Amplification primer of Orachidae mitochondria COI gene and application of amplification primer

Abstract

The invention provides an amplification primer for a mitochondrial COI gene of a general family of Orachidae and application of the amplification primer. The amplification primer comprises a forward primer HxmlbF: CTACGAATCACCTAGATATTGG, a reverse primer HxmlbF: CTACGAATCACCTAGATATTGG, a reverse primer HxmlbF: And a reverse primer HxmlbR: CTTCAGGGTGCCGAAAAATCA (Center for Type Culture Collection Gene Gene Gene Gene Gene Gene). The primer pair HxmlbF and HxmlbR designed by the invention is high in universality, has extremely high amplification efficiency on the known 14 types of oysters, is high in specificity, and provides a more efficient method for systematic classification of the general family of the oysters.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and relates to an amplification primer for mitochondrial COI gene of superfamily oysters and application thereof. Background Art

[0002] Oysters belong to the phylum Mollusca, class Bivalvia, order Pterioida, family Ostreidae. Oysters, also known as oysters, oyster roe, oysters, and sea oysters, are an important marine biological resource and one of the most important marine aquaculture economic groups in the world. Their total aquaculture output and yield per unit area rank first among all shellfish aquaculture species.

[0003] Oysters are a species that are widely distributed in the world, mainly in tropical and temperate oceans, ranging from intertidal zones to tens of meters deep. Since oysters are sessile mollusks, their external morphology often changes greatly with different living environments, lacking obvious quantitative characteristics, and most species are difficult to distinguish simply by the external morphology of their shells.

[0004] COI gene (mitochondrial cytochrome oxidase subunit I) is a highly conserved protein-coding gene in the animal mitochondrial genome. It is universal and highly conserved and contains a lot of phylogenetic signals. Studies have shown that COI gene contains rich genetic information and is very suitable for intraspecific research. It is the preferred genetic marker and has been widely used for species identification and genetic diversity assessment of mollusks and other invertebrates. For example, based on the COI gene sequence, Li Yongmei et al. believed that the genetic diversity of oysters in Qinzhou Bay, Guangxi is rich.

[0005] However, the currently available identification primers still have poor specificity and cannot correctly amplify the target gene; they also have low amplification efficiency and can only amplify one or several oysters, but cannot amplify most oyster species. Summary of the invention

[0006] In view of the above technical problems, the object of the present invention is to provide an amplification primer for the mitochondrial COI gene of the superfamily Oyster and its application.

[0007] The technical solution adopted by the present invention to achieve the technical purpose is:

[0008] The present invention provides an amplification primer for the mitochondrial COI gene of the superfamily Oysteroidea, comprising:

[0009] Forward primer HxmlbF: CTACGAATCACCTAGATATTGG;

[0010] Reverse primer HxmlbR: CTTCAGGGTGCCCGAAAAATCA.

[0011] Preferably, the oyster species that can be identified by the amplification primers include: Malabon oyster (Saccostreamalabonensis), Portuguese oyster (Magallana angulata), Saccostrea sp.2, Saccostrea sp.3, spiny oyster 2 (Saccostrea echinata 2), black-toothed oyster 1 (Saccostrea mordax 1), black-toothed oyster 2 (Saccostrea mordax 2), edge-toothed oyster (Dendostrea sandvichensis), thin-flaked oyster (Dendostreafofium), Kumamoto oyster (Magallana sikamea), green oyster (Ostrea stentina), goose palm oyster (Planostrea pestigris), Easy oyster (Magallana bilineata), electric white oyster (Saccostrea readianbaiensis).

[0012] The present invention also provides application of the amplification primers in classification and identification of oyster superfamily.

[0013] Preferably, the amplification primers are used to perform PCR amplification on the DNA template of the oyster sample, and then the classification and identification are performed by comparing the sequencing results.

[0014] Preferably, the DNA template of the oyster sample is obtained by the following method: taking fresh, frozen or 75% ethanol-soaked oyster adductor muscle, and extracting DNA as a template.

[0015] Preferably, the composition of the 20 μL reaction system for PCR amplification is: 3 μL template DNA, 10 μL 2×Taq PCRMaster MIX II, 0.5 μL each of the forward and reverse primers, and sterile distilled water to make up to 20 μL.

[0016] More preferably, the concentration of the template DNA is 100 ng / μL.

[0017] More preferably, the concentration of the forward and reverse primers is 10 mM.

[0018] Preferably, the reaction steps of PCR amplification are: pre-denaturation at 94°C for 3 minutes, followed by denaturation at 94°C for 30 seconds, annealing at 48°C for 30 seconds, extension at 72°C for 45 seconds, and 35 cycles under these conditions, and finally extension at 72°C for 10 minutes.

[0019] The beneficial effects of the present invention are:

[0020] The primer pair HxmlbF and HxmlbR designed by the present invention has strong universality, extremely high amplification efficiency for 14 known oyster species, strong specificity, and provides a more efficient method for the systematic classification of the superfamily of oysters. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The amplification results of the Portuguese oyster (Magallana angulata), Malabon oyster (Saccostrea malabonensis), Kumamoto oyster (Magallana sikamea) and Goosefoot oyster (Planostrea pestigris) using the amplification primers of the present invention are shown.

[0022] Figure 2 The amplification results of the amplification primers of the present invention for Magallana bilineata, Saccostrea echinata 2, and Saccostrea mordax 2 are shown.

[0023] Figure 3 The amplification results of Dendostrea fofium, Dendostrea sandvichensis and Saccostrea dianbaiensis using the amplification primers of the present invention are shown.

[0024] Figure 4 The amplification results of black tooth oyster 1 (Saccostrea mordax 1), Saccostrea sp. 2, Saccostrea sp. 3 and green oyster (Ostrea stentina) using the amplification primers of the present invention are shown.

[0025] Figure 5 These are the shells of 14 oyster samples in the examples of the present invention. DETAILED DESCRIPTION

[0026] The present invention is described in detail below in conjunction with specific implementation methods. The following specific embodiments are helpful for those skilled in the art to further understand the present invention, but do not limit the present invention in any form.

[0027] Example

[0028] The implementation process of the present invention is as follows:

[0029] 1. Take fresh, frozen or 75% ethanol-soaked oyster adductor muscles and extract DNA using a marine animal tissue genomic DNA extraction kit. The extracted DNA is stored in TE buffer and stored at -20°C as template DNA for later use. At the same time, properly preserve the shell of the oyster sample, such as Figure 5 shown.

[0030] 2. The oyster mitochondrial COI gene amplified by the universal primers LCO1490 and HCO2198 and the oyster mitochondrial COI gene in the NCBI nucleotide database were integrated for comparison analysis, and the conserved sequence regions were selected to design specific primers to obtain a specific primer pair for the superfamily of oysters. The primer pair is as follows: forward primer HxmlbF: CTACGAATCACCTAGATATTGG, reverse primer HxmlbR: CTTCAGGGTGCCCGAAAAATCA.

[0031] 3. The reaction system for polymerase chain reaction (PCR) is 20 μL, which consists of 3 μL template DNA (100 ng / μL), 10 μL 2×Taq PCR Master MIX II, 0.5 μL of forward and reverse primers (10 mM), and sterile distilled water to make up to 20 μL. The PCR reaction steps are: pre-denaturation at 94°C for 3 minutes, followed by denaturation at 94°C for 30 seconds, annealing at 48°C for 30 seconds, extension at 72°C for 45 seconds, and 35 cycles under these conditions, and finally extension at 72°C for 10 minutes. The PCR product was detected on a 1.5% agarose gel to confirm the quality and length of the target fragment. The marker used was D2000 DNA Marker.

[0032] The amplification results are as follows Figures 1 to 4 As shown, it can be seen that the primer pair HxmlbF and HxmlbR designed by the present invention has strong versatility, extremely high amplification efficiency and strong specificity for the 14 known oyster species.

[0033] The qualified products are sent to the sequencing company for Sanger sequencing.

[0034] 4. Use SeqMan software to optimize the splicing sequencing results, and use BLAST to compare the sequencing results in the NCBI nucleic acid database for species identification.

[0035] Obviously, the above embodiments of the present invention are merely examples to more clearly illustrate the present invention, and are not limitations on the implementation methods of the present invention. For ordinary technicians in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is impossible to list all the implementation methods here. All obvious changes or modifications derived from the technical solution of the present invention are still within the protection scope of the present invention.

Claims

1. A primer for amplifying the mitochondrial COI gene of the superfamily Oysteroidea, comprising: Forward primer HxmlbF: CTACGAATCACCTAGATATTGG; Reverse primer HxmlbR: CTTCAGGGTGCCCGAAAAATCA.

2. The amplification primer according to claim 1, characterized in that The oyster species that can be identified by the amplification primers include: Malabon oyster Saccostrea malabonensis, Portuguese oyster Magallana angulata, Saccostrea sp. 2, Saccostrea sp. 3, spiny oyster 2 Saccostrea echinata 2, black-toothed oyster 1 Saccostreamordax 1, black-toothed oyster 2 Saccostrea mordax 2, edge-toothed oyster Dendostrea sandvichensis, thin-flaked oyster Dendostrea fofium, Kumamoto oyster Magallanasikamea, green oyster Ostrea stentina, goose-foot oyster Planostrea pestigris, Easy oyster Magallana bilineata, and Dianbai oyster Saccostrea di baiensis.

3. Use of the amplification primers according to claim 1 in the classification and identification of the superfamily of oysters.

4. The use according to claim 3, characterized in that: After the amplification primers are used to perform PCR amplification on the DNA template of the oyster sample, classification and identification are performed by comparing the sequencing results.

5. The use according to claim 4, characterized in that: The DNA template of the oyster sample is obtained by the following method: taking fresh, frozen or 75% ethanol-soaked oyster adductor muscle, and extracting DNA as a template.

6. The use according to claim 5, characterized in that: The composition of the 20 μL reaction system for PCR amplification is: 3 μL template DNA, 10 μL 2×Taq PCR Master MIX II, 0.5 μL each of the forward and reverse primers, and sterile distilled water to make up to 20 μL.

7. The use according to claim 6, characterized in that: The concentration of template DNA was 100 ng / μL.

8. The use according to claim 6, characterized in that: The concentration of forward and reverse primers was 10 mM.

9. The use according to any one of claims 4 to 8, characterized in that: The reaction steps of PCR amplification were: pre-denaturation at 94°C for 3 minutes, followed by denaturation at 94°C for 30 seconds, annealing at 48°C for 30 seconds, and extension at 72°C for 45 seconds. 35 cycles were performed under the same conditions, and finally extension was performed at 72°C for 10 minutes.

Images