SNP (Single Nucleotide Polymorphism) marker for identifying female plant and male plant of siraitia grosvenorii and identification method

Abstract

According to the invention, 125 varieties collected by the Jiaosi company and wild natural varieties collected in Guilin region are subjected to GWAS data association analysis through many years of repeated phenotypic data, and it is found that a region determined by sex is located in a 0-1mbps interval of a No.3 chromosome of a genome. Therefore, the invention provides the SNP region for early identification of the female and male plants of the siraitia grosvenorii, the female and male plants in the region have own haplotypes, a group of haplotypes of the female and male plants are finally screened out, and any one SNP marker in the haplotypes can be used for SNP molecular marker development and identification of the female and male plants.

Description

Technical Field

[0001] This application relates to the field of genetic engineering and molecular biology, and is about the identification and application of a region for determining the sex of male and female development in Momordica grosvenori. Background Art

[0002] Momordica grosvenori is a dioecious plant, and its male and female plants cannot be identified by the naked eye in morphology. The male and female can only be distinguished when they bloom. Although relatively few seedlings are used in production, most of them are tissue culture propagation seedlings, but the planting of seedlings is particularly important in the breeding of new varieties with high yield and high glycosides. In order to improve the quality of seedlings, protect them from the influence of viral diseases, and improve the root system and weak growth potential, if it is not possible to distinguish male and female plants in the seedling stage, then planting a large number of female plants that have not been screened for males will waste a lot of manpower and land resources. Therefore, the development of seedling sex identification markers before rapid transplanting has important production significance, especially to promote the hybrid advantage of Momordica grosvenori and improve the efficiency of breeding.

[0003] In the past, the method of selecting male and female plants usually selectively removed the male plants when the plants were flowering to reduce the need for plant management. In 2013, Zhang Huixin et al. published a patent titled "A SCAR molecular marker for identifying the sex of monk fruit". This marker enabled the use of PCR to screen male and female plants in the early seedling stage. However, the amplified fragments in this patent cannot be determined to be related to male and female genes and genomic male and female control sites. In addition, this marker may not necessarily have universal adaptability, because this marker has not been verified in other monk fruit varieties in the patent publication. In addition, the throughput of this method is relatively slow and low.

[0004] The male-female ratio of monk fruit in the offspring is 1.3:1, with more male plants than female plants, which limits the promotion of hybrid seedlings in terms of economic value of planting. Due to the lack of a complete reference genome for monk fruit, the genetic polymorphism of monk fruit cannot be systematically compared and analyzed, and molecular markers cannot be screened and verified. At the same time, the differences between male and female plants at the genomic level are difficult to compare because there is no reference genome, so it is even more difficult to find the determining genes for male and female. Although the genetic ratio of male and female monk fruit is known, there is no similar model to explain the male-female genetic mechanism of monk fruit. In addition, when looking for the location of male and female genes in monk fruit, a complete reference genome is also required so that the genes linked to the traits can be located and determined.

[0005] In 2018, Xia et al. assembled a monk fruit genome, but this genome was not assembled to the chromosome level, and more than 2,000 contig fragments that could not be assembled were retained, making any gene mapping very difficult. Summary of the invention

[0006] Due to the lack of a complete genome and male-female identification markers, the improvement and large-scale screening of conventional breeding of dioecious monk fruit have been limited for a long time. In order to solve the problems existing in the prior art, this application splices and assembles the whole genome of a commercial variety of Giffords Company, and compares the male and female plants of multiple different varieties on different chromosomes, with the aim of providing a haplotype that distinguishes males and females on a chromosome region, as well as SNP molecular markers and applications in this haplotype.

[0007] This application can solve the accuracy and reliability problems of identifying the sex of Momordica grosvenori. The technology can determine the sex of Momordica grosvenori plants at the seedling stage, avoiding the problem of wasting germplasm resources and costs. At the same time, the technology can be applied to Momordica grosvenori plants of different varieties, improving the universality and practicality of the research.

[0008] Specifically, this application adopts the following technologies:

[0009] 1. A SNP marker for identifying female and male Momordica grosvenori plants, wherein the SNP marker is a site with a p-vlaue value greater than 25.

[0010] 2. The SNP marker according to item 1, wherein the nucleotide sequence of the SNP marker is as shown in SEQ ID NO: 1, and the position is the 122nd position of the nucleotide sequence, wherein the nucleotide represented by S in SEQ ID NO: 1 is G or C.

[0011] 3. The SNP marker according to item 1 or 2, wherein when the alleles at the S position of the Momordica grosvenori diploid are G and C, the Momordica grosvenori is a male plant, and when the alleles at the S position of the Momordica grosvenori diploid are C and C, the Momordica grosvenori is a female plant.

[0012] 4. A primer for detecting the SNP marker described in any one of items 1 to 3, comprising:

[0013] Forward Primer 1:

[0014] 5'-GAAGGTGACCAAGTTCATGCTTCAACCATTGGGGATGGAG-3';

[0015] Forward Primer 2:

[0016] 5'-GAAGGTCGGAGTCAACGGATTTCAACCATTGGGGATGGAC-3';

[0017] Reverse primer: 5′-GTAGAAGCGGCTGCTTTTACTGG-3′.

[0018] 5. A detection reagent or kit for detecting a SNP marker according to any one of items 1 to 3, comprising the primer according to item 4.

[0019] 6. Use of the SNP marker described in any one of Items 1 to 3, the primer described in Item 4, or the detection reagent or kit described in Item 5 in identifying or screening female and male Momordica grosvenori plants.

[0020] 7. Use of the SNP marker according to any one of Items 1 to 3, the primer according to Item 4, or the detection reagent or kit according to Item 5 in marker-assisted breeding of Momordica grosvenori.

[0021] 8. Use of the SNP marker according to any one of Items 1 to 3, the primer according to Item 4, or the detection reagent or kit according to Item 5 in Momordica grosvenori hybrid breeding.

[0022] 9. A method for distinguishing female and male Momordica grosvenori plants, wherein the SNP marker for distinguishing female and male Momordica grosvenori plants to be tested is detected to predict whether the Momordica grosvenori plant is a female plant or a male plant, wherein the SNP marker is the SNP marker described in any one of items 1 to 3.

[0023] 10. The method according to claim 9, comprising:

[0024] Extracting genomic DNA of the tested monk fruit;

[0025] Using the genomic DNA of the tested monk fruit as a template, PCR amplification is performed using the primers described in item 4 to obtain a PCR amplification product;

[0026] Detect the PCR amplification product. If the alleles at the diploid S position of the amplification product sequence are G and C, the Momordica grosvenori is a male plant; when the alleles at the diploid S position of the Momordica grosvenori are C and C, the Momordica grosvenori is a female plant.

[0027] Effects of the Invention

[0028] This application uses 125 varieties collected by Giffords and wild natural varieties collected in Guilin to perform GWAS data association analysis through multi-year and multi-repeated phenotypic data, and finds that the region determining sex is located in the 0-1 mbps interval of chromosome 3 of the genome. Therefore, this application provides a SNP region for early identification of male and female monk fruit plants, in which the female and male plants have their own haplotypes, and finally a group of haplotypes of male and female plants are screened out, and any SNP marker in it can be used for SNP molecular marker development and identification of male and female plants.

[0029] The present application directly sequenced 125 DNA samples of different varieties and found the common haplotypes of male and female plants. The haplotypes of male and female plants are not restricted by season, environment, expression or not.

[0030] The screening method of the present application is highly efficient, rapid and accurate in technical effect, and can determine the sex of plants with 96% detection accuracy without planting until the plants bloom, thereby greatly reducing the cost of planting and increasing the efficiency of monk fruit hybrid breeding.

[0031] The research and application of this application alleviate the technical problem of lack of accurate and complete reference genome and effective and efficient molecular biological markers in the research of monk fruit molecular breeding. The application of this technology will help improve the efficiency and quality of monk fruit breeding and promote the development of the monk fruit industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] The accompanying drawings are used to better understand the present application and do not constitute an improper limitation on the present application.

[0033] Figure 1 It is the Manhattan plot of the SNP marker site, the horizontal axis is the chromosome number, and the vertical axis is the association analysis-log P value.

[0034] Figure 2 This is the quantile map of SNP loci for the association analysis of male and female traits. DETAILED DESCRIPTION

[0035] The following is a description of the exemplary embodiments of the present application, including various details of the embodiments of the present application to facilitate understanding, which should be considered as merely exemplary. Therefore, it should be recognized by those of ordinary skill in the art that various changes and modifications can be made to the embodiments described herein without departing from the scope and spirit of the present application. Similarly, for clarity and conciseness, the description of well-known functions and structures is omitted in the following description.

[0036] The present application provides a SNP marker for identifying female and male Momordica grosvenori plants, wherein the SNP marker is a site with a p-vlaue value greater than 25.

[0037] The term "single nucleotide polymorphism" or "SNP" refers to a change in a DNA sequence or genetic variant that occurs when one nucleotide [e.g., adenine (A), thymine (T), cytosine (C), or guanine (G))] is changed to another nucleotide in the genomic sequence.

[0038] The term "p-value" is a parameter used to determine the results of a hypothesis test. It can also be used to compare different distributions using the rejection region of the distribution. It was first proposed by R.A. Fisher.

[0039] The p-value (P value) is the probability of a result that is more extreme than the sample observation result when the null hypothesis is true. If the P value is very small, it means that the probability of the null hypothesis occurring is very small. If it occurs, according to the principle of small probability, there is reason to reject the null hypothesis. The smaller the P value, the more sufficient the reason to reject the null hypothesis. In short, the smaller the P value, the more significant the result.

[0040] In this application, the p-value refers to the statistical significance indicator of the association between genes or genetic variations and traits in GWAS analysis. A smaller P value indicates that the observed association result is unlikely to be caused by random factors, which increases the confidence in rejecting the null hypothesis. In this application, the P value is expressed in terms of (-log 10 (p)) indicates.

[0041] In the present application, each SNP marker locus with a p-vlaue value greater than 25 is considered to be a SNP associated with the identification of female and male Momordica grosvenori plants, and can be used to identify female and male Momordica grosvenori plants.

[0042] Momordica grosvenori is the fruit of a perennial vine of the Cucurbitaceae family. Also known as Lahan fruit, false bitter melon, light fruit turtle, Jinbuhuan, Luohanbiao, naked turtle, it is praised as the "immortal fruit". Its leaves are heart-shaped, dioecious, blooming in summer and bearing fruit in autumn. It is one of the first batch of medicinal and edible materials approved by the country, and its main effect is to relieve cough and reduce phlegm. The fruit has high nutritional value and is rich in vitamin C (400 mg to 500 mg per 100 g of fresh fruit) as well as glycosides, fructose, glucose, protein, lipids, etc. There are many varieties of Momordica grosvenori, and they have different names according to different classification methods. The SNP sites involved in this application can identify any variety of Momordica grosvenori without limitation, such as the common long beach fruit, green skin fruit, red hair fruit, tea mountain fruit, Lajiang fruit, winter melon fruit, etc.

[0043] In a specific embodiment, the nucleotide sequence of the SNP marker is as shown in SEQ ID NO:1, and the position is the 122nd position of the nucleotide sequence, wherein the nucleotide represented by S in SEQ ID NO:1 is G or C.

[0044] ATTGTCGTCCTACCTATCTACAAAACAGCAGAGCCTTCAAAGTAGAAGCGGCTGCTTTTACTGGATTATTAGAGAGAGAAGAAGTTGAGAAAATGAATGAACTGAGATTTGCTTGCATGCTSTCCATCCCCAATGGTT GATTTAATTCGTTTGGTAGGCAGAGATTGTAAAACATATAAACGAAATCTTTTGGGACATGATAAAAAATTAAATTTTCAGTTCCATGCTTTGGGTTGGGCCCGTCATATTCTTATTCAACACACGTACGGGGCGCCT

[0045] In a specific embodiment, when the alleles at the S position of the Momordica grosvenori diploid are G and C, the Momordica grosvenori is a male plant, and when the alleles at the S position of the Momordica grosvenori diploid are C and C, the Momordica grosvenori is a female plant.

[0046] The present application provides a primer set for identifying SNPs of female and male Momordica grosvenori plants, including a forward primer and a reverse primer. The primer set includes a primer pair for detecting the above-mentioned SNP marker site.

[0047] In a specific embodiment, an exemplary primer pair is shown below, wherein the primer comprises:

[0048] Forward primer 1, as shown in SEQ ID NO: 2,

[0049] 5'-GAAGGTGACCAAGTTCATGCTTCAACCATTGGGGATGGAG-3';

[0050] Forward primer 2, as shown in SEQ ID NO: 3,

[0051] 5'-GAAGGTCGGAGTCAACGGATTTCAACCATTGGGGATGGAC-3';

[0052] The reverse primer is shown in SEQ ID NO:4,

[0053] 5'-GTAGAAGCGGCTGCTTTTACTGG-3'.

[0054] For the specific base sequences of the above exemplary primer pairs, as long as they can specifically recognize their respective specific recognition regions under the conditions for PCR implementation (preferably, annealing and self-annealing do not occur between the primers used in a single reaction vessel), one or more bases can be replaced with other bases, or one or more bases can be added to the 3' end or 5' end. Here, the so-called multiple bases are, for example, 2 to 3. When one or more bases are added to the primer, it is preferably added to the 5' end of the primer.

[0055] The base sequence obtained by replacing one or more bases in the specific base sequence of the primer exemplified above with other bases preferably has an identity of 70% or more with the base sequence before substitution (i.e., the base sequence shown in the sequence number), more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, and more preferably 95% or more.

[0056] According to the embodiments of the present application, the above primers have very good specificity, and the above primers can be used to accurately and effectively perform PCR amplification on the fragment where the SNP marker site related to the tested monk fruit is located.

[0057] The present application provides a detection reagent or kit for SNP markers as described in any one of the above items, wherein any one of the primers described above.

[0058] In a specific embodiment, the kit further includes reagents for extracting genomic DNA from a sample and reagents for performing PCR reaction using the primers.

[0059] In a specific embodiment, the reagent for extracting genomic DNA from a sample can be an existing kit.

[0060] In one embodiment, the reagents for PCR reaction using the primer set can be selected from DNA polymerase, PCR buffer, dNTP mixture and aqueous medium, or selected from premixes of the above reagents. For example, the premix is ​​selected from EXTaq (HS): Premix Ex TaqTM Hot Start Version, takara (RR030Q).

[0061] The PCR buffer can usually provide the most suitable conditions for the enzyme-catalyzed reaction to the PCR system. The buffer only needs to play the above-mentioned role.

[0062] The dNTP mixture is usually used as a raw material in DNA synthesis, and specifically may include dATP, dGTP, dTTP, dCTP, and the like.

[0063] The aqueous medium can generally be used to adjust the concentration of each component in the PCR system and can generally be used as a dilution solvent.

[0064] The present application further provides the use of any of the above-described SNP markers, primers or detection reagents or kits in identifying or screening female and male Momordica grosvenori plants.

[0065] The present application further provides the use of any of the above-described SNP markers, primers or detection reagents or kits in marker-assisted breeding of Momordica grosvenori.

[0066] The present application further provides the use of any of the above-mentioned SNP markers, primers or detection reagents or kits in Momordica grosvenori hybrid breeding.

[0067] The detection method of the SNP marker of the present application is not specifically limited. Sequencing, single-strand conformation polymorphism polymerase chain reaction (PCR-SSCP), restriction fragment length polymorphism polymerase chain reaction (PCR-RFLP) and time-of-flight mass spectrometry and other technologies can all achieve SNP detection. Among them, sequencing is a detection technology with high accuracy, strong flexibility, high throughput and short detection cycle. It is only necessary to design a pair of primers on both sides of the SNP site, amplify a 400-700bp product, and then directly detect the genotype of the SNP site by sequencing.

[0068] The present application further provides a method for identifying female and male Momordica grosvenori plants, wherein the SNP marker used for identifying female and male Momordica grosvenori plants is detected to predict whether the Momordica grosvenori plant is a female plant or a male plant, wherein the SNP marker is the SNP marker described in any one of the above items.

[0069] In a specific embodiment, the identification method comprises the following steps:

[0070] Extracting genomic DNA of the tested monk fruit;

[0071] Using the genomic DNA of the tested monk fruit as a template, PCR amplification is performed using primers to obtain PCR amplification products;

[0072] Detect the PCR amplification product. If the alleles at the X position of the diploid sequence of the amplification product are G and C, the Momordica grosvenori is a male plant; when the alleles at the X position of the diploid sequence of the Momordica grosvenori are C and C, the Momordica grosvenori is a female plant.

[0073] Example

[0074] Example 1 Acquisition of SNP markers

[0075] 1. Sample Collection and Processing

[0076] Giffords has preserved 125 different varieties in the past 20 years, including commercial varieties and wild varieties collected in Guilin. This application sequenced these Momordica germplasm resources, of which 102 were female plants and 17 were male plants, which were cultivated and the sprouts were selected for DNA extraction.

[0077] 2. DNA extraction and purification method The CTAB method, which is the most commonly used method for plant species, was used.

[0078] 3. Screening and identification of SNP molecular markers:

[0079] a. High-throughput sequencing

[0080] The 125 monk fruit varieties mentioned above were deeply sequenced using a high-throughput second-generation resequencing method. The average sequencing depth of each site reached 60×, and six million high MAF polymorphic sites were obtained.

[0081] At the same time, one of the male line's monk fruit varieties, MFC0009, was subjected to third-generation sequencing including HIFI and Hi-C sequencing, and chromosome-level splicing was performed.

[0082] b. Genome assembly

[0083] After three generations of sequencing and splicing, the third-generation sequencing completed the genome of Monk Fruit and successfully assembled the genome to the chromosome level. The total length of the entire genome is 321Mbps.

[0084] In this field, it is currently not possible to sequence the entire genome and perform chromosome splicing on Momordica grosvenori. This application is based on more than 100 Momordica grosvenori germplasm resources preserved by the applicant in the past 20 years. After a large amount of sequencing and splicing, the Momordica grosvenori genome was fully spliced ​​and the genome was successfully assembled to the chromosome level. This is the first time in this field. The total length of the entire genome is 321Mbps, and the spliced ​​genome and chromosomes are also determined by the applicant for the first time.

[0085] Although the cultivation history of monk fruit has been hundreds of years, the complete sequence of its genome has not been completely spliced ​​in the past 20 years. In 2018, Mian Xia et al. published an improved monk fruit genome, Monk fruit (Qingpiguo) v1 Genome | CuGenDBv2 (cucurbitgenomics.org). Although 30,565 conserved protein regions can be found according to this genome, this genome is still composed of more than 4,000 contigs. This splicing has not reached the chromosome level. Therefore, it is difficult to locate any trait gene on this genome. The applicant used the third-generation long sequencing technology and the second-generation sequencing technology to sequence and splice a male commercial variety before splicing the monk fruit genome.

[0086] c. GWAS association analysis of male and female traits

[0087] High-throughput next-generation sequencing was used to sequence the above 125 Momordica grosvenori germplasm resources, of which 102 were female plants and 17 were male plants, and the SNP polymorphism of all germplasms was analyzed. A 6.4M locus SNP database was integrated. Using these SNP loci and known male and female traits, a genome-wide association analysis was performed on this database.

[0088] Genome-wide association analysis (GWAS) refers to the use of high-throughput sequencing technology to identify existing sequence variations in the entire genome, namely, SNP typing, and the use of bioinformatics methods to screen out SNP sites associated with complex traits or measurable shapes. It is currently the most commonly used method for discovering functional gene markers.

[0089] The GLM+3pc method was used to calculate the association analysis of SNPs in the GWAS analysis. The mixed linear model algorithm (Yu et al., 2006) was used in the GWAS analysis, which was implemented in the rMVP R software package v.1.0.6 (Yin et al., 2021). In this analysis, the applicant calculated the kinship matrix of all breeds of Giffords (calculated according to the method described in VanRaden, 2008) and the first three principal component variances (calculated as described above) as covariates. The calculation of local linkage disequilibrium was performed using Plink v.1.9 (Purcell et al., 2007) software.

[0090] GLM+3pc is a statistical model commonly used in genome-wide association studies (GWAS). It considers the effect of group structure on genetic variation and uses three principal components to correct population stratification and correct false positives. It is mainly used to correct the effect of group structure on genetic variation, thereby correcting false positives. In GWAS, a false positive refers to a situation where there is no real association but it is mistakenly identified as an association due to the influence of group structure. This situation may cause researchers to waste time and resources when looking for real associations. Compared with other methods for correcting population structure in GWAS, GLM+3pc is considered to be a relatively simple and computationally efficient method. It is also relatively easy to implement and explain, which is why this application chooses this method for calculation.

[0091] In the GWAS analysis, the GWAS p-value (-log10(p)) of all SNPs in the continuous segment between 0 and 1mbp of the chromosome 3 segment showed that the trait related to male and female was located near 0.49mb. The Manhattan plot obtained by GWAS analysis is as follows Figure 1 As shown, the horizontal axis is the base sequence from chromosome 1 to 14. The vertical axis is -log 10 (p) represents the statistical significance value of GWAS analysis, that is, the p-value.

[0092] In GWAS analysis, p-value is a statistically significant indicator of the association between genes or genetic variations and traits. A smaller P value indicates that the observed association result is unlikely to be caused by random factors, increasing the confidence in rejecting the null hypothesis. However, the P value only provides association information. Although SNP sites with (-log10(p)) greater than or equal to 8 can be theoretically considered to be significantly associated with males and females, this application detected that SNP sites with (-log10(p)) greater than or equal to 25 are the sites most closely associated with male and female traits. Selecting any of these sites can distinguish between male and female plants.

[0093] The threshold is selected between (-log 10 (p)) is greater than or equal to 25, that is, the loci with p-vlaue value greater than or equal to 25, the SNPs associated with sex traits at the position of chromosome 3 are all located in the peaks framed in the figure above, and these SNPs form a series of male and female haploid SNP loci. Any of these SNPs can be used to distinguish male and female plants, and these SNPs are called golden SNPs.

[0094] At the same time, the present application also conducted a statistical analysis on the GWAS analysis results. On chromosome 3, there are 471 SNP sites with p-vlaue values ​​greater than 25 and associated with sex traits. Any of these 471 SNP sites can be used to distinguish between male and female plants. In addition, the present application found that the larger the p-vlaue value, the higher the accuracy of distinguishing between male and female plants. By conducting a statistical analysis on the GWAS analysis results, there are 9 SNP sites on chromosome 3 with p-vlaue values ​​greater than 30 and associated with sex traits. These 9 SNP sites have a higher accuracy in distinguishing between male and female plants.

[0095] By comparing the actual result of the SNP locus P value and the quantile of the probability distribution of the probability value / expected value, the two P value probability distributions can be compared. Figure 2 As shown in the figure, the Y axis is the actual result of the p-value of the SNP site, i.e. observed; the X axis is the probability value / expected value of uniform distribution, i.e. expected. The above indicators are all converted to -log10.

[0096] Figure 2 The distribution of P values ​​associated with male and female traits obtained from statistical tests in the male and female genome-wide association study (GWAS) is presented. The expected P value is calculated under the null hypothesis and plotted on the x-axis, while the observed P value is plotted on the y-axis. A straight line with a slope of one indicates that the observed p-value distribution conforms to the null hypothesis distribution, while a curved line indicates a deviation from the null hypothesis distribution. The higher the degree of deviation, the higher the probability of association, such as Figure 2 The loci with -log10(p) greater than 30 have the highest probability of being associated with male and female traits.

[0097] d. Screening of SNP molecular markers in Momordica grosvenori

[0098] From the SNP sites with p-vlaue values ​​greater than 30 and associated with sex traits, a site with high p-vlaue is further screened, and the site meets the requirements of allele-specific PCR designed as a fluorescent endpoint method. The sequence of the SNP marker site is shown in SEQ ID NO: 1:

[0099] ATTGTCGTCCTACCTATCTACAAAACAGCAGAGCCTTCAAAGTAGAAGCGGCTGCTTTTACTGGATTATTAGAGAGAGAAGAAGTTGAGAAAATGAATGAACTGAGATTTGCTTGCATGCTSTCCATCCCCAATGGTT GATTTAATTCGTTTGGTAGGCAGAGATTGTAAAACATATAAACGAAATCTTTTGGGACATGATAAAAAATTAAATTTTCAGTTCCATGCTTTGGGTTGGGCCCGTCATATTCTTATTCAACACACGTACGGGGCGCCT

[0100] The nucleotide represented by S at position 122 in SEQ ID NO:1 is G or C, which is marked as [G / C], i.e., a SNP marker site. The polymorphism of the sequence in female and male plants is that when the alleles at this position in the diploid Momordica grosvenori are G and C, the Momordica grosvenori is a male plant, and when the alleles at this position in the diploid Momordica grosvenori are C and C, the Momordica grosvenori is a female plant, i.e.

[0101] G:C is male,

[0102] C: C is female.

[0103] Example 2 Validation and Application of SNP Molecular Markers

[0104] The above marks were verified in 2019, 2020 and 2021. The verification method used is as follows

[0105] 1. Cultivate seedlings and select young shoots for DNA extraction.

[0106] 2. DNA extraction and purification method The CTAB method, which is the most commonly used method for plant species, was used.

[0107] 3. Amplify the nucleotide fragment containing the SNP site and detect the amplification of specific primers.

[0108] The primers for allelic PCR of SEQ ID NO: 1 using the fluorescent endpoint method were designed as follows:

[0109] Forward Primer 1 (SEQ ID NO: 2):

[0110] 5'-GAAGGTGACCAAGTTCATGCTTCAACCATTGGGGATGGAG-3';

[0111] Forward Primer 2 (SEQ ID NO: 3):

[0112] 5'-GAAGGTCGGAGTCAACGGATTTCAACCATTGGGGATGGAC-3';

[0113] Reverse primer (SEQ ID NO:4):

[0114] 5'-GTAGAAGCGGCTGCTTTTACTGG-3'.

[0115] The above three primers were mixed in the following ratio: 12 μl of forward primer 1, 12 μl of forward primer 2, 30 μl of reverse primer, and 46 μl of water to form 100 μl of primer mixture.

[0116] Mix the primer mixture (0.07 μl), DNA template (2.5 μl), and fluorescent PCR mixture (2.5 μl) and place them in a fluorescent PCR instrument. Perform the reaction according to the following cycle parameters: (1) Denaturation: 94°C, 15 min, 1 cycle (2) Specific cycle: 94°C, 20 seconds, 61°C-55°C, decreasing by 0.6°C, 10 cycles (3) Amplification cycle: 94°C 20 seconds, 55°C 60 seconds, 26 cycles; (4) Reading cycle: 30°C 60 seconds, 1 cycle. Amplify the nucleotide fragment where the SNP to be tested is located.

[0117] 4. High-throughput sequencing

[0118] After the PCR reaction was completed, the second generation sequencing method was used to perform high-throughput DNA detection on the nucleotide fragments where the amplified SNPs to be tested of the above 125 monk fruit varieties were located, so as to achieve early detection of male and female plants. The results are shown in Table 1 below.

[0119] 2020: The same verification method as in 2019 was used, with a total sample size of 194. The results are shown in Table 1 below.

[0120] 2021: The same verification method as in 2019 was used, with a total sample size of 383. The results are shown in Table 1 below.

[0121] Table 1

[0122]

[0123] The experimental seedlings from 2019 to 2021 were tested, and as can be seen from the verified results in Table 1, the data confirmed that the prediction accuracy of this marker is more than 94.8%.

[0124] Momordica grosvenori is a perennial vine plant, and the breeding of seedlings requires 2-3 years. The present application has spent a lot of time and manpower in the process of collection, cultivation, detection, and re-verification. The development of this marker has expanded the scale of breeding from the selection of dozens of trees to the scale of thousands of trees, and the breeding selection scale has been improved by dozens of times, greatly improving the efficiency of breeding. The applicant has carried out these sequencing, planting and final verification processes as accurately as possible, and finally obtained a high prediction accuracy rate. Therefore, it is explained that the method of the present application has high accuracy and high efficiency.

[0125] The present application has verified the SNP marker of the present application in 2019, 2020 and 2021 respectively, and this marker has provided stable, fast and accurate predictions for three consecutive years. Such a long verification process is very rare in this field, because it requires a lot of experimental means and manpower and material resources. The SNP marker provided by the present application has an accuracy of 96.1% in the verification process in 2019. This is the first rapid detection of the accuracy of male and female traits in this field. However, the present application has been rigorous and serious and has conducted two more years of verification, at the cost of a lot of manpower and material resources. Facts have proved that the SNP marker provided by the present application is very accurate, which is a result that has not been achieved in this field so far.

[0126] Although the embodiments of the present application are described above, the present application is not limited to the above specific embodiments and application fields, and the above specific embodiments are merely illustrative and instructive, rather than restrictive. A person of ordinary skill in the art can make many forms under the guidance of this specification and without departing from the scope of protection of the claims of the present application, all of which belong to the protection of the present application.

Claims

1. SNP markers used to identify female and male Momordica grosvenori plants, including: The SNP markers are sites with p-values ​​greater than 25.

2. The SNP marker according to claim 1, wherein the nucleotide sequence of the SNP marker is as shown in SEQ ID NO: 1, and the position is the 122nd position of the nucleotide sequence, wherein the nucleotide represented by S in SEQ ID NO: 1 is G or C.

3. The SNP marker according to claim 1 or 2, wherein: When the alleles at the S position of the diploid Momordica grosvenori are G and C, the Momordica grosvenori is a male plant. When the alleles at the S position of the diploid Momordica grosvenori are C and C, the Momordica grosvenori is a female plant.

4. A primer for detecting the SNP marker according to any one of claims 1 to 4, comprising: Forward Primer 1: 5'-GAAGGTGACCAAGTTCATGCTTCAACCATTGGGGATGGAG-3'; Forward Primer 2: 5'-GAAGGTCGGAGTCAACGGATTTCAACCATTGGGGATGGAC-3'; Reverse primer: 5′-GTAGAAGCGGCTGCTTTTACTGG-3′.

5. A detection reagent or kit for detecting a SNP marker according to any one of claims 1 to 3, wherein Comprising the primers described in claim 4.

6. Use of the SNP marker according to any one of claims 1 to 3, the primer according to claim 4, or the detection reagent or kit according to claim 5 in identifying or screening female and male Momordica grosvenori plants.

7. Use of the SNP marker according to any one of claims 1 to 3, the primer according to claim 4, or the detection reagent or kit according to claim 5 in marker-assisted breeding of Momordica grosvenori.

8. Use of the SNP marker according to any one of claims 1 to 3, the primer according to claim 4, or the detection reagent or kit according to claim 5 in Momordica grosvenori hybrid breeding.

9. A method for distinguishing female and male Momordica grosvenori plants, wherein: By detecting the SNP marker for distinguishing female and male Momordica grosvenori plants of the Momordica grosvenori to be tested, it is predicted that the Momordica grosvenori is a female plant or a male plant, wherein the SNP marker is the SNP marker according to any one of claims 1 to 3.

10. The method according to claim 9, wherein: include, Extracting genomic DNA of the tested monk fruit; Using the genomic DNA of the tested monk fruit as a template, PCR amplification is performed using the primers described in claim 4 to obtain a PCR amplification product; Detect the PCR amplification product. If the alleles at the diploid S position of the amplification product sequence are G and C, the Momordica grosvenori is a male plant; when the alleles at the diploid S position of the Momordica grosvenori are C and C, the Momordica grosvenori is a female plant.

Images