0137] In some embodiments, the second genome is a genome in which the 480-569nt region of GenBank:AB448778.1 (known genome sequence of human adenovirus type 37 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, and the 27,030...27,530nt region is replaced with the sequence shown in SEQ ID NO:2.

[0138] In some embodiments, the second genome is a genome in which the 477-572nt region of GenBank:AY737798.1 (known genome sequence of human adenovirus type 50 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, and the 28,119...28,637nt region is replaced with the sequence shown in SEQ ID NO:2.

[0139] In some embodiments, the method for preparing the second carrier comprises:

[0140] 1) Prepare the first carrier according to the above method.

[0141] 2) The first vector and the second SM expression cassette are co-transformed into Escherichia coli for linear-circular homologous recombination (LCHR) so that the second SM expression cassette replaces the E3gp19K gene of the wild genome. The second SM expression cassette includes a second upstream homology arm, an SM screening marker, and a second downstream homology arm. The second upstream homology arm is homologous to the upstream of the wild genome E3gp19K gene. The second downstream homology arm is homologous to the downstream of the wild genome E3gp19K gene. The SM screening marker is shown in SEQ ID NO:6.

[0142] 3) The vector obtained in step 2) is linearized and co-transfected into Escherichia coli together with a sequence consisting of the second upstream homology arm, the first expression cassette (SEQ ID NO: 2) and the second downstream homology arm for linear-linear homologous recombination (LLHR) so that the first expression cassette replaces the second SM expression cassette to form a second genome and obtain a second vector.

[0143] In particular, step 2) may employ a host E. coli capable of linear-circular homologous recombination, such as E. coli GBRed-GyrA462. Step 3) may employ a host E. coli capable of linear-linear homologous recombination (LLHR), such as E. coli GB05-Dir.

[0144] In some embodiments, the method for preparing the second virus includes: releasing the second genome from the second vector, transfecting the host cell with the second genome and replicating the second genome in the cell, transcribing and translating the second genome to obtain viral proteins, and assembling the viral proteins to obtain the second virus.

[0145] In some embodiments, the host cell can be any cell that can be infected and replicated by the second genome, such as nasopharyngeal carcinoma cells, synovial carcinoma cells, liver cancer cells, kidney cancer cells, cancer cells of connective tissue, melanoma cells, lung cancer cells, intestinal cancer cells, colon cancer cells, rectal cancer cells, colorectal cancer cells, brain cancer cells, laryngeal cancer cells, oral cancer cells, liver cancer cells, bone cancer cells, pancreatic cancer cells, choriocarcinoma cells, gastrinoma cells, pheochromoma cells, prolactinoma cells, T-cell leukemia / lymphoma cells, neuroma cells, adrenal cancer cells, anal cancer cells, bile duct cancer cells, bladder cancer cells, ureteral cancer cells, oligodendroglioma cells, neuroblastoma cells, meningioma cells, spinal cord tumor cells, osteochondroma cells, chondrosarcoma cells, Ewing's sarcoma cells, cancer cells of unknown primary site, carcinoid cells, gastrointestinal carcinoma cells, fibrosarcoma cells, breast cancer cells, cervical cancer cells, esophageal cancer cells, gallbladder cancer cells, head cancer cells, eye cancer cells, neck cancer cells, kidney cancer cells, Wilms' tumor cells, Kaposi's sarcoma cells, prostate cancer cells adenocarcinoma cell, testicular cancer cell, Hodgkin's disease cell, non-Hodgkin's lymphoma cell, skin cancer cell, mesothelioma cell, multiple myeloma cell, ovarian cancer cell, endocrine pancreatic cancer cell, glucagonoma cell, pancreatic cancer cell, parathyroid cancer cell, penis cancer cell, pituitary cancer cell, soft tissue sarcoma cell, retinoblastoma cell, small intestine cancer cell, gastric cancer cell, thymus cancer cell, thyroid cancer cell, trophoblast cancer cell, uterine cancer cell, endometrial cancer cell, vaginal cancer cell, vulvar cancer cell, acoustic neuroma cell, insulinoma cell, somatostatinoma cell, heart cancer cell, lip cancer cell, meningeal cancer cell, oral cancer cell, neural cancer cell, palate cancer cell, parotid cancer cell, peritoneal cancer cell, pharyngeal cancer cell, pleural cancer cell, salivary gland cancer cell, tongue cancer cell and tonsil cancer cell, for another example, the host cell is selected from HEK293 cell, Ad293 cell, Ad293-E3 cell, A549 cell, SKBr3 cell, MCF-7 cell, MDA-MB-231 cell or Hs578T cell.

[0146] The third vector and the third virus

[0147] The embodiment provides a third vector and a third virus carrying a third genome. The third genome is a genome formed by replacing the E1A promoter of the wild genome with the promoter hTERTp, and replacing the promoter of the E1B gene and its partial sequence with the second expression cassette. In some embodiments, the wild genome is selected from the genome of human adenovirus type 4, the genome of human adenovirus type 7, the genome of human adenovirus type 11, the genome of human adenovirus type 14, the genome of human adenovirus type 17, the genome of human adenovirus type 21, the genome of human adenovirus type 34, the genome of human adenovirus type 35, the genome of human adenovirus type 37, and the genome of human adenovirus type 50.

[0148] In some embodiments, the third genome is a genome in which the 469-575nt region of GenBank:AY487947.1 (known genome sequence of human adenovirus type 4 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, and the 1439..1907nt region is replaced with the sequence shown in SEQ ID NO:3.

[0149] In some embodiments, the third genome is a genome in which the 480-575nt region of GenBank: KC857700.1 (known genome sequence of human adenovirus type 7 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, and the 1453..1910nt region is replaced with the sequence shown in SEQ ID NO:3.

[0150] In some embodiments, the third genome is a genome in which the 471-567nt region of GenBank: AF532578.1 (known genome sequence of human adenovirus type 11 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, and the 1334..1917nt region is replaced with the sequence shown in SEQ ID NO:3.

[0151] In some embodiments, the third genome is a genome in which the 494-586nt region of GenBank:AY803294.1 (known genome sequence of human adenovirus type 14 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, and the 1454..1933nt region is replaced with the sequence shown in SEQ ID NO:3.

[0152] In some embodiments, the third genome is a genome in which the 446-559nt region of GenBank: HQ910407.1 (known genome sequence of human adenovirus type 17 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, and the 1413..1876nt region is replaced with the sequence shown in SEQ ID NO:3.

[0153] In some embodiments, the third genome is a genome in which the 458-571nt region of GenBank: KF528688.1 (known genome sequence of human adenovirus type 21 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, and the 1448..1905nt region is replaced with the sequence shown in SEQ ID NO:3.

[0154] In some embodiments, the third genome is a genome in which the 477-568nt region of GenBank:AY737797.1 (known genome sequence of human adenovirus type 34 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, and the 1335..1918nt region is replaced with the sequence shown in SEQ ID NO:3.

[0155] In some embodiments, the third genome is a genome in which the 477-568nt region of GenBank:AY271307.1 (known genome sequence of human adenovirus type 35 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, and the 1335..1918nt region is replaced with the sequence shown in SEQ ID NO:3.

[0156] In some embodiments, the third genome is a genome in which the 480-569nt region of GenBank:AB448778.1 (known genome sequence of human adenovirus type 37 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, and the 1424..1885nt region is replaced with the sequence shown in SEQ ID NO:3.

[0157] In some embodiments, the third genome is a genome in which the 477-572nt region of GenBank:AY737798.1 (known genome sequence of human adenovirus type 50 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, and the 1449..1906nt region is replaced with the sequence shown in SEQ ID NO:3.

[0158] The preparation method of the third carrier comprises:

[0159] 1) Prepare the first carrier according to the above method.

[0160] 2) The first vector and the third SM expression cassette are co-transformed into Escherichia coli for linear-circular homologous recombination (LCHR) so that the third SM expression cassette replaces the promoter and partial sequence of the E1B gene of the wild genome. The third SM expression cassette includes a third upstream homology arm, an SM screening marker, and a third downstream homology arm. The third upstream homology arm is homologous to the upstream of the wild genome E1B gene promoter. The third downstream homology arm is homologous to the downstream of the wild genome E1B19K gene.

[0161] 3) The vector obtained in step 2) is linearized and co-transfected into Escherichia coli together with a sequence consisting of a third upstream homologous arm, a second expression cassette (SEQ ID NO: 3) and a third downstream homologous arm for linear-linear homologous recombination (LLHR), so that the second expression cassette replaces the third SM expression cassette to form a third genome and obtain a third vector.

[0162] In particular, step 2) may employ a host E. coli capable of linear-circular homologous recombination, such as E. coli GBRed-GyrA462. Step 3) may employ a host E. coli capable of linear-linear homologous recombination (LLHR), such as E. coli GB05-Dir.

[0163] In some embodiments, the method for preparing the third virus includes: releasing the third genome from the third vector, transfecting the host cell with the third genome and replicating the third genome in the cell, transcribing and translating the third genome to obtain viral proteins, and assembling the viral proteins to obtain the third virus.

[0164] In some embodiments, the host cell can be any cell that can be infected and replicated by the third genome, such as nasopharyngeal carcinoma cells, synovial carcinoma cells, liver cancer cells, kidney cancer cells, cancer cells of connective tissue, melanoma cells, lung cancer cells, intestinal cancer cells, colon cancer cells, rectal cancer cells, colorectal cancer cells, brain cancer cells, laryngeal cancer cells, oral cancer cells, liver cancer cells, bone cancer cells, pancreatic cancer cells, choriocarcinoma cells, gastrinoma cells, pheochromoma cells, prolactinoma cells, T-cell leukemia / lymphoma cells, neuroma cells, adrenal cancer cells, anal cancer cells, bile duct cancer cells, bladder cancer cells, ureteral cancer cells, oligodendroglioma cells, neuroblastoma cells, meningioma cells, spinal cord tumor cells, osteochondroma cells, chondrosarcoma cells, Ewing's sarcoma cells, cancer cells of unknown primary site, carcinoid cells, gastrointestinal carcinoma cells, fibrosarcoma cells, breast cancer cells, cervical cancer cells, esophageal cancer cells, gallbladder cancer cells, head cancer cells, eye cancer cells, neck cancer cells, kidney cancer cells, Wilms' tumor cells, Kaposi's sarcoma cells, prostate cancer cells, adenocarcinoma cell, testicular cancer cell, Hodgkin's disease cell, non-Hodgkin's lymphoma cell, skin cancer cell, mesothelioma cell, multiple myeloma cell, ovarian cancer cell, endocrine pancreatic cancer cell, glucagonoma cell, pancreatic cancer cell, parathyroid cancer cell, penis cancer cell, pituitary cancer cell, soft tissue sarcoma cell, retinoblastoma cell, small intestine cancer cell, gastric cancer cell, thymus cancer cell, thyroid cancer cell, trophoblast cancer cell, uterine cancer cell, endometrial cancer cell, vaginal cancer cell, vulvar cancer cell, acoustic neuroma cell, insulinoma cell, somatostatinoma cell, heart cancer cell, lip cancer cell, meningeal cancer cell, oral cancer cell, neural cancer cell, palate cancer cell, parotid cancer cell, peritoneal cancer cell, pharyngeal cancer cell, pleural cancer cell, salivary gland cancer cell, tongue cancer cell and tonsil cancer cell, for another example, the host cell is selected from HEK293 cell, Ad293 cell, Ad293-E3 cell, A549 cell, SKBr3 cell, MCF-7 cell, MDA-MB-231 cell or Hs578T cell.

[0165] The fourth vector and the fourth virus

[0166] The embodiment provides a fourth vector and a fourth virus carrying a fourth genome. The fourth genome is a genome formed by replacing the E1A promoter of the wild genome with the promoter hTERTp, replacing the E3gp19K gene with the first expression cassette, and replacing the promoter of the E1B gene and a partial sequence thereof with the second expression cassette. In some embodiments, the wild genome is selected from the genome of human adenovirus type 4, the genome of human adenovirus type 7, the genome of human adenovirus type 11, the genome of human adenovirus type 14, the genome of human adenovirus type 17, the genome of human adenovirus type 21, the genome of human adenovirus type 34, the genome of human adenovirus type 35, the genome of human adenovirus type 37, and the genome of human adenovirus type 50.

[0167] In some embodiments, the fourth genome is a genome in which the 469-575nt region of GenBank:AY487947.1 (known genome sequence of human adenovirus type 4 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, the 27,893...28,417nt region is replaced with the sequence described in SEQ ID NO:2, and the 1439..1907nt region is replaced with the sequence described in SEQ ID NO:3.

[0168] In some embodiments, the fourth genome is a genome in which the 480-575nt region of GenBank: KC857700.1 (known genome sequence of human adenovirus type 7 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, the 28,054...28,572nt region is replaced with the sequence described in SEQ ID NO:2, and the 1453..1910nt region is replaced with the sequence described in SEQ ID NO:3.

[0169] In some embodiments, the fourth genome is a genome in which the 471-567nt region of GenBank: AF532578.1 (known genome sequence of human adenovirus type 11 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, the 27,836...28,336nt region is replaced with the sequence described in SEQ ID NO:2, and the 1334..1917nt region is replaced with the sequence described in SEQ ID NO:3.

[0170] In some embodiments, the fourth genome is a genome in which the 494-586nt region of GenBank:AY803294.1 (known genome sequence of human adenovirus type 14 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, the 27,823...28,323nt region is replaced with the sequence described in SEQ ID NO:2, and the 1454..1933nt region is replaced with the sequence described in SEQ ID NO:3.

[0171] In some embodiments, the fourth genome is a genome in which the 446-559nt region of GenBank: HQ910407.1 (known genome sequence of human adenovirus type 17 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, the 27,052...27,525nt region is replaced with the sequence described in SEQ ID NO:2, and the 1413..1876nt region is replaced with the sequence described in SEQ ID NO:3.

[0172] In some embodiments, the fourth genome is a genome in which the 458-571nt region of GenBank: KF528688.1 (known genome sequence of human adenovirus type 21 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, the 28,151...28,669nt region is replaced with the sequence described in SEQ ID NO:2, and the 1448..1905nt region is replaced with the sequence described in SEQ ID NO:3.

[0173] In some embodiments, the fourth genome is a genome in which the 477-568nt region of GenBank:AY737797.1 (known genome sequence of human adenovirus type 34 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, the 27,836...28,336nt region is replaced with the sequence described in SEQ ID NO:2, and the 1335..1918nt region is replaced with the sequence described in SEQ ID NO:3.

[0174] In some embodiments, the fourth genome is a genome in which the 477-568nt region of GenBank:AY271307.1 (known genome sequence of human adenovirus type 35 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, the 27,850...28,350nt region is replaced with the sequence described in SEQ ID NO:2, and the 1335..1918nt region is replaced with the sequence described in SEQ ID NO:3.

[0175] In some embodiments, the fourth genome is a genome in which the 480-569nt region of GenBank:AB448778.1 (known genome sequence of human adenovirus type 37 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, the 27,030...27,530nt region is replaced with the sequence described in SEQ ID NO:2, and the 1424..1885nt region is replaced with the sequence described in SEQ ID NO:3.

[0176] In some embodiments, the fourth genome is a genome in which the 477-572nt region of GenBank:AY737798.1 (known genome sequence of human adenovirus type 50 in the NCBI database) is replaced with the sequence shown in SEQ ID NO:1, the 28,119...28,637nt region is replaced with the sequence described in SEQ ID NO:2, and the 1449..1906nt region is replaced with the sequence described in SEQ ID NO:3.

[0177] The preparation method of the fourth carrier comprises:

[0178] 1) Prepare the third carrier according to the above method.

[0179] 2) The third vector and the second SM expression cassette are co-transformed into Escherichia coli for linear-circular homologous recombination (LCHR) so that the second SM expression cassette replaces the E3gp19K gene of the wild genome. The second SM expression cassette includes a second upstream homology arm, a SM selection marker, and a second downstream homology arm. The second upstream homology arm is homologous to the upstream of the wild genome E3gp19K gene. The second downstream homology arm is homologous to the downstream of the wild genome E3gp19K gene.

[0180] 3) The vector obtained in step 2) is linearized and co-transfected into Escherichia coli together with a sequence consisting of the second upstream homology arm, the first expression cassette (SEQ ID NO: 2) and the second downstream homology arm for linear-linear homologous recombination (LLHR) so that the first expression cassette replaces the second SM expression cassette to form a fourth genome and obtain a fourth vector.

[0181] In particular, step 2) may employ a host E. coli capable of linear-circular homologous recombination, such as E. coli GBRed-GyrA462. Step 3) may employ a host E. coli capable of linear-linear homologous recombination (LLHR), such as E. coli GB05-Dir.

[0182] In some embodiments, the method for preparing the fourth virus includes: releasing the fourth genome from the fourth vector, transfecting the host cell with the fourth genome and replicating the fourth genome in the cell, transcribing and translating the fourth genome to obtain viral proteins, and assembling the viral proteins to obtain the fourth virus.

[0183] In some embodiments, the host cell can be any cell that can be infected and replicated by the fourth genome, such as nasopharyngeal carcinoma cells, synovial carcinoma cells, liver cancer cells, kidney cancer cells, cancer cells of connective tissue, melanoma cells, lung cancer cells, intestinal cancer cells, colon cancer cells, rectal cancer cells, colorectal cancer cells, brain cancer cells, laryngeal cancer cells, oral cancer cells, liver cancer cells, bone cancer cells, pancreatic cancer cells, choriocarcinoma cells, gastrinoma cells, pheochromoma cells, prolactinoma cells, T-cell leukemia / lymphoma cells, neuroma cells, adrenal cancer cells, anal cancer cells, bile duct cancer cells, bladder cancer cells, ureteral cancer cells, oligodendroglioma cells, neuroblastoma cells, meningioma cells, spinal cord tumor cells, osteochondroma cells, chondrosarcoma cells, Ewing's sarcoma cells, cancer cells of unknown primary site, carcinoid cells, gastrointestinal carcinoma cells, fibrosarcoma cells, breast cancer cells, cervical cancer cells, esophageal cancer cells, gallbladder cancer cells, head cancer cells, eye cancer cells, neck cancer cells, kidney cancer cells, Wilms' tumor cells, Kaposi's sarcoma cells, prostate cancer cells, adenocarcinoma cell, testicular cancer cell, Hodgkin's disease cell, non-Hodgkin's lymphoma cell, skin cancer cell, mesothelioma cell, multiple myeloma cell, ovarian cancer cell, endocrine pancreatic cancer cell, glucagonoma cell, pancreatic cancer cell, parathyroid cancer cell, penis cancer cell, pituitary cancer cell, soft tissue sarcoma cell, retinoblastoma cell, small intestine cancer cell, gastric cancer cell, thymus cancer cell, thyroid cancer cell, trophoblast cancer cell, uterine cancer cell, endometrial cancer cell, vaginal cancer cell, vulvar cancer cell, acoustic neuroma cell, insulinoma cell, somatostatinoma cell, heart cancer cell, lip cancer cell, meningeal cancer cell, oral cancer cell, neural cancer cell, palate cancer cell, parotid cancer cell, peritoneal cancer cell, pharyngeal cancer cell, pleural cancer cell, salivary gland cancer cell, tongue cancer cell or tonsil cancer cell, for another example, the host cell is selected from HEK293 cell, Ad293 cell, Ad293-E3 cell, A549 cell, SKBr3 cell, MCF-7 cell, MDA-MB-231 cell or Hs578T cell.

[0184] Cell culture

[0185] Two triple-negative breast cancer cell lines MDA-MB-231 (ATCC, American Type Culture Collection) and Hs578T (ATCC), invasive breast cancer cell line MCF-7 (ATCC) and lung adenocarcinoma cell line A549 (ATCC) were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS) and 1% penicillin and streptomycin (P / s). The breast cancer cell line SKBr3 (ATCC) was cultured in modified McCoy's 5A medium supplemented with 20% FBS gold and 1% P / s at 37°C and 5% CO2. All reagents were from PanBiotech, Aidenbach, Germany.

[0186] Flow cytometry was used to detect the expression of CAR and CD46 in cancer cells

[0187] CAR is a receptor for Ad5 used as an oncolytic virus, and CD46 is a receptor for Ad34 and Ad35 used as an oncolytic virus. Both CAR and CD46 have been shown to make Ad34 and Ad35 oncolytic viruses with low seropositivity and not bound to platelet factor 4 (PF4). To this end, the present application also tested the expression of CAR and CD46 in different cancer cells by flow cytometry, thinking that the recombinant virus provided by the test application can lyse these cancer cells or tissues.

[0188] To detect the expression of CAR and CD46 in four breast cancer cell lines, the cells were scraped off the cell culture plates to keep the extracellular receptors intact. The cells were counted to 100,000 cells per cell line, washed twice with DPBS (PanBiotech, Aidenbach, Germany), and resuspended with 100 μL DPBS. The cells were incubated with PE-coupled anti-CAR IgG antibodies (SinoBiological, anti-human CXADR / CAR antibody (PE)) and FITC-coupled anti-CD46 IgG antibodies (BioLegend, anti-human CD46 antibody (FITC)) at a concentration of 2 μg / mL at 4 ° C for 1 h. After incubation, the cells were washed twice with DPBS and resuspended in 120 μL DPBS. After the cells were transferred to a 96-well microplate (Sarstedt, 82.1581), the expression of CAR and CD46 was detected using CytoFLEX from Beckman Coulter (Brea, CA, USA), and analyzed using their CytExpert software (Version 2.4) and FlowJo software (BD Biosciences, Franklin Lakes, New Jersey, USA).

[0189] Figure 2A is a flow cytometry test of CAR and CD46 expression in different tumor cells. In the figure, red shows the unstained cell population, orange is CAR-positive cells, blue is CD46-positive cells, the y-axis shows the number of cells, and the x-axis shows the fluorescence intensity. The cell lines used were stained with anti-human CXADR / CAR antibody (PE) and anti-human CD46 antibody (FITC), and the data were analyzed using FlowJo. Figure 2 As shown in A, all tumor cells have CD46 expression (blue part). Orange represents CAR expression, A549 cell CAR expression 100%, MCF-7 cell CAR expression 21%, SKBr3 cell CAR expression 53%, tnbcMDA-MB-231 and Hs578T CAR expression are both around 77%.

[0190] UCSC Xena (University of California Santa Cruz Xena, https: / / xena.ucsc.edu / , accessed on December 5, 2023) was used to analyze TCGA (the Cancer Genome Atlas) breast cancer samples and GTEx (gene-type_tissue Expression) healthy breast tissue samples based on the gene expression of promoter CAR and CD46, comparing whether these genes were upregulated or downregulated in healthy breast tissue and tumor cells. The significance was tested by Mann-Whitney U test, ***p<0.001, ****p<0.0001. GraphPad Prism8 was used to analyze data and create graphics. Figure 2 B is a statistical chart of CAR expression results in 1247 breast cancer tissues (TCGA) (blue) and 9783 healthy breast tissues (GTEx) (orange) (Xena). Figure 2 C is a statistical chart of CD46 expression results in 1247 breast cancer tissues (TCGA) (blue) and 9783 healthy breast tissues (GTEx) (orange) (Xena).

[0191] Plaque forming ability test

[0192] 1. Test virus

[0193] Human adenovirus type 5 in which the E1Ap promoter is replaced by the hTERTp promoter (Ad5-hTERT), human adenovirus type 34 in which the E1Ap promoter is replaced by the hTERTp promoter (Ad34-hTERT), human adenovirus type 35 in which the E1Ap promoter is replaced by the hTERTp promoter (Ad35-hTERT), human adenovirus type 34 in which the E1Ap promoter is replaced by the hTERTp promoter and the E3gp19K gene is replaced by SEQ ID NO: 2 (Ad34-hTERT-EX1), and human adenovirus type 35 in which the E1Ap promoter is replaced by the hTERTp promoter and the E3gp19K gene is replaced by SEQ ID NO: 2 (Ad35-hTERT-EX1).

[0194] 2. Testing

[0195] To determine the viral proliferation capacity of cancer cell lines after infection with different test viruses, all cancer cell lines were infected with 300 vpc of different test viruses. 72 h after infection, the supernatant was collected and washed with 10 to 10 -10 The supernatants of the dilution series were used to infect new A549 cells. To determine the plaque forming units (pfu / cell) of each supernatant, the cytopathic effect (CPE) was observed and recorded using a modified TCID50 was calculated by the Poisson distribution method, and the plaque forming ability (pfu / cell) was calculated by the Poisson distribution method. For details, please refer to "Lei, C., Yang, J., et al. On the Calculation of TCID50 for Quantitation of Virus Infectivity. Virologica Sinica, 2021, 36, 141-144".

[0196] 3. Results

[0197] like Figure 3 As shown, the plaque-forming ability of Ad34-hTERT, Ad34-hTERT-EX1, Ad35-hTERT or Ad35-hTERT-EX1 was higher than that of Ad5-hTERT. Moreover, the plaque-forming ability of Ad34-hTERT-EX1 was higher than that of Ad34-hTERT, and the plaque-forming ability of Ad35-hTERT-EX1 was higher than that of Ad35-hTERT, all of which were improved to varying degrees.

[0198] Fluorescent labeling to test cancer cell toxicity

[0199] 1. Test virus

[0200] Human adenovirus type 5 in which the E1Ap promoter is replaced by the hTERTp promoter (Ad5-hTERT), human adenovirus type 34 in which the E1Ap promoter is replaced by the hTERTp promoter (Ad34-hTERT), human adenovirus type 35 in which the E1Ap promoter is replaced by the hTERTp promoter (Ad35-hTERT), human adenovirus type 34 in which the E1Ap promoter is replaced by the hTERTp promoter and the E3gp19K gene is replaced by SEQ ID NO: 2 (Ad34-hTERT-EX1), and human adenovirus type 35 in which the E1Ap promoter is replaced by the hTERTp promoter and the E3gp19K gene is replaced by SEQ ID NO: 2 (Ad35-hTERT-EX1).

[0201] 2. Cell killing test

[0202] SKBr3 cells and MCF-7 cells were infected with the test virus at a ratio of 300 VPC. The culture medium was replaced 2 hours after infection. After 24 hours, IncuCyte Cytotox Green Dye fluorescently labeled lysed cell nucleic acids were added to each cell culture well and placed in Sartorius' IncuCyte SX5 system. Fluorescence data were read every 2 hours for 7 consecutive days.

[0203] 3. Results

[0204] Figure 4 The cell lysis curves of the five tested viruses on SKBr3 cells and MCF-7 cells were shown. It can be seen that the toxicity of Ad34-hTERT, Ad34-hTERT-EX1, Ad35-hTERT or Ad35-hTERT-EX1 to cancer cells is higher than that of Ad5-hTERT. The killing activity of Ad34-hTERT-EX1 and Ad35-hTERT-EX1 on SKBr3 cells and MCF-7 cells is improved compared with Ad34-hTERT and Ad35-hTERT.

[0205] Tumor cell lysis activity test

[0206] The present application also conducts a tumor cell lysis activity test on the recombinant virus obtained in the above embodiment, specifically including:

[0207] 1. Test virus

[0208] Human adenovirus type 5 in which the E1Ap promoter is replaced by the hTERTp promoter (Ad5-hTERT), human adenovirus type 34 in which the E1Ap promoter is replaced by the hTERTp promoter (Ad34-hTERT), human adenovirus type 35 in which the E1Ap promoter is replaced by the hTERTp promoter (Ad35-hTERT), human adenovirus type 34 in which the E1Ap promoter is replaced by the hTERTp promoter and the E3gp19K gene is replaced by SEQ ID NO: 2 (Ad34-hTERT-EX1), and human adenovirus type 35 in which the E1Ap promoter is replaced by the hTERTp promoter and the E3gp19K gene is replaced by SEQ ID NO: 2 (Ad35-hTERT-EX1).

[0209] 2. CCK-8 assay

[0210] SKBr3 cells and MCF-7 cells were inoculated in 96-well plates, infected with test viruses at 300 VPC, and replaced with new culture medium containing 2% serum 2 hours after infection for a total of 24 hours. After the 3rd to 5th day, 100 μL of 10% CCK-8 reagent (Abcam, ab228554) was added to the culture medium, incubated at 37°C and 5% CO2 for 2.5 hours, and the absorbance at 450 nm was detected to calculate the cell activity. The cell activity is the percentage of the number of live cells at different detection time points to the number of cells in the initial state (0h).

[0211] Figure 5 Cell activity curves of different tested viruses are shown. Figure 5 As shown, the cancer cell activity on the 5th day after the action of Ad34-hTERT, Ad34-hTERT-EX1, Ad35-hTERT or Ad35-hTERT-EX1 was lower than that of Ad5-hTERT, and the cancer cell activity on the 5th day after the action of Ad34-hTERT-EX1 was lower than that of Ad34-hTERT, and the cancer cell activity on the 5th day after the action of Ad35-hTERT-EX1 was lower than that of Ad35-hTERT. This shows that the cancer cell killing ability of Ad34-hTERT, Ad34-hTERT-EX1, Ad35-hTERT or Ad35-hTERT-EX1 is better than that of Ad5-hTERT, the cancer cell killing ability of Ad34-hTERT-EX1 is better than that of Ad34-hTERT, and the cancer cell killing ability of Ad35-hTERT-EX1 is better than that of Ad35-hTERT.

[0212] Anti-neutralization test

[0213] The present application also tested the anti-neutralizing effect of Ad5-hTERT, Ad34-hTERT and Ad35-hTERT. A549 tumor cells were inoculated in 96-well plates and infected with 300VPC oncolytic virus, and anti-hAd5 serum was added at different dilution ratios (1 / 125, 1 / 250, 1 / 500, 1 / 1000, 1 / 512, 1 / 16000) for 24 hours. Uninfected cells, serum-free and virus-free cells, infected cells and cells without antibody serum were used as controls, and CCK-8 assay was performed as described above 5 days later. Anti-hAd5 serum is of canine origin (HauslMA, ZhangW, MütherN, RauschhuberC, FranckHG, MerricksEP, NicholsTC, KayMA, EhrhardtA. Hyperactivesleepingbeautytransposaseenablespe rsistentphenotypiccorrectioninmiceandacaninemodelforhemophilia

[0214] like Figure 6 As shown in the figure, Ad5-hTERT was completely neutralized by highly diluted anti-Ad5 serum, and A549 cells survived; while Ad34-hTERT and Ad35-hTERT could not be neutralized by different dilutions of anti-Ad5 serum, and A549 cells died. This shows that Ad34-hTERT and Ad35-hTERT cannot be neutralized by anti-Ad5 serum.

[0215] In vivo oncolytic performance test

[0216] 1. Construction of A549 cell transplantation model mice

[0217] Xenografts were performed in 12 nu / nuNMR1 / FoxN1 mice (Charles River Laboratories). Each tumor was injected with 1×10 6 A549 cells were injected into the left and right flanks of each mouse. 12 and 15 days after cell injection, 10 9The mice were injected with 100% Ad5-hTERT, Ad34-hTERT, Ad35-hTERT, Ad34-hTERT-EX1 or Ad35-hTERT-EX1 virus particles, or injected with PBS as a control of the model group. The mice were killed on the 27th day after injection, and the tumor size was measured.

[0218] 2. Luciferase labeling of oncolytic viruses and distribution detection of infected A549 cells

[0219] To determine whether the new oncolytic viruses can reach the tumor site, the firefly luciferase gene (fLuc, Promega) was reversely inserted into the E3gp19K region of Ad5-hTERT and Ad34-hTERT under the control of the SV40 promoter to obtain the viruses Ad5-hTERT-fLuc and Ad34-hTERT-fLuc, respectively.

[0220] like Figure 7 Each mouse was injected with 1×10 6 After A549 cells were injected into the mice, they were divided into a model group (3 mice) and multiple oncolytic groups (4 mice). On days 0 and 2 after observable tumors appeared in the mice, each mouse in each oncolytic group was intravenously injected with 2×10 10 The model group was injected with the same dose of PBS. On the 13th day after infection, the mice were killed, and the kidney, liver, lung, pancreas, spleen and tumor tissues were isolated. The total DNA was isolated using NEB's Monarch genomic DNA isolation and purification kit, and the number of viral genome copies in each cell was examined by RT-qPCR.

[0221] 3. RT-qPCR

[0222] Total DNA was isolated using the Monarch genomic DNA purification kit from NEB, and virus particles infected in each cell were detected using the Takyon NoROX Probe Master Mix from Eurogentec and the CFX96 Real-Time System from Bio-Rad. The primers and probes used are shown in Table 1. Human adenovirus type 5 was detected by detecting the L3 gene, human adenovirus type 34 and human adenovirus type 35 were detected by detecting the PolB gene, hB2M was used as a reference gene for human cells, and mGAPDH was used as a reference gene for mouse cells.

[0223] Table 1

[0224] Primer / probe 5’→3’ hB2M-F GGAATTGATTTGGGAGAGCATC, SEQ ID NO:7 hB2M-R CAGGTCCTGGCTCTACAATTTACTAA, SEQ ID NO:8 hB2M-P HEX-AGTGTGACTGGGCAGATCATCCACCTTC, SEQ ID NO:9 mGAPDH-F CTCTCTGCTCCTCCCTGTTC, SEQ ID NO:10 mGAPDH-R TCACACCGACCTTCACCATT, SEQ ID NO:11 mGAPDH-P HEX-CAGAGACGGCCGCATCTTCTTGTG, SEQ ID NO:12 DNAPolB-F CAGCTGTTGGGGTAGGTATTC, SEQ ID NO:13 DNAPolB-R CTGTCAATATCAAATCCTCCTCGT, SEQ ID NO:14 DNAPolB-F FAM-GGCATGACCTCTGCACTCAGGTTGTCT, SEQ ID NO:15 L3(hAd5)-F ATGCCACATCCGTTGACTTG, SEQ ID NO:16 L3(hAd5)-R GAGTTGGCACCCCTATTCGA, SEQ ID NO:17 L3(hAd5)-P FAM-TGTCCACCAGGTACACACGGGTGG, SEQ ID NO:18

[0225] 4. Results

[0226] like Figure 8Compared with Ad5-hTERT, Ad34-hTERT, and Ad35-hTERT viruses, Ad34-hTERT-EX1 or Ad35-hTERT-EX1 injected subcutaneously into the left and right hind flanks of nu / nuNMR1 / FoxN1 mice, respectively, showed reduced tumor growth in A549 xenografts. Test viruses were injected intratumorally 12 and 15 days after transplantation, and on day 27 after implantation (day 15 after the first injection of test virus), the tumor growth of Ad34-hTERT-EX1 or Ad35-hTERT-EX1 injected was significantly reduced compared with the other test viruses.

[0227] like Fig. 9 As shown in A, in order to test whether the virus can reach the tumor site when injected intravenously, the test case also constructed a luciferase-labeled virus. Fig. 9 As shown in B, the luciferase gene fLuc in these luciferase-tagged viruses is driven by the SV40 promoter instead of the E3gp19K transcription unit. Fig. 9 C, the viral copy number of Ad5-hTERT-fLuc in the tumor was 10 6 , Ad34-hTERT-fLuc is almost 10 9 Therefore, Ad34-hTERT-fLuc virus reaches the tumor after intravenous injection and can replicate more efficiently in the tumor than Ad5-hTERT-fLuc. This shows that the non-type 5 human adenovirus provided by the present application is easier to reach the tumor tissue in the body and replicate efficiently in the tumor tissue, and its anti-tumor effect is better.

[0228] The above is only a preferred specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed in the present application should be covered within the protection scope of the present application.

Claims

1. An isolated infectious polynucleotide carrying at least one recombinant adenovirus genome, wherein the recombinant adenovirus genome is formed by replacing at least one of the following: the promoter of the E1A gene in a wild genome of a non-type 5 human adenovirus, the replacement of the E3gp19K gene, and the replacement of the promoter of the E1B gene and a partial sequence thereof.

2. The infectious polynucleotide of claim 1, wherein the non-type 5 human adenovirus is selected from the group consisting of human adenovirus type 4, human adenovirus type 7, human adenovirus type 11, human adenovirus type 14, human adenovirus type 17, human adenovirus type 21, human adenovirus type 34, human adenovirus type 35, human adenovirus type 37, and human adenovirus type 50.

3. The infectious polynucleotide according to claim 1, wherein the recombinant adenovirus genome is selected from at least one of the following: The 469-575 nt region of GenBank:AY487947.1 was replaced with the genome sequence shown in SEQ ID NO:1; The 480-575 nt region of GenBank: KC857700.1 was replaced with the genome sequence shown in SEQ ID NO: 1; The 471-567 nt region of GenBank: AF532578.1 was replaced with the genome sequence shown in SEQ ID NO: 1; The 494-586 nt region of GenBank:AY803294.1 was replaced with the genome sequence shown in SEQ ID NO:1; The 446-559 nt region of GenBank: HQ910407.1 was replaced with the genome sequence shown in SEQ ID NO: 1; The 458-571 nt region of GenBank: KF528688.1 was replaced with the genome sequence shown in SEQ ID NO: 1; The 477-568 nt region of GenBank:AY737797.1 was replaced with the genome sequence shown in SEQ ID NO:1; The 477-568 nt region of GenBank:AY271307.1 was replaced with the genome sequence shown in SEQ ID NO:1; The 480-569 nt region of GenBank: AB448778.1 was replaced with the genome sequence shown in SEQ ID NO: 1; The 477-572 nt region of GenBank:AY737798.1 was replaced with the genome sequence shown in SEQ ID NO:1; A genome in which the 469-575 nt region of GenBank:AY487947.1 is replaced with the sequence shown in SEQ ID NO:1, and the 27,893 ... 28,417 nt region is replaced with the sequence shown in SEQ ID NO:2; A genome in which the 480-575 nt region of GenBank: KC857700.1 is replaced with the sequence shown in SEQ ID NO: 1, and the 28,054 ... 28,572 nt region is replaced with the sequence shown in SEQ ID NO: 2; A genome in which the 471-567 nt region of GenBank: AF532578.1 is replaced with the sequence shown in SEQ ID NO: 1, and the 27,836 ... 28,336 nt region is replaced with the sequence shown in SEQ ID NO: 2; A genome in which the 494-586 nt region of GenBank:AY803294.1 is replaced with the sequence shown in SEQ ID NO:1, and the 27,823 ... 28,323 nt region is replaced with the sequence shown in SEQ ID NO:2; A genome in which the 446-559 nt region of GenBank: HQ910407.1 is replaced with the sequence shown in SEQ ID NO: 1, and the 27,052 ... 27,525 nt region is replaced with the sequence shown in SEQ ID NO: 2; A genome in which the 458-571 nt region of GenBank: KF528688.1 is replaced with the sequence shown in SEQ ID NO: 1, and the 28,151 ... 28,669 nt region is replaced with the sequence shown in SEQ ID NO: 2; A genome in which the 477-568 nt region of GenBank:AY737797.1 is replaced with the sequence shown in SEQ ID NO:1, and the 27,836 ... 28,336 nt region is replaced with the sequence shown in SEQ ID NO:2; A genome in which the 477-568 nt region of GenBank:AY271307.1 is replaced with the sequence shown in SEQ ID NO:1, and the 27,850 ... 28,350 nt region is replaced with the sequence shown in SEQ ID NO:2; A genome in which the 480-569 nt region of GenBank: AB448778.1 is replaced with the sequence shown in SEQ ID NO: 1, and the 27,030 ... 27,530 nt region is replaced with the sequence shown in SEQ ID NO: 2; A genome in which the 477-572 nt region of GenBank:AY737798.1 is replaced with the sequence shown in SEQ ID NO:1, and the 28,119 ... 28,637 nt region is replaced with the sequence shown in SEQ ID NO:2; A genome in which the 469-575 nt region of GenBank:AY487947.1 is replaced with the sequence shown in SEQ ID NO:1, and the 1439..1907 nt region is replaced with the sequence shown in SEQ ID NO:3; A genome in which the 480-575 nt region of GenBank: KC857700.1 is replaced with the sequence shown in SEQ ID NO: 1, and the 1453..1910 nt region is replaced with the sequence shown in SEQ ID NO: 3; A genome in which the 471-567 nt region of GenBank: AF532578.1 is replaced with the sequence shown in SEQ ID NO: 1, and the 1334..1917 nt region is replaced with the sequence shown in SEQ ID NO: 3; A genome in which the 494-586 nt region of GenBank:AY803294.1 is replaced with the sequence shown in SEQ ID NO:1, and the 1454..1933 nt region is replaced with the sequence shown in SEQ ID NO:3; A genome in which the 446-559 nt region of GenBank: HQ910407.1 is replaced with the sequence shown in SEQ ID NO: 1, and the 1413..1876 nt region is replaced with the sequence shown in SEQ ID NO: 3; A genome in which the 458-571 nt region of GenBank: KF528688.1 is replaced with the sequence shown in SEQ ID NO: 1, and the 1448..1905 nt region is replaced with the sequence shown in SEQ ID NO: 3; A genome in which the 477-568 nt region of GenBank:AY737797.1 is replaced with the sequence shown in SEQ ID NO:1, and the 1335..1918 nt region is replaced with the sequence shown in SEQ ID NO:3; A genome in which the 477-568 nt region of GenBank:AY271307.1 is replaced with the sequence shown in SEQ ID NO:1, and the 1335..1918 nt region is replaced with the sequence shown in SEQ ID NO:3; A genome in which the 480-569 nt region of GenBank: AB448778.1 is replaced with the sequence shown in SEQ ID NO: 1, and the 1424..1885 nt region is replaced with the sequence shown in SEQ ID NO: 3; A genome in which the 477-572 nt region of GenBank:AY737798.1 is replaced with the sequence shown in SEQ ID NO:1, and the 1449..1906 nt region is replaced with the sequence shown in SEQ ID NO:3; A genome in which the 469-575 nt region of GenBank:AY487947.1 is replaced with the sequence shown in SEQ ID NO:1, the 27,893 ... 28,417 nt region is replaced with the sequence shown in SEQ ID NO:2, and the 1439 ... 1907 nt region is replaced with the sequence shown in SEQ ID NO:3; A genome in which the 480-575 nt region of GenBank: KC857700.1 is replaced with the sequence shown in SEQ ID NO: 1, the 28,054 ... 28,572 nt region is replaced with the sequence shown in SEQ ID NO: 2, and the 1453 ... 1910 nt region is replaced with the sequence shown in SEQ ID NO: 3; A genome in which the 471-567 nt region of GenBank: AF532578.1 is replaced with the sequence shown in SEQ ID NO: 1, the 27,836 ... 28,336 nt region is replaced with the sequence shown in SEQ ID NO: 2, and the 1334 ... 1917 nt region is replaced with the sequence shown in SEQ ID NO: 3; A genome in which the 494-586 nt region of GenBank:AY803294.1 is replaced with the sequence shown in SEQ ID NO:1, the 27,823 ... 28,323 nt region is replaced with the sequence shown in SEQ ID NO:2, and the 1454 ... 1933 nt region is replaced with the sequence shown in SEQ ID NO:3; A genome in which the 446-559 nt region of GenBank: HQ910407.1 is replaced with the sequence shown in SEQ ID NO: 1, the 27,052 ... 27,525 nt region is replaced with the sequence shown in SEQ ID NO: 2, and the 1413 ... 1876 nt region is replaced with the sequence shown in SEQ ID NO: 3; A genome in which the 458-571 nt region of GenBank: KF528688.1 is replaced with the sequence shown in SEQ ID NO: 1, the 28,151 ... 28,669 nt region is replaced with the sequence shown in SEQ ID NO: 2, and the 1448 ... 1905 nt region is replaced with the sequence shown in SEQ ID NO: 3; A genome in which the 477-568 nt region of GenBank:AY737797.1 is replaced with the sequence shown in SEQ ID NO:1, the 27,836 ... 28,336 nt region is replaced with the sequence shown in SEQ ID NO:2, and the 1335 ... 1918 nt region is replaced with the sequence shown in SEQ ID NO:3; A genome in which the 477-568 nt region of GenBank:AY271307.1 is replaced with the sequence shown in SEQ ID NO:1, the 27,850 ... 28,350 nt region is replaced with the sequence shown in SEQ ID NO:2, and the 1335 ... 1918 nt region is replaced with the sequence shown in SEQ ID NO:3; A genome in which the 480-569 nt region of GenBank:AB448778.1 is replaced with the sequence shown in SEQ ID NO:1, the 27,030 ... 27,530 nt region is replaced with the sequence shown in SEQ ID NO:2, and the 1424 ... 1885 nt region is replaced with the sequence shown in SEQ ID NO:3; A genome in which the 477-572 nt region of GenBank:AY737798.1 is replaced with the sequence shown in SEQ ID NO:1, the 28,119 ... 28,637 nt region is replaced with the sequence shown in SEQ ID NO:2, and the 1449..1906 nt region is replaced with the sequence shown in SEQ ID NO:

3.

4. A viral vector, which carries at least one recombinant adenovirus genome, wherein the recombinant adenovirus genome is formed by replacing at least one of the following: the promoter of the E1A gene in a wild genome of a non-type 5 human adenovirus, the E3gp19K gene, and the promoter of the E1B gene and a partial sequence thereof.

5. A viral vector, which carries at least one recombinant adenovirus genome, wherein the recombinant adenovirus genome is formed by replacing the promoter of the E1A gene in a wild genome of a non-type 5 human adenovirus.

6. A viral vector carrying at least one recombinant adenovirus genome, wherein the recombinant adenovirus genome is formed by replacing the E1 gene promoter and the E3gp19K gene of a wild-type genome of a non-type 5 human adenovirus.

7. A viral vector carrying at least one recombinant adenovirus genome, wherein the recombinant adenovirus genome is formed by replacing the E1 gene promoter of a wild genome of a non-type 5 human adenovirus, and replacing the promoter of the E1B gene and a partial sequence thereof.

8. A viral vector, which carries at least one recombinant adenovirus genome, wherein the recombinant adenovirus genome is formed by replacing the E1A gene promoter of a wild-type genome of a non-type 5 human adenovirus, replacing the E3gp19K gene, and replacing the promoter of the E1B gene and a partial sequence thereof.

9. The viral vector according to any one of claims 4 to 8, comprising a basic vector and the recombinant adenoviral genome inserted into the basic vector.

10. The viral vector of claim 9, wherein the base vector is selected from pBR322, pUC18, pUC19, pBluescript, pcDNA3.1, p15A or pR6K-SM.

11. A recombinant adenovirus, wherein the recombinant adenovirus is obtained by packaging cells transfected with the viral vector according to any one of claims 4 to 10.

12. An oncolytic virus, wherein the oncolytic virus is obtained by packaging cells transfected with the viral vector according to any one of claims 4 to 10.

13. The virus according to any one of claims 11 to 12, wherein the cell is selected from the group consisting of nasopharyngeal carcinoma cells, synovial carcinoma cells, hepatoma cells, renal carcinoma cells, cancer cells of connective tissue, melanoma cells, lung cancer cells, intestinal cancer cells, colon cancer cells, rectal cancer cells, colorectal cancer cells, brain cancer cells, laryngeal cancer cells, oral cancer cells, liver cancer cells, bone cancer cells, pancreatic cancer cells, choriocarcinoma cells, gastrinoma cells, pheochromoma cells, prolactinoma cells, T-cell leukemia / lymphoma cells, neuroma cells, adrenal cancer cells, anal cancer cells, bile duct cancer cells, bladder cancer cells, ureteral cancer cells, oligodendroglioma cells, neuroblastoma cells, meningioma cells, spinal cord tumor cells, osteochondroma cells, chondrosarcoma cells, Ewing's sarcoma cells, cancer cells of unknown primary site, carcinoid cells, gastrointestinal carcinoma cells, fibrosarcoma cells, breast cancer cells, cervical cancer cells, esophageal cancer cells, gallbladder cancer cells, head cancer cells of the eye, neck, kidney, Wilms' tumor, Kaposi's sarcoma, prostate, testis, Hodgkin's disease, non-Hodgkin's lymphoma, skin, mesothelioma, multiple myeloma, ovarian, endocrine pancreatic, glucagonoma, pancreatic, parathyroid, penis, pituitary, soft tissue sarcoma, retinoblastoma, small intestine, stomach, thymus, thyroid, trophoblast, uterine, endometrial, vaginal, vulvar, acoustic neuroma, insulinoma, somatostatinoma, heart, lip, meningeal, oral, neural, palate, parotid, peritoneal, pharyngeal, pleural, salivary, tongue, or tonsil.

14. The virus according to any one of claims 11 to 12, wherein the cell is selected from HEK293 cells, Ad293 cells, Ad293-E3 cells, A549 cells, SKBr3 cells, MCF-7 cells, MDA-MB-231 cells or Hs578T cells.

15. A composition comprising the combination of infectious polynucleotides according to any one of claims 1 to 3.

16. A composition comprising the combination of viral vectors according to any one of claims 4 to 10.

17. A composition comprising a combination of viruses as claimed in any one of claims 11 to 14.

18. Use of the infectious polynucleotide according to any one of claims 1 to 3, the viral vector according to any one of claims 4 to 10, or the virus according to any one of claims 11 to 14 in the preparation of an anti-tumor drug.

Images