Biomarker related to pancreatitis and application thereof

Abstract

The invention belongs to the technical field of biomedicine, and discloses a biomarker related to pancreatitis and application thereof. The substance for detecting the ANG expression level is applied to preparation of at least one of the following products: A1) a product for diagnosing and detecting pancreatitis; a2) a product for predicting pancreatitis prognosis. According to the biomarker related to pancreatitis, diagnosis and prediction of pancreatitis can be accurately achieved by detecting ANG, more accurate and more reliable diagnosis basis can be provided for clinic, doctors can be helped to formulate more accurate treatment schemes, and the diagnosis accuracy and treatment effect of pancreatitis are improved.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and in particular relates to biomarkers associated with pancreatitis and applications thereof. Background Art

[0002] Pancreatitis is a common digestive system disease worldwide. It refers to the abnormal activation of multiple digestive enzymes synthesized by acinar cells under special circumstances, which in turn causes an inflammatory reaction to the pancreas itself. Excessive drinking, gallstones and smoking are high-risk factors for the disease. In my country, with the development of social economy, people's living and eating habits have quietly changed, and the incidence of pancreatitis has also been rising. It has become one of the diseases that seriously endangers people's health and quality of life.

[0003] The pancreatic islets are important endocrine tissues in the pancreas and play an important role in the body's blood sugar regulation. It is now clear that pancreatitis can also cause damage to the pancreatic islets. The risk of diabetes in patients with pancreatitis is more than twice that of the general population, and this type of post-pancreatitis diabetes mellitus (PPDM) has become the second largest type of diabetes in adults. However, there is currently limited knowledge about post-pancreatitis diabetes mellitus and PPDM has many similar features to type 2 diabetes. There is currently a lack of specialized and recognized methods for the prevention, diagnosis and treatment of PPDM in clinical practice, and the correct diagnosis rate of PPDM is less than 50%.

[0004] Due to the lack of evidence related to the diagnosis and progression prediction of pancreatitis, the clinical means of distinguishing pancreatitis patients are very limited. Therefore, there is an urgent need to provide biomarkers that can accurately diagnose or predict pancreatitis patients to help improve the prevention efficiency and diagnostic accuracy of pancreatitis.

[0005] Angiogenin (ANG; also known as ribonuclease 5, RNASE5) is a secreted alkaline ribonuclease belonging to the ribonuclease A family. It exists in a variety of tissue microenvironments and can regulate cell behaviors such as cell growth, proliferation, migration and survival through intracellular and extracellular pathways. It participates in physiological and pathological processes such as angiogenesis, self-renewal and differentiation of hematopoietic stem cells, and tumor development. Current studies have reported that the level of angiogenin in the serum of patients with colorectal cancer is significantly increased, and it is a potential serum marker for risk stratification of colon cancer. For example, CN114720699 A considers ANG as an early warning serum detection marker for colorectal cancer.

[0006] However, there are no reports on the association between ANG and pancreatitis. Summary of the invention

[0007] In order to solve the above problems, the present invention obtains serum samples of pancreatitis patients from hospitals and serum of pancreatitis mice, and detects and analyzes the protein expression information related to pancreatitis in the blood, and finds that ANG can be used as a marker for predicting the progression of pancreatitis. In addition, the present invention uses a pancreatitis mouse animal model to detect and analyze the expression level of ANG at different stages of pancreatitis, and finds that ANG is significantly correlated with the development and progression of pancreatitis. Based on the above research results, the present invention is completed.

[0008] A first aspect of the present invention protects the use of a substance for detecting ANG expression level in the preparation of at least one of the following products:

[0009] A1) Products for the diagnosis or detection of pancreatitis;

[0010] A2) Products for predicting the prognosis of pancreatitis.

[0011] In certain embodiments, the product is selected from one or more of a kit, a chip, a probe, and a membrane strip.

[0012] In certain embodiments, the substance for detecting ANG expression level in the product is the only active ingredient or one of the active ingredients of the product.

[0013] In certain embodiments, the substance for detecting the expression level of ANG comprises a reagent for detecting the expression level of ANG gene or a reagent for detecting the expression level of ANG protein.

[0014] In certain specific embodiments, the substance for detecting the expression level of ANG is selected from one or more of a specific probe, a primer and a specific antibody.

[0015] In certain more specific embodiments, the substance for detecting the expression level of ANG comprises the primers shown in SEQ ID NO: 1-2.

[0016] In certain embodiments, the product is used to detect ANG gene expression level and / or protein expression level in a sample.

[0017] In certain specific embodiments, the sample is selected from one or more of blood, plasma, serum, pancreatic islets and pancreatic tissue.

[0018] In certain embodiments, use of ANG in the preparation of a product for monitoring the progression of pancreatitis is also included.

[0019] The second aspect of the present invention protects a product for diagnosing or detecting pancreatitis, the product comprising a substance for detecting the expression level of ANG.

[0020] In certain embodiments, the product is selected from one or more of a kit, a chip, a probe, and a membrane strip.

[0021] In certain embodiments, the substance for detecting the expression level of ANG is selected from one or more of a specific probe, a primer and a specific antibody.

[0022] In certain specific embodiments, the substance for detecting the expression level of ANG includes the primers shown in SEQ ID NO: 1-2.

[0023] The third aspect of the present invention protects the use of ANG as a target in the preparation or screening of therapeutic drugs for pancreatitis or pancreatic islet injury.

[0024] The present invention detected blood samples from patients with pancreatitis and found that the content of ANG in the blood was significantly higher than the ANG level in the blood of normal people; further, the present invention verified again in an animal model of pancreatitis that an increased level of ANG in the blood was significantly correlated with pancreatitis, which comprehensively showed that ANG is an excellent pancreatitis marker with high sensitivity and specificity, and is suitable for preparing pancreatitis diagnostic products, detection products or monitoring products.

[0025] The beneficial effects of the present invention are:

[0026] 1) The present invention found that the ANG level in the blood of pancreatitis patients was significantly increased in both pancreatitis patients and pancreatitis mice; and further found that the ANG level in the blood was significantly correlated with the duration of pancreatitis. At the same time, the ROC analysis results suggest that ANG has a good diagnostic value for pancreatitis. When 500 ng / mL is taken as the diagnostic threshold (Cut-off value), the sensitivity and specificity of diagnosing pancreatitis are 78.95%, 78.95%, and the AUC can be as high as 0.8415. Therefore, the present invention uses ANG as a marker to prepare a diagnostic or detection tool for pancreatitis. The detection tool is used to detect the level of ANG in the sample, which can independently or auxiliaryly determine whether pancreatitis is present, monitor the process of individual disease development, clinical prognosis evaluation, etc., and provide an effective and reliable means for the diagnosis and early prevention of pancreatitis, which is not only conducive to the diagnosis and typing of pancreatitis, but also improves the understanding and understanding of the clinical pathology of pancreatitis, and provides a new idea for the treatment and prevention of pancreatitis in the future.

[0027] 2) The present invention uses ANG as a marker to prepare a pancreatitis prognosis assessment detection tool, which can effectively assess the patient's response to treatment and the risk of future disease.

[0028] 3) The present invention uses ANG as a marker to prepare an evaluation and detection tool for the progression or possible future progression of pancreatitis, thereby achieving precise treatment of the disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is a graph showing the analysis results of ANG expression levels in the serum of 95 pancreatitis patients and 66 healthy controls in Example 1 of the present invention.

[0030] Figure 2 This is a diagram showing the analysis results of the detection of ANG expression levels in the blood of pancreatitis mice and control mice in Example 1 of the present invention.

[0031] Figure 3 This is a diagram showing the staining and immunohistochemical staining of pancreatic tissue sections and the statistical analysis results in Example 2 of the present invention.

[0032] Figure 4 This is a graph showing the results of the detection and analysis of ANG expression levels in the blood of pancreatitis mice at different disease progression stages in Example 2 of the present invention.

[0033] Figure 5 This is a diagram showing the analysis results of ANG mRNA levels in the pancreatic islets of pancreatitis mice and control mice in Example 3 of the present invention.

[0034] Figure 6 This is a diagram showing the analysis results of the expression level of ANG in the pancreatic islets of pancreatitis mice and control mice in Example 3 of the present invention.

[0035] Figure 7 This is a graph showing the results of analyzing the changes in ANG levels in islets treated with inflammatory factors and control islets in Example 3 of the present invention.

[0036] Figure 8 The ROC analysis results of ANG levels in the blood of 95 healthy subjects and 66 pancreatitis patients in Example 4 of the present invention are shown in the figure. DETAILED DESCRIPTION

[0037] This application compares the ANG levels in the blood of pancreatitis patients and healthy people, the ANG levels in the blood of pancreatitis mice and healthy mice, and the ANG levels in the pancreatic islets of pancreatitis mice and healthy mice, and comprehensively finds that the ANG gene and protein expression levels in the blood or pancreatic islets of pancreatitis mice and pancreatitis patients are statistically significant; in addition, this application finds that the ANG level in the blood is significantly correlated with the duration of pancreatitis through pancreatitis mice, and it increases significantly with the extension of modeling time, and the changes in ANG levels in the blood at different stages are statistically different; therefore, ANG can provide more accurate and reliable information for the diagnosis, prediction and staging of pancreatitis. Further experimental verification shows that when ANG is used as a biomarker for diagnosing pancreatitis, it has a high sensitivity of 78.95%, a high specificity of 78.95%, and a ROC curve of 0.8, indicating that ANG as a biomarker for pancreatitis can show good predictive performance and accuracy. This application diagnoses pancreatitis and predicts clinical stages by detecting ANG biomarkers, providing more targeted guidance and reference for the prevention strategies and treatment plans for pancreatitis, thereby reducing the mortality rate of pancreatitis and making positive contributions to improving patients' quality of life, reducing medical costs and reducing the impact of pancreatitis.

[0038] A first aspect of the present invention protects the use of a substance for detecting ANG expression level in the preparation of at least one of the following products:

[0039] A1) Products used to diagnose, detect or monitor pancreatitis;

[0040] A2) Products for predicting the prognosis of pancreatitis.

[0041] In this application, the gene number of ANG in the Ensemble database is ENSG00000214274283.

[0042] In certain embodiments, the product is selected from one or more of a kit, a chip, a probe, and a membrane strip.

[0043] In certain embodiments, the substance for detecting ANG expression level in the product is the only active ingredient or one of the active ingredients of the product.

[0044] In certain embodiments, the substance for detecting the expression level of ANG comprises a reagent for detecting the expression level of ANG gene or a reagent for detecting the expression level of ANG protein.

[0045] In certain specific embodiments, the substance for detecting the expression level of ANG is selected from one or more of a specific probe, a primer and a specific antibody.

[0046] In certain more specific embodiments, the substance for detecting the expression level of ANG comprises the primers shown in SEQ ID NO: 1-2.

[0047] In certain embodiments, ANG is also used in the preparation of a product for monitoring the progression of pancreatitis. The present application found through pancreatitis model mice that the serum ANG level increased further with the extension of modeling time before and 1 week, 2 weeks, 3 weeks and 4 weeks after pancreatitis induction, and the fitting results showed that the blood ANG level was significantly correlated with the duration of pancreatitis (Y=5.753*X+269.7, R 2 =0.56).

[0048] In certain embodiments, the product is used to detect ANG gene expression level and / or protein expression level in a sample.

[0049] In certain specific embodiments, the sample is selected from one or more of blood, plasma, serum, pancreatic islets and pancreatic tissue.

[0050] Further, the biological sample contains cells and / or other molecular entities (e.g., DNA) to be characterized or identified based on physical, biochemical, chemical, and / or physiological characteristics, specifically, including but not limited to individual cells, tissues, organs, and / or biological fluids obtained by any method known to those skilled in the art. In some embodiments, the biological sample is selected from the group consisting of histological sections, tissue biopsies, paraffin-embedded tissues, body fluids, surgical resection samples, isolated blood cells, cells separated from blood, and any combination thereof, such as body fluids selected from the group consisting of whole blood, serum, plasma, and any combination thereof. In some embodiments, the biological sample is whole blood, more specifically plasma. Those skilled in the art know various methods for preparing plasma from whole blood. For example, plasma is obtained by centrifuging whole blood from an individual once, twice, three times, four times, five times, or more. In certain specific embodiments, DNA is isolated and purified from a biological sample, and the DNA comprises genomic DNA, cellular DNA, and extracellular free DNA (cfDNA).

[0051] The second aspect of the present invention protects a product for predicting, diagnosing or detecting pancreatitis, the product comprising a substance for detecting the expression level of ANG.

[0052] In certain embodiments, the product is selected from one or more of a kit, a chip, a probe, and a membrane strip. The product comprises a substance for detecting the expression level of ANG.

[0053] In certain specific embodiments, the kit may contain one or more of a specific probe, a primer, and a specific antibody.

[0054] Preferably, the primers include a primer pair capable of specifically amplifying ANG. More preferably, the primers may further include primers for detecting an internal reference such as ACTB. Preferably, the primers are packaged in a single container or in separate containers. The substance for detecting the expression level of ANG includes the primers shown in SEQ ID NO: 1-2.

[0055] Preferably, the kit or composition further comprises a labeled reagent. Preferably, the reagent is selected from the group consisting of a fluorescent probe, an intercalating dye, a chromophore-labeled probe, a radioisotope-labeled probe, and a biotin-labeled probe.

[0056] Preferably, the kit may further comprise a DNA polymerase and / or a container suitable for storing a biological sample obtained from an individual. In some embodiments, the kit further comprises instructions for use and / or an explanation of the test results of the kit.

[0057] Preferably, the kit or composition may further include a PCR reaction reagent. Preferably, the PCR reaction reagent includes Taq DNA polymerase, PCR buffer, dNTPs, Mg 2+ .

[0058] Preferably, the kit or composition may comprise additional reagents selected from the group consisting of buffers (eg, restriction enzyme, PCR, storage or washing buffers), DNA recovery reagents or kits (eg, precipitation, ultrafiltration, affinity columns), and DNA recovery components.

[0059] Furthermore, the conditions for the PCR amplification are: pre-denaturation at 92°C to 98°C for 15 to 30s; denaturation at 92°C to 98°C for 5s to 20s, and annealing at 60°C to 70°C for 20s to 40s.

[0060] Furthermore, it also includes reagents for RNA extraction and reverse transcription.

[0061] The third aspect of the present invention protects the use of ANG as a target in the preparation or screening of drugs for the treatment of pancreatitis.

[0062] Furthermore, the candidate drug uses ANG as a drug target to screen drugs or drug preparations to find drugs that can inhibit ANG as candidate drugs for preventing or treating pancreatitis.

[0063] The following is a description of the implementation of the present invention by means of specific embodiments. Those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification.

[0064] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are intended to describe specific embodiments, rather than to limit the scope of protection of the present invention. The test methods in the following examples without specifying specific conditions are generally carried out under conventional conditions or under conditions recommended by the manufacturers.

[0065] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0066] The present invention is further described below in conjunction with specific embodiments.

[0067] Example 1 Study on the changes in ANG levels in pancreatitis patients and pancreatitis mice

[0068] In this Example 1, the changes in ANG in the blood of pancreatitis patients and the serum of pancreatitis mice were studied, including the following steps:

[0069] 1.1 Methods

[0070] First, blood samples were obtained from healthy subjects and patients with pancreatitis, including 95 healthy subjects and 66 patients with pancreatitis. Then, the level of ANG in plasma was detected by enzyme-linked immunosorbent assay. The specific steps are as follows:

[0071] 1.1.1. ANG detection in human serum samples

[0072] (1) Antibody coating: Dilute mouse ANG monoclonal antibody (Thermo Scientific, Catalog No. 14-9762-82) to 5 μg / mL with coating buffer, add 100 μL of the diluted monoclonal antibody solution to each well of a 96-well plate, and coat overnight at room temperature.

[0073] (2) Blocking: Discard the coating buffer in the wells, wash the plate 3 times with PBST buffer, and then wash it 2 times with PBS; prepare 0.5% BSA solution with PBS as blocking solution, add 300 μL to each well, and incubate at room temperature for 1 hour. PBST buffer is PBS buffer with 0.1 v / v% Tween-20 added.

[0074] (3) Preparation of standard samples and test samples: 1 mg / mL of ANG protein storage solution was serially diluted with 0.01% BSA buffer as the standard (1000 pg / mL, 750 pg / mL, 500 pg / mL, 333 pg / mL, 250 pg / mL, 125 pg / mL, 63 pg / mL), and BSA buffer was used as the blank control; in addition, human plasma samples were diluted 1000 times with 0.01% BSA buffer.

[0075] (4) Sample incubation: Discard the blocking solution in step (2), wash the plate three times with PBST buffer, and then wash twice with PBS; add ANG protein standards of different concentration gradients and diluted plasma samples to the 96-well plate, seal with sealing film, and incubate at room temperature overnight.

[0076] (5) Incubation with secondary and tertiary antibodies: Discard the samples in the wells of step (4), wash with PBST buffer 4 times, and then wash with PBS 3 times; dilute the rabbit-derived ANG polyclonal antibody to a final concentration of 1 μg / mL with blocking solution, add 100 μL of the diluted antibody to each well, and incubate at room temperature for 2 h; then remove the antibody solution in the wells, wash with PBST buffer 4 times, and then wash with PBS 3 times; then add 100 μL of goat anti-rabbit IgG / Alkaline Phosphatase Conjugated antibody (1:5000), also known as tertiary antibody, to each well and incubate at room temperature for 1 h.

[0077] (6) Color development and detection: remove the antibody solution in each well in step (5), wash 4 times with PBST buffer, and then wash 3 times with PBS; add 1 PNPP color substrate (Thermo Scientific, #34045) to 10 mL substrate dissolution buffer (Thermo Scientific, #34064), shake until completely dissolved, and obtain a color substrate solution; add 100 μL of the color substrate solution to each well, and color develop at room temperature in the dark for 1.5 h; use an ELISA reader to detect the absorbance value at 405 nm; draw a standard curve based on the standard sample, and calculate the concentration of ANG in the serum sample based on it.

[0078] The differences in blood ANG levels between healthy subjects and patients with pancreatitis were analyzed and compared. The Student's test was used for statistical difference test, ****P<0.001, and the data were expressed as mean ± standard error.

[0079] 1.1.2. ANG detection in mouse serum samples

[0080] At the same time, blood samples were obtained from 6 healthy mice and their corresponding 6 pancreatitis mice (pancreatitis mice were induced by intraperitoneal injection of caerulein; literature reference: https: / / www.gastrojournal.org / article / S0016-5085(13)00198-4 / fulltext). Then, the level of ANG in plasma was detected using the mouse Angiogenin ELISA kit (Cat. No. ab208349) from Abcam.

[0081] The differences in ANG levels in the blood of healthy mice and mice with pancreatitis were analyzed and compared. Student's test was used for statistical difference test, ****P<0.0001, and the data were expressed as mean ± standard error.

[0082] 1.2 Results

[0083] 1.2.1. ANG detection results in human serum samples

[0084] The levels of ANG in 96 healthy subjects and 66 pancreatitis patients were analyzed. Figure 1 .

[0085] from Figure 1 It can be seen that compared with healthy people, the level of ANG in the blood of pancreatitis patients is increased, and ****P<0.0001, indicating that there is a significant difference in the level of ANG in the blood of pancreatitis patients and healthy people.

[0086] 1.2.2. ANG detection results in mouse serum samples

[0087] The levels of ANG in the blood samples of 6 healthy mice and their corresponding 6 pancreatitis mice were analyzed for differences. The results are shown in Figure 2 .

[0088] from Figure 2 It can be seen that compared with healthy mice, the level of ANG in the blood of mice with pancreatitis was increased, and ****P<0.0001, indicating that there was a significant difference in the level of ANG in the blood of mice with pancreatitis and healthy mice.

[0089] The above results indicate that ANG can be used as a marker for pancreatitis, and its detection material can be used to prepare diagnostic, detection or monitoring products for pancreatitis.

[0090] Example 2 Study on the correlation between ANG levels and pancreatitis progression

[0091] In this Example 2, the study on the correlation between the ANG level in the blood and the progression stage of pancreatitis includes the following steps:

[0092] 2.1 Methods

[0093] First, blood from healthy mice (n=6) was obtained as test samples at week 0. Then, pancreatitis modeling was performed on these mice, and the modeling steps were as follows:

[0094] 2.1.1. Pancreatitis induction and detection

[0095] (1) Pancreatitis induction: Wild-type (WT) mice and Ang knockout mice (Ang knockout mice) were randomly divided into - / - ) (gifted by Professor Hu Guofu of Tufts University, USA) After starvation overnight, 50 μg / kg of caerulein was injected intraperitoneally, one injection per hour for 6 consecutive injections; the mice were induced with caerulein once every two days for 30 days.

[0096] (2) Detection of inflammatory cells in the pancreas: After induction, the mice were dissected to obtain the mouse pancreas for paraffin embedding and sectioning; then, immunohistochemical staining and H&E staining were used to detect immune cells in the pancreatic tissue.

[0097] The specific steps of immunohistochemical staining experiment are as follows:

[0098] 1) Dewaxing and hydration of sections: incubate the paraffin sections in a 60°C oven for 30 min, then immerse the sections in xylene (10 min×2 times), 100% ethanol (5 min×2 times), 90% ethanol (3 min), 80% ethanol (3 min), 70% ethanol (3 min), deionized water (3 min), and PBS (5 min×3 times) in a fume hood.

[0099] 2) Endogenous peroxidase blocking: 100 μL of freshly prepared 3% hydrogen peroxide solution was added to each section, incubated at room temperature for 10-20 min, and then rinsed with PBS three times, 5 min each time.

[0100] 3) Antigen repair: Heat freshly prepared sodium citrate solution (10 mM, pH 6.0) in a microwave oven until boiling, immerse the hydrated sections in the boiling sodium citrate solution, reduce the power and continue to boil for 10 to 20 minutes. After completion, let it cool at room temperature and wash with PBS three times, 5 minutes each time.

[0101] 4) Blocking: Add 50-100 μL of sheep serum to each section and incubate at room temperature for 1 hour.

[0102] 5) Primary antibody incubation: According to the antibody instructions, dilute the antibody with PBS at a certain ratio (CD45, 1:100; F4 / 80, 1:100), add 50 μL to each section, and incubate in a humidified box at 4°C overnight.

[0103] 6) Rinse: Wash 3 times with PBS, 5 min each time.

[0104] 7) Secondary antibody incubation: Add 50 μL of ultra-sensitive enzyme-labeled goat anti-mouse / rabbit IgG antibody working solution to each section and incubate at room temperature for 1 hour.

[0105] 8) Rinse: Wash 3 times with PBS, 5 min each time.

[0106] 9) Color development: Add 100 μL of freshly prepared DAB color developing solution to each slice and develop color at room temperature. During the development, the slices must be constantly observed under a microscope. The brown-yellow colored part is positive staining. At this time, the slices can be rinsed with distilled water to terminate the color development reaction.

[0107] 10) Re-staining: Add hematoxylin staining solution and incubate for about 20 seconds, rinse with tap water to return to blue, and the cell nucleus can be seen to be stained blue under a microscope.

[0108] 11) Dehydration, transparentization and sealing: The sections after color development and counterstaining were immersed in 70% ethanol (3 min), 80% ethanol (3 min), 90% ethanol (3 min), anhydrous ethanol (3 min × 2 times), and xylene (5 min × 2 times) for dehydration and transparentization. Each section was sealed with 20 μL of neutral resin.

[0109] 12) Observation: Observe and take photos using a Leica upright optical microscope, or scan and record using an Olympus VS200 tissue section scanner in bright field mode.

[0110] The steps of H&E staining are as follows:

[0111] 1) Slide baking: Same as immunohistochemical staining, no further details will be given.

[0112] 2) Dewaxing: Same as immunohistochemical staining, no further details will be given.

[0113] 3) Hematoxylin staining: Same as immunohistochemical staining, no further details will be given.

[0114] 4) Eosin staining: add eosin dye for 5 minutes, and then rinse with 95% ethanol three times, 30 seconds each time;

[0115] 5) Dehydration: Soak in 100% ethanol for 3 times, 30 seconds each time, and soak in xylene for 2 times, 10 minutes each time.

[0116] 6) Sealing: After the slices are naturally dried, seal them with neutral resin.

[0117] ImageJ software was used to measure and count the proportion of acinar tissue (Acini area) and the number of immune cells per unit area of ​​pancreatic tissue (CD 45+ cells / mm 2 ) and the number of macrophages per unit area of ​​pancreatic tissue (F4 / 80 + cells / mm 2 ), and then the statistical difference was tested by Student's test, ****P<0.0001, and the data were expressed as mean ± standard error.

[0118] 2.1.2 Correlation analysis between ANG level and pancreatitis

[0119] At the same time, blood samples were collected from mice at 1 week, 2 weeks, 3 weeks, and 4 weeks after pancreatitis modeling. The same method as in Example 1.1.2 was used to detect the level of ANG in the blood using the mouse Angiogenin ELISA kit (Cat. No. ab208349) from Abcam. The blood sample collection time was used as the independent variable, and the level of ANG in the blood was used as the dependent variable. Scatter plots were made and curve fitting was performed to analyze the changes in the level of ANG in the blood during the progression of pancreatitis.

[0120] 2.2 Results

[0121] 2.2.1. H&E staining and immunohistochemical staining results

[0122] The results of H&E staining and immunohistochemical staining of pancreatic tissue sections are shown in Figure 3 .

[0123] During pancreatitis, acinar cells may be damaged, leading to premature activation of pancreatic digestive enzymes and inflammatory response. The proportion of acinar tissue is related to the severity of the disease and treatment strategy, and is therefore an important indicator for diagnosing pancreatitis.

[0124] The number of macrophages is usually identified and counted by specific surface markers. F4 / 80 is a commonly used marker for mature tissue macrophages in mice; F4 / 80 + The number of cells can reflect the infiltration of macrophages and the degree of inflammatory response, which helps to understand the role of macrophages in the inflammatory process.

[0125] from Figure 3 It can be seen that the H&E staining results of pancreatic tissue sections showed that compared with the control group, the acinar tissue was lost due to damage after pancreatitis induction; the measurement and analysis results of the proportion of acinar tissue in the sections showed that the proportion of acinar tissue was significantly reduced (****P<0.0001), indicating that the pancreatic tissue was damaged after induction.

[0126] from Figure 3It can be seen that the staining results of immune cell marker CD45 and macrophage marker F4 / 80 in pancreatic tissue sections showed that after pancreatitis induction, there was obvious immune cell infiltration in the tissue. The statistical and analysis results showed that the number of immune cells and macrophages per unit area of ​​pancreatic tissue increased significantly (****P<0.0001), indicating that there was obvious inflammation in induced pancreatitis.

[0127] The above results proved that pancreatitis was induced successfully.

[0128] 2.2.2 ANG level detection results and fitting analysis results

[0129] The levels of ANG in the blood were detected and analyzed before pancreatitis induction and 1, 2, 3, and 4 weeks after induction. The results are shown in Figure 4 .

[0130] from Figure 4 It can be seen that the level of ANG in the blood increased after pancreatitis modeling, and further increased with the extension of modeling time. Compared with before modeling, the changes in the level of ANG in the blood at each stage after modeling were significantly different (P<0.05).

[0131] from Figure 4 It can be seen that the curve fitting results show that the level of ANG in the blood is significantly correlated with the duration of pancreatitis (Y = 5.753*X + 269.7, R 2 =0.56).

[0132] This suggests that the level of ANG in the blood can indicate the progression stage of pancreatitis.

[0133] Example 3 Study on the expression level of ANG in pancreatic islets of pancreatitis mice

[0134] In this Example 3, the expression level of ANG in the pancreatic islets of pancreatitis mice was studied, including the following steps:

[0135] 3.1 Methods

[0136] First, islet is isolated from normal mice and mice with pancreatitis. The specific steps are as follows:

[0137] 3.1.1. Isolation of pancreatic islets

[0138] (1) Preparation: Prepare 1 mg / mL type V collagenase solution and 10% FBS solution with HBSS and pre-cool on ice for later use; prepare cotton balls, syringes, 26G injection needles, ophthalmic scissors, ophthalmic forceps, and hemostatic forceps.

[0139] (2) Mouse treatment: The experimental mice were anesthetized by injection of 2% sodium pentobarbital solution at a dose of 50 mg / kg. After anesthesia, the mice were fixed on a sterile operating table, and their abdomens were disinfected with 75% ethanol. The abdominal and thoracic cavities were then opened to expose the heart and common bile duct, and the right atrial appendage of the mice was cut to bleed.

[0140] (3) Collagenase injection: Clean the blood of the mouse with a cotton ball, ligate the end of the common bile duct near the gallbladder with a hemostatic forceps, and then use a disposable 5 mL syringe to draw up 2 mL of type V collagenase solution; replace the syringe needle with a 26G needle, and then insert the needle through the duodenal papilla of the common bile duct and slowly inject the collagenase solution into the pancreas until the pancreas is completely filled (about 1.5 mL of enzyme solution is required).

[0141] (4) Pancreatic digestion: Carefully dissect out the full pancreas, place it in a 15-mL sterile centrifuge tube, add 3 mL of type V collagenase solution, and place it in a 37°C water bath for digestion for about 20 min. Invert and mix several times during the digestion. After digestion, vortex and oscillate 3 times for 3 to 5 seconds each time. At this time, the pancreas will appear like quicksand. Add twice the volume of pre-cooled 10% FBS solution to terminate the digestion reaction.

[0142] (5) Filtration: Filter the digested tissue fluid with a 30-mesh metal filter to remove undigested tissue pieces. Centrifuge at 50×g for 5 min, discard the supernatant, and resuspend the precipitate with 5 mL of 10% FBS. Pipette repeatedly for about 20 times, and then filter the solution with a 100 μm pore size filter. The islets will be intercepted on the filter. Rinse with HBSS several times, and finally rinse the islets with 10% FBS solution into a 10 cm culture dish.

[0143] (7) Islet selection: Place the culture dish under a stereoscope and adjust the magnification and focus. Islets with smooth edges and roughly oval or mulberry shapes can be observed. Use a pipette to pick up the islets and transfer them to another culture dish. When there are more acinar cells in the solution, repeat this step until no other types of tissues / cells are mixed in the islets.

[0144] (8) Islet culture: The selected islets were transferred to RPMI1640 medium containing 10% FBS and 1% PS and cultured in suspension at 37°C overnight before proceeding to the next step of the experiment.

[0145] Then, RNA from the pancreatic islets was extracted, and the transcription level of the Ang gene was detected by reverse transcription-real time quantitative polymerase chain reaction (RT-qPCR). The specific steps are as follows:

[0146] 3.1.2. Pancreatic Islet RNA Extraction

[0147] (1) Lysis: Add 1 mL of RNAiso reagent to the EP tube containing islets and repeatedly pipette until the islets are completely lysed and dissolved in the reagent, then let stand at room temperature for 15 min.

[0148] (2) Nucleic acid extraction: Add 200 μL of chloroform to the EP tube, invert and shake to mix, and let stand at room temperature for 5 minutes. Then put it in a centrifuge and centrifuge it at 4°C and 12000×g for 15 minutes. Transfer 500 μL of the upper colorless and transparent phase to a new EP tube.

[0149] (3) Precipitate RNA: Add 500 μL of isopropanol to the EP tube from the previous step. Optionally, add 100 μL of sodium acetate solution (3 M, pH 5.5) and glycogen. Mix by inverting the tube. Let stand at room temperature for 5 min or at -20°C to precipitate overnight. Place the tube in a 4°C centrifuge and centrifuge at 12,000 × g for 15 min. After centrifugation, a white RNA precipitate can be observed at the bottom of the tube.

[0150] (4) Rinse: Carefully remove the residual liquid with a vacuum pump, then add 1 mL of 75% ethanol to the centrifuge tube; place the centrifuge tube in a 4°C centrifuge and centrifuge at 7000 × g for 5 min. A more obvious RNA precipitate can be observed at the bottom of the centrifuge tube; remove the supernatant and add 1 mL of 75% ethanol again; place the centrifuge tube in a 4°C centrifuge and centrifuge at 7000 × g for 5 min; repeat the above steps once and try to remove as much liquid as possible from the centrifuge tube.

[0151] (5) Drying and dissolving: Place the centrifuge tube in a clean bench and blow dry with filtered air. When the white precipitate of RNA in the centrifuge tube becomes transparent, add 50 μL (or appropriate amount) of RNase-free water to the centrifuge tube, pipette and dissolve it, then place the centrifuge tube on ice.

[0152] (6) RNA concentration and purity detection: The concentration of RNA samples was measured using NanoDrop One micro-spectrophotometer. RNA samples can be used directly in downstream experiments or stored in a -80°C refrigerator for later use.

[0153] 3.1.3 Reverse transcription and real-time fluorescence quantitative PCR

[0154] (1) RNA reverse transcription: All RNA-related experimental steps were strictly performed in accordance with the specifications and DNase- and RNase-free consumables were used. Each RNA sample was reverse transcribed at equal mass to obtain cDNA, and the corresponding reagents were added to the reverse transcription reaction system in the DNase- and RNase-free PCR tube according to the following Table 1.

[0155] Table 1

[0156] Element Volume or mass 5×M-MLVbuffer 4μL DTT(1M) 2μL dNTPs (100 μM) 1μL M-MLV 1μL RNA 0.5-1 μg Random Primer (100 μM) 1μL Ultrapure water without enzyme Make up to 20 μL

[0157] After adding all the ingredients, vortex and mix well, then use a microcentrifuge to briefly centrifuge the sample to the bottom of the tube. Set up the reverse transcription program in the PCR instrument (as shown below) and perform the reverse transcription reaction.

[0158] Table 2

[0159] step Temperature(℃) Time (min) 1 42 10 2 95 2

[0160] (2) Real-time fluorescence quantitative PCR: Add ultrapure water to the reverse transcribed cDNA sample to dilute it 3 to 5 times and mix well. Use an electronic pipette to add the qPCR primers, TB Green reagent and cDNA sample of the gene to be detected to each well of the 384-well plate according to the proportions in Table 3 below, seal it with plastic and centrifuge it at 500×g for 2 minutes.

[0161] Forward primer sequence: CCTGTGAGGAGCCTCTAGCTT (SEQ ID NO: 1);

[0162] Reverse primer sequence: GGAAGGGAGACTTGCTCATTC (SEQ ID NO: 2)

[0163] Table 3

[0164]

[0165]

[0166] Turn on the real-time fluorescence quantitative PCR instrument LightCycler 480, set the relevant parameters and programs according to Table 4 below, detect the expression level of the target gene in the cDNA sample by the chimeric fluorescence method, and calculate the cycle number (Ct value) at which different samples reach the fluorescence threshold, and finally analyze the relative transcription level of the specific gene in different samples.

[0167] Table 4

[0168]

[0169] Healthy mice were used as the control group to analyze the changes in the transcription level of Ang gene in the pancreatic islets of pancreatitis mice. Then the statistical difference was tested by Student's test, ****P<0.0001, and the data were expressed as mean ± standard error.

[0170] 3.1.4. Detection of ANG levels in pancreatic islets by ELISA

[0171] (1) Islet protein extraction: The pancreatic islets of control mice and pancreatitis mice were isolated by the above steps, and then the islet cells were lysed with 25 μL of lysis buffer to obtain islet proteins.

[0172] (2) Enzyme-linked immunosorbent assay: The islet protein sample was diluted at a ratio of 1:50 and the mouse Angiogenin ELISA kit (Cat. No. ab208349) from Abcam was used for the assay according to the instructions. The ANG content in the sample was then normalized based on the islet protein sample concentration.

[0173] (3) Analysis: Healthy mice were used as the control group to analyze the changes in the protein expression level of the Ang gene in the pancreatic islets of pancreatitis mice. The Student's test was then used to test the statistical difference, ***P<0.001, and the data were expressed as mean ± standard error.

[0174] At the same time, the pancreatic islets of normal mice were isolated, and then a variety of inflammatory factors (final concentrations: 10ng / mL TNF-α, 10ng / mL IL-1β and 100ng / mL IFN-γ) were added to the culture medium to treat the islets, and PBS was used as a control and incubated in a cell culture incubator for 12 hours. Then, the protein of the islets was extracted, and the protein expression level of the Ang gene was detected by enzyme-linked immunosorbent assay. The changes in the protein expression level of the Ang gene in the islets after inflammatory factor treatment were analyzed. Then, the statistical difference test was performed by Student's test.

[0175] ****P<0.0001, data are expressed as mean ± standard error.

[0176] 3.2 Results

[0177] The results of the analysis of the changes in the transcriptional level of Ang gene in pancreatic islets after pancreatitis induction are as follows Figure 5 shown.

[0178] Figure 5 As shown, there was a significant difference in the transcription level of Ang between the islets in the healthy group and the islets in the pancreatitis group (P<0.05), suggesting that pancreatitis can promote the transcription of Ang genes in islets.

[0179] After pancreatitis induction, the results of the analysis of the changes in the protein level of the Ang gene in the islets are as follows Figure 6 shown.

[0180] Figure 6 As shown, there was a significant difference in the protein level of Ang gene between the islets in the healthy group and the islets in the pancreatitis group (P<0.05), suggesting that pancreatitis can promote the expression of Ang gene in islets.

[0181] The results of the analysis of the changes in ANG levels in pancreatic islets after treatment with inflammatory factors are as follows: Figure 7 shown.

[0182] Figure 7 As shown in the data, compared with the islets treated with PBS, the ANG protein level in the islets was significantly increased after treatment with inflammatory factors (P<0.05), indicating that the changes in ANG levels in the islets were related to inflammatory stimulation.

[0183] Example 4 Specificity and sensitivity analysis of ANG as a pancreatitis marker

[0184] In this Example 4, the specificity and sensitivity of ANG as a biomarker for pancreatitis were analyzed, including the following steps:

[0185] 4.1 Methods

[0186] According to the ANG content in the plasma samples of different patients in Example 1, 500 ng / mL was set as the critical value, and people with ANG content less than 500 ng / mL in their blood were classified as non-pancreatitis patients, while people with ANG content equal to or greater than 500 ng / mL were classified as pancreatitis patients.

[0187] Then, a case-control strategy was adopted to collect plasma samples from 66 clinically confirmed pancreatitis patients and 95 healthy subjects, and the sensitivity and specificity of ANG as a marker for diagnosing pancreatitis were determined. The detection of ANG content in plasma samples was the same as in 1.1.1 of Example 1.

[0188] Sensitivity = number of people with blood ANG equal to or greater than 500 ng / mL / actual number of pancreatitis patients

[0189] Specificity = number of people with blood ANG less than 500ng / mL / actual number of healthy people

[0190] At the same time, by setting a series of different positive-negative critical values, a series of sensitivity and specificity value combinations that change accordingly can be calculated. With specificity as the horizontal axis and sensitivity as the vertical axis, each combination point is connected to draw the receiver operating characteristic curve (Receiver Operation Characteristic Curve, referred to as ROC curve). The area AUC (Area Under Curve) enclosed by the curve and the horizontal axis can be used for the comprehensive evaluation of product detection capabilities. The AUC value range is [0,1]. The closer the value is to 1, the higher the accuracy of product detection, and the accuracy of ANG as a marker can be judged accordingly.

[0191] 4.2 Results

[0192] The table of ANG as a marker for diagnosing pancreatitis is drawn with 500 ng / mL as the diagnostic cutoff value as follows:

[0193] Table 5

[0194] The actual number of healthy people The actual number of patients with pancreatitis ANG content <500 ng / mL 75 (true negative) 17 (false negative) ANG content>500ng / mL 20 (false positive) 49 (True Positive) Total number of people 95 66

[0195] It can be calculated from Table 5 that when 500 ng / mL is used as the diagnostic critical value, the sensitivity of ANG in diagnosing pancreatitis is 78.95% (49 / 66) and the specificity is 78.95% (75 / 95), indicating that ANG as a diagnostic marker for pancreatitis has a high ability to judge positive cases (sensitivity) and negative cases (specificity).

[0196] The results of ROC analysis of ANG levels in the blood of 95 healthy subjects and 66 patients with pancreatitis are shown in Figure 8 .

[0197] from Figure 8 It can be seen that the ROC analysis results of ANG levels in the blood of healthy controls and pancreatitis patients showed that the area under the ROC curve (AUC) was 0.8415 (95% CI: 0.7764-0.9066, P<0.0001), indicating that ANG, as a marker of pancreatitis, has high accuracy and has the potential to indicate the occurrence of pancreatitis.

[0198] The embodiments of the present invention are described in detail above, but it is worth noting that the embodiments of the present invention are not limited to the described embodiments. For those skilled in the art, without departing from the principles and spirit of the present invention, the output of various variations of the embodiments still falls within the protection scope of the present invention.

Claims

1. Use of a substance for detecting ANG expression level in the preparation of at least one of the following products: A1) Products for the diagnosis or detection of pancreatitis; A2) Products for predicting the prognosis of pancreatitis.

2. The use according to claim 1, characterized in that Includes at least one of the following features: B1) the substance for detecting the expression level of ANG comprises a reagent for detecting the expression level of ANG gene or a reagent for detecting the expression level of ANG protein; B2) the product is selected from one or more of a kit, a chip, a probe and a membrane strip; B3) The substance for detecting ANG expression level in the product is the only active ingredient or one of the active ingredients of the product.

3. The use according to claim 2, characterized in that The substance for detecting the expression level of ANG is selected from one or more of a specific probe, a primer and a specific antibody.

4. The use according to claim 3, characterized in that The material for detecting the expression level of ANG includes the primers shown in SEQ ID NO: 1-2.

5. The use according to claim 2, characterized in that The product is used to detect the ANG gene expression level and / or protein expression level in a sample.

6. The use according to claim 5, characterized in that The sample is selected from one or more of blood, plasma, serum, pancreatic islets and pancreatic tissue.

7. The use according to claim 1, characterized in that Also included is the use of ANG in the preparation of a product for monitoring the progression of pancreatitis.

8. A product for diagnosing, detecting or predicting pancreatitis, characterized in that: The product includes a substance for detecting the expression level of ANG.

9. The product according to claim 8, characterized in that The product is selected from one or more of a kit, a chip, a probe and a membrane strip; And / or, the substance for detecting the expression level of ANG is selected from one or more of a specific probe, a primer and a specific antibody; Preferably, the substance for detecting the expression level of ANG includes primers shown in SEQ ID NO: 1-2.

10. Application of ANG as a target in the preparation or screening of drugs for the treatment of pancreatitis.

Images