Preparation and application of botulinum toxin receptor binding domain probe molecule

Abstract

Neuroendocrine tumors (NETs) are highly heterogeneous tumors derived from neuroendocrine cells. The synaptic vesicle 2 (SV2) protein is a novel marker of NETs, and is also a protein receptor of BoNT / A. The BONT / A is directly combined with extracellular maximum lumen rings (L4) of SV2A, SV2B and SV2C through a C-terminal receptor binding domain of the BONT / A so as to enter neurons. The method comprises the following steps: constructing a recombinant botulinum toxin type A receptor binding domain plasmid vector by adopting a gene technology, transforming escherichia coli, carrying out induced expression and purification to obtain a botulinum toxin type A receptor binding domain, marking the botulinum toxin type A receptor binding domain by adopting fluorescein, chemical toxin small molecules or nuclide, preparing probe molecules, and detecting the botulinum toxin type A receptor binding domain. The result can specifically bind to neuroendocrine tumor cells. The invention provides a preparation method of a botulinum toxin A receptor binding domain probe molecule. The probe molecule can be used for preparing a preparation for diagnosing and treating neuroendocrine tumors.

Description

Technical Field

[0001] The invention belongs to the field of medical technology and provides a recombinant SV2 receptor binding domain protein of a botulinum toxin type A heavy chain, which is used in preparing a neuroendocrine tumor nuclear imaging probe molecule and a radioactive drug targeting a neuroendocrine tumor. Background Art

[0002] Radiopharmaceuticals are an important part of nuclear medicine. They are widely used in the diagnosis and treatment of cancer, myocardial imaging and diagnosis of heart diseases, and status monitoring of neurodegenerative diseases. Radiopharmaceuticals can be divided into diagnostic radiopharmaceuticals and therapeutic radiopharmaceuticals according to their uses. Diagnostic radiopharmaceuticals can be further divided into single-photon radiopharmaceuticals and positron radiopharmaceuticals. They can be combined with single-photon emission computed tomography (SPECT) or positron emission tomography (PET) to study the function and metabolic process of drugs in vivo at the molecular level, and achieve rapid, non-destructive and real-time imaging of physiological and pathological processes, providing new methods and means for early diagnosis and timely treatment in the true sense, and providing a possible path for the realization of preventive medicine, translational medicine and personalized medicine [1].

[0003] Neuroendocrine tumors (NETs) consist of a range of malignant tumors that may originate from neuroendocrine cells throughout the body. These tumors are characterized by their ability to produce peptides that lead to characteristic hormonal syndromes. The disease is characterized by excessive secretion of neurotransmitters and hormones, causing clinical symptoms such as skin flushing, rash, diarrhea, and heart failure. Neuroendocrine tumors occur in many parts of the human body. Neuroendocrine cells can form neuroendocrine tumors in many organs. Female patients are more likely to develop primary tumors in the lungs, stomach, appendix, or cecum, while male patients are more likely to develop primary tumors in the thymus, duodenum, pancreas, jejunum / ileum, or rectum. The prognosis and mortality of patients depend on the degree of differentiation of NETs. The median life expectancy of patients with poorly differentiated malignant tumors is less than 1 year [2].

[0004] Neuroendocrine tumors can be divided into two categories based on whether the substances secreted by the tumor can cause typical clinical symptoms: functional and non-functional. Functional neuroendocrine tumors often show symptoms caused by excessive secretion of tumor-related substances, while non-functional neuroendocrine tumors do not cause corresponding clinical manifestations even if the concentration of hormones or peptides increases. Due to the lack of typical clinical manifestations, it is often difficult to detect in the early stage. Patients often come to the hospital for treatment because the tumor is large and can cause a mass in the abdomen or because of complications caused by the tumor. When they come to the hospital for treatment, metastasis has often occurred. Therefore, somatostatin receptor imaging (SRI) is often used clinically to clearly locate the tumor. However, studies have shown that some patients have negative somatostatin receptor imaging, which makes somatostatin receptor imaging have certain defects. Therefore, more effective NETs nuclear imaging molecular probes are urgently needed in clinical practice to more accurately determine the size of NETs and their metastatic lesions [3].

[0005] Botulinum toxins (BoNTs) have seven subtypes, of which botulinum toxin type A (BoNT / A) is the most deadly of all known biological substances, with a toxicity of about one million times that of cobra toxin. Although BoNT / A has become a threat to biological warfare due to its deadly toxicity, its biological activity also makes it widely used in various beauty industries and medical treatments. BoNT / A contains a light chain (LC) of about 50 kDa and a heavy chain (HC) of about 100 kDa connected by a disulfide bond. LC is a metalloprotease that can cleave proteins of the soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) complex and block synaptic vesicle exocytosis. HC is further divided into two functional domains: the C-terminal receptor binding domain (HCR) that is mainly responsible for endocytosis and transport, and the N-terminal pore-forming domain (HCN) that allows LC translocation. The intoxication of BoNTs can be summarized in three steps: i) HCR binds to the cell membrane and is internalized into the endocytic compartment; ii) the HCN domain forms a channel in the endocytic vesicle membrane; iii) LC translocates to the cytosol through HCN, separates from HC and targets SNARE proteins, blocking synaptic vesicle release [4,5].

[0006] Synaptic vesicle 2 (SV2) protein is abundantly expressed in NET tissues and has been identified as a novel marker for NETs. 2+Triggered external osmotic regulator, there are three different subtypes (SV2A / B / C). Botulinum toxin type A and SV2A / C have high affinity activity [6-8]. BoNT / A binds to SV2 to form a BoNT / A-SV2 complex. After translocation to the cytoplasm, BoNT / A cuts a specific site of synaptosome-associated protein-25 (SNAP-25), preventing the assembly of the synaptic fusion complex SNARE, thereby blocking exocytosis. Since exocytosis plays an important role in regulating external messenger interactions and internal signaling, in cancerous tumors, SV2 may promote cellular mechanisms of antigen processing and presentation to evade the immune system. In cancer, SV2 may also be involved in regulating membrane markers, transdifferentiation and tumor angiogenesis, and inhibiting cell apoptosis [9]. BoNT / A enters neurons directly through its C-terminal receptor binding domain binding to the largest luminal loop (L4) of SV2A, SV2B and SV2C.

[0007] Literature reports that the HCR domain of recombinant BoNT / A can specifically bind to neuroendocrine tumor cells that highly express SV2 receptors and can be internalized into tumor cells. When the chemical small molecule toxin MMAE is coupled to BAHCR, it can carry small molecule toxins into neuroendocrine tumor cells and significantly reduce the volume of tumor tissue

[10] . However, the defect of the existing technology is that mammalian CHO cells are used to express BAHCR, which makes its production cost high and the accessibility of drugs poor.

[0008] The present invention utilizes genetic engineering technology to reconstruct the HCR of wild-type BoNT / A into pET-28 a+ , transform Escherichia coli BL21 (DE3), induce expression with IPTG, and obtain high-purity BAHCR by two-step ion exchange chromatography. The method for preparing the BAHCR probe molecule precursor of the present invention has low cost, short production cycle, and strong drug accessibility.

[0009] The SV2 receptor binding domain HCR of the recombinant botulinum toxin type A heavy chain provided by the present invention is used as a ligand targeting the SV2 target of neuroendocrine malignancies, and can be used by conventional methods using nuclides 68 Ga, 99 Tc, 131 I, 89 Zr, 111 In, 90 Y, 18F etc. to make it a nuclear imaging probe molecule or a nuclear medicine molecule with therapeutic effect; it can also be coupled with chemical toxin small molecules such as auristatin, maytansine and its analogs, calicheamicin, duocarmycins, anthracyclines, pyrrolobenzodiazepine dimers, amatoxin and quinoline alkaloid (SN-38) to make it a BAHCR chemical toxin molecule conjugate; it can also be labeled with fluorescein to make it a fluorescent imaging probe molecule as a research tool for studying neuroendocrine tumors.

[0010] References

[0011] [1] Wang Zheng, Xu Jianfeng, Cai Yuting, Dai Juan, Li Shihong, Luo Zhigang. Current status and development trend of radiopharmaceuticals in China[J]. China Food and Drug Administration, 2018(07):44-49.

[0012] [2] Massironi S, Rossi RE, Casazza G, Conte D, Ciafardini C, Galeazzi M, et al. Chromogranin A in diagnosing and monitoring patients with gastroenteropancreatic neuroendocrine neoplasms: a large series from a singleinstitution. Neuroendocrinology. 2014; 100:240-9.

[0013] [3] Lu Tingting, Wang Xiaohui, Yang Guoren, Huo Zongwei. (99) The diagnostic value of Tcm-octreotide SPECT / CT imaging for neuroendocrine tumors. Chinese Journal of Oncology Prevention and Treatment, 2020, 27(21): 74-78.

[0014] [4] Luis Solabre Valois et al. Endocytosis, trafficking and exocytosis of intact full-length botulinum neurotoxin type a in cultured rat neurons [J]. Neurotoxicology, 2020, 78(C): 80-87.

[0015] [5]Kathryn Turton and John A Chaddock and K.Ravi Acharya.Botulinumand tetanus neurotoxins:structure,function and therapeutic utility[J].Trendsin Biochemical Sciences,2002,27(11):552-558.

[0016] [6]Portela-Gomes GM,Lukinius A,Grimelius L.Synaptic vesicle protein2,A new neuroendocrine cell marker.Am J Pathol.2000;157:1299-309.

[0017] [7]Jakobsen AM,Ahlman H,Wangberg B,Kolby L,Bengtsson M,NilssonO.Expression of synaptic vesicle protein 2(SV2)in neuroendocrine tumours ofthe gastrointestinal tract and pancreas.J Pathol.2002;196:44-50.

[0018] [8]Nilsson O,Jakobsen AM,Kolby L,Bernhardt P,ForssellAronsson E,Ahlman H.Importance of vesicle proteins in the diagnosis and treatment ofneuroendocrine tumors.Ann N Y Acad Sci.2004;1014:280-3.

[0019] [9]Bandala C et al.Botulinum neurotoxin type A inhibits synapticvesicle 2expression in breast cancer cell lines.[J].International journal of clinical and experimental pathology,2015,8(7):8411-8.

[0020]

[10] Whitt J, Hong WS, Telange RR, et al. Non-toxic fragment of botulinumneurotoxin type A and monomethyl auristatin E conjugate for targeted therapy for neuroendocrine tumors. Cancer Gene Ther. 2020; 27(12):898-909. Summary of the invention

[0021] The present invention aims to provide a method for preparing a recombinant botulinum toxin type A heavy chain SV2 receptor binding domain protein BAHCR probe molecule and its application in preparing a neuroendocrine tumor nuclear imaging probe molecule and a radioactive drug or toxin-coupled therapeutic drug targeting a neuroendocrine tumor.

[0022] The present invention constructs pET-28 a+ -BAHCR recombinant plasmid, outsourced to GeneWeiZhi Company for sequencing, after sequencing results are correct, it will be transformed into pET-28 in BL21(DE3) competent cells a+-BAHCR strains were inoculated into LB medium at 1%, cultured at 37°C until OD600nm value was about 0.6, IPTG was added at a final concentration of 0.4mmol / L, and induced at 16°C for 20h. Binding Buffer was added to the harvested cells at 30 times their weight, the cells were broken by homogenizer, 10% TritonX-100 was added, the cells were allowed to stand at 4°C for 30min, and centrifuged at 10000rpm for 10min. The supernatant was purified by DEAE column, flow rate 1.5mL / min, 20 times column volume balance, Binding Buffer: 20mM PB, pH 7.4; Elution Buffer 1: 20mM PB, pH7.4, 100mM NaCl; Elution Buffer 2: 20mM PB, pH7.4, 300mM NaCl; Elution Buffer 3: 20mM PB, pH7.4, 500mM NaCl. The target protein exists in the flow-through sample. The flow-through sample is taken and purified by CM column, balanced with 20 times column volume, Binding Buffer and Elution Buffer are the same as DEAE column conditions, and the target protein can be eluted with 100mM NaCl.

[0023] The purified protein was dialyzed, and the buffer was replaced with 0.1M NaHCO3 solution. According to the protein: dye molar ratio = 1:20-50, Super Flour 680SE dye solution was slowly added to 1mL of protein solution for labeling, and slowly stirred at room temperature in the dark for 1 hour. The labeled protein solution was purified by Sephadex G25 column, eluted with PBS solution, and the eluted labeled protein solution was collected according to the reading of the UV detector.

[0024] The labeled BAHCR protein solution was co-incubated with Neuro-2a cells to verify its cell targeting. Most of the labeled protein bound to the receptors on the Neuro-2a cell membrane, so red fluorescence could be observed on the cell membrane, while the labeled irrelevant protein BSA did not bind to Neuro-2a cells and no fluorescence was observed. As a fluorescent probe molecule, BAHCR can be a research tool for studying neuroendocrine tumors.

[0025] In addition, different nuclides can be used to label the SV2 receptor binding domain protein of the recombinant botulinum toxin type A heavy chain. The nuclide-labeled BAHCR protein can become a nuclear imaging probe molecule or a nuclear medicine molecule with therapeutic effects, which can be understood by those skilled in the art. Generally, 89 Zr, 68 Ga, 99 Tc, 111 In, 90Nuclides such as Y are labeled with BAHCR through bifunctional chelators such as DOPA, DTPA, and HYNIC; 18 F by first synthesizing 18 F precursor molecule to label BAHCR; 131 I was labeled with BAHCR by the chloramine T method.

[0026] The toxin molecules are coupled to BAHCR by conventional chemical methods. The BAHCR protein coupled with toxin small molecules can become a nuclear medicine molecule with therapeutic effects, which can be understood by technicians in the same field. Such toxin small molecules include: microtubule generation inhibitors such as auristatin, maytansine and its analogs; DNA damaging factors such as calicheamicin, duocarmycins, anthracyclines, pyrrolobenzodiazepine dimers; DNA transcription inhibitors such as amatoxin and quinoline alkaloid (SN-38).

[0027] The present invention provides a method for preparing a BAHCR probe molecule of the SV2 receptor binding domain protein of a recombinant type A botulinum toxin heavy chain. The method uses Escherichia coli as a receptor cell, and the expression product is purified by only two steps of ion exchange chromatography to obtain the target probe molecule, which is then coupled to a fluorescent molecule, a chemical toxin molecule or a radionuclide molecule by conventional chemical methods, and is used in the preparation of scientific research tools, diagnostic drugs or therapeutic drugs in the field of neuroendocrine tumors. The beneficial effect of the present invention is that the process for preparing the BAHCR probe molecule is simple and the preparation cost is greatly reduced compared to using mammalian CHO as a receptor cell system. In addition, compared to also using Escherichia coli as a receptor cell system, the present invention uses a conventional purification method instead of affinity chromatography, and also obtains the beneficial effect of greatly reducing the preparation cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 .pET-28 a+ -BAHCR recombinant protein induction results. In the figure, M is the Protein Ladder, Lane 1 is the uninduced sample, and Lane 2 is the induced sample;

[0029] Figure 2 .The results of purification of the supernatant of the lysis solution induced by BAHCR E. coli by DEAE anion exchange chromatography. In the figure, M is the protein ladder, lane 1 is the precipitate sample after centrifugation of the lysis solution, lane 2 is the pre-column sample of the supernatant of the lysis solution, lane 3 is the chromatography breakthrough sample, lane 4 is the wash sample, and lane 5 is the elution sample;

[0030] Figure 3 .by Figure 2 The results of purification of the mid-stream sample as the pre-column sample loading sample by CM cation exchange chromatography. In the figure, M is the protein ladder, and lane 1 is Figure 2 The penetration sample in the sample is used as the loading sample, lane 2 is the penetration sample of the cation chromatography, lane 3 is the wash sample, lane 4 is the elution peak Elution 1 sample, lane 5 is the elution peak Elution 2 sample, lane 6 is the elution peak Elution 3 sample, and the target protein is mostly in Elution 1;

[0031] Figure 4 . SDS-PAGE results of BAHCR labeled with fluorescent dye SF-680SE and desalted samples. In the figure, M is ProteinLadder, lane 1 is the undesalted sample, lane 2 is an empty lane, lane 3 is the labeled BAHCR eluted sample 1, lane 4 is the labeled BAHCR eluted sample 2, and lane 5 is the labeled BAHCR eluted sample 3.

[0032] Figure 5 .Fluorescence microscopy observation results of SF-680SE-labeled BAHCR binding to Neuro-2a cells. Specific embodiments

[0033] Example 1 Expression and purification of the SV2 receptor binding domain protein of the recombinant botulinum toxin type A heavy chain

[0034] 1.1 Materials

[0035] 2×Hieff Gold PCR Master Mix high-fidelity enzyme premix (Shanghai Yisheng Biotechnology Co., Ltd., catalog number 10149ES03), agarose (Shanghai Yisheng Biotechnology Co., Ltd., catalog number 10208ES60), low melting point agarose (Shanghai Yisheng Biotechnology Co., Ltd., catalog number 10214ES60), nucleic acid dye (Shanghai Yisheng Biotechnology Co., Ltd., catalog number 10202ES76), 1kb DNA ladder (Shanghai Yisheng Biotechnology Co., Ltd., catalog number 10510-A), 6×DNA loading buffer (Shanghai Yisheng Biotechnology Co., Ltd., catalog number 10213ES08), SpeedyCut BamHI fast-cutting enzyme, EcoRI endonuclease, and NdeⅠ endonuclease were purchased from Shanghai Bioengineering Co., Ltd. SanPrep column DNA gel recovery kit (Shanghai Bioengineering Co., Ltd., catalog number B518131), SanPrep column plasmid DNA small-scale extraction kit (Shanghai Bioengineering Co., Ltd., catalog number B518191), ampicillin sodium (Shanghai Bioengineering Co., Ltd., catalog number A610028-0025), kanamycin sulfate (Shanghai Bioengineering Co., Ltd., catalog number A506636-0025), IPTG (Shanghai Bioengineering Co., Ltd., catalog number A600168-0025), and imidazole (Shanghai Bioengineering Co., Ltd., catalog number A600168-0025). No. A600277-0100), SDS (Sangon Biotechnology Co., Ltd., Catalog No. A600485-0100), Glycine (Sangon Biotechnology Co., Ltd., Catalog No. A610235-0005), Tris (Sangon Biotechnology Co., Ltd., Catalog No. A610195-0005), Coomassie Brilliant Blue R-250 (Sangon Biotechnology Co., Ltd., Catalog No. A610037), Sephadex G-25 Resin chromatography medium (Sangon Biotechnology Co., Ltd., Catalog No. C510060-0026), BL21 (DE3) Escherichia coli competent cells (Sangon Biotechnology Co., Ltd., Catalog No. B528414), Protein non-prestained Marker IV (Sangon Biotechnology Co., Ltd., Catalog No. C600525), T4 DNA Ligase (Beijing Bio-Rad Biotechnology Co., Ltd., Catalog No. 2011A), CM Sepharose TM Fast Flow (GE Healthcare, Catalog No. 56119117-EG), DEAE Sepharose TMFast Flow (GE Healthcare, Catalog No. 56119116-EG), Triton X-100, agar powder (Beijing Solebao Technology Co., Ltd., Catalog No. A8190), TEMED (Beijing Solebao Technology Co., Ltd., Catalog No. T8090), bromophenol blue (Beijing Solebao Technology Co., Ltd., Catalog No. B8120), sodium chloride, sodium hydroxide, sodium dihydrogen phosphate, sodium hydrogen phosphate, methanol, glacial acetic acid, and anhydrous ethanol were purchased from Tianjin Best Chemical Co., Ltd., tryptone (Thermo Fisher Scientific, Catalog No. LP0042B), yeast extract (Thermo Fisher Scientific, Catalog No. LP0021), ammonium persulfate (Beijing Jinming Biotechnology Co., Ltd., Catalog No. 7727-54-0), acrylamide (Beijing Jinming Biotechnology Co., Ltd., Catalog No. 79-06-1), N,N-methylenebisacrylamide (Beijing Jinming Biotechnology Co., Ltd., Catalog No. 110-26-9), M5 HiClear PrestainedPlus Protein Ladder (10-250 kDa) (Beijing Juhemei Biotechnology Co., Ltd., catalog number MF028-plus-01). pGEX-4T-1-BoNT / A WT (complete gene synthesis by Genewise Biotechnology Co., Ltd.).

[0036] 1.2 Implementation steps

[0037] 1.2.1 pET-28 a+ -BAHCR plasmid construction

[0038] Design upstream and downstream PCR primers, BAHCR-F:

[0039] GGAATTCCATATGATTATCAACACCAGCATTCTCAAC; BAHCR-R: CCGGAATTCTTACAGCGGGCGTTCGCCCCAACC, these two primers were used to amplify the BoNT / A-HCR sequence from the pGEX-4T-1-BoNT / A WT plasmid. The addition of reactants to the PCR reaction is shown in Table 1, and the reaction procedure is shown in Table 2. The BoNT / A WT (GenBank: AF461540.1) gene in the pGEX-4T-1-BoNT / A WT plasmid was cloned into pGEX-4T-1 by full gene synthesis from GENEWISE, and BAHCR was optimized for E. coli preferred codons, and the sequence is Seq ID No: 1.

[0040] Table 1 PCR system

[0041]

[0042]

[0043] Table 2 PCR amplification program

[0044]

[0045] According to the instructions of the supplier, the PCR product was double-digested with EcoR I and Nde I, and the double-digested product fragment was obtained by gel recovery and purification. Then, the double-digested PCR product was combined with pET-28 a+ The vector was connected at a molar ratio of vector: fragment = 1:10 at 16°C overnight to obtain the recombinant plasmid pET-28. a+ -BAHCR.

[0046] The competent Escherichia coli BL21 (DE3) was transformed by conventional heat shock transformation method, spread on LB plates containing 80 μg / mL kanamycin, and cultured at 37°C overnight. The positive clones grown on the plates were picked, and the plasmids were extracted using a small plasmid extraction kit according to the instructions of the kit. The clones whose target gene sequences were consistent with the theoretical sequences were selected, and the single clones were picked and inoculated into 50 mL LB liquid culture medium containing 80 μg / mL kanamycin, and cultured at 37°C overnight. The strains were preserved in a -80°C ultra-low temperature refrigerator with 15% glycerol.

[0047] 1.2.2 pET-28 a+ -BAHCR protein expression

[0048] Take out the strain from the -80℃ ultra-low temperature freezer, inoculate 5μL into 20mL LB liquid medium containing 80μg / mL kanamycin, and culture at 37℃ overnight to obtain the strain. a+ -BAHCR BL21 (DE3) strains were inoculated into LB medium containing 80 μg / mL kanamycin at 1%, cultured at 37°C until the OD600 value was about 0.6, uninduced samples were taken, IPTG was added to a final concentration of 0.4 mmol / L, induced at 16°C for 20 h, and induced samples were taken. Uninduced samples and induced samples were centrifuged and prepared for SDS-PAGE electrophoresis to detect pET-28 a+ -BAHCR protein expression. Figure 1 The induced sample has an obvious induced band at about 45 kDa, which is consistent with the theoretical size of BaHCR.

[0049] 1.2.3 pET-28 a+ Purification of -BAHCR

[0050] Add 30 times the weight of Binding Buffer to the bacteria, use a homogenizer to break the bacteria, add 10% Triton X-100 to a final concentration of 1%, let stand at 4°C for 30 minutes, and centrifuge at 10000rpm for 10 minutes. Take the supernatant and purify it by DEAE anion exchange chromatography. The chromatography column uses the equilibration buffer Binding buffer to equilibrate 20 times the column volume. The Binding Buffer formula is: 20mM PB, pH 7.4; the elution buffer contains different concentrations of NaCl for step-by-step gradient elution. The elution buffer formula is: Elution Buffer 1: 20mM PB, pH7.4, 100mM NaCl; Elution Buffer 2: 20mMPB, pH7.4, 300mM NaCl; Elution Buffer 3: 20mM PB, pH7.4, 500mM NaCl. The target protein BAHCR is present in the flow-through sample. The results are shown in Figure 2 The flow-through sample from the previous step was purified by CM cation exchange chromatography. The column was equilibrated with 20 column volumes of Binding buffer. The Binding Buffer and Elution Buffer of this step of chromatography were the same as those of the DEAE column. The target protein BAHCR was present in the elution fraction Elution 1. The results are shown in Figure 3 .

[0051] The present invention uses a buffer of pH 6.0 to 8.0, and after the above two-step chromatography, a purification effect that is almost the same can be obtained. The present invention uses a PB buffer prepared with sodium dihydrogen phosphate and disodium hydrogen phosphate. Other buffers within the buffer range of 6.0 to 8.0 required by the present invention, such as Tris-HCl, HEPES, etc., can obtain the same purification effect, which can be understood by those skilled in the art.

[0052] The N-terminus of the BAHCR of the present invention is fused with a His6 tag, but the target cannot be captured by nickel ion affinity chromatography. Surprisingly, the target can be captured by affinity filler by harvesting the flow-through sample after DEAE anion exchange chromatography and then using nickel ion affinity chromatography. Considering that affinity chromatography fillers are expensive and it is necessary to design a protease cleavage site to remove the affinity tag, the present invention adopts a method of using anion flow-through samples as pre-column samples and further using cation exchange chromatography to capture and purify, and obtains unexpected results.

[0053] The N-terminus of the BAHCR obtained in the present invention contains a His6 tag, and there is a thrombin cleavage site between the tag and the N-terminus of the target. The His6 tag can be conveniently removed by thrombin, and then the His6 tag can be removed by ultrafiltration purification. Alternatively, the target protein can be directly connected to the expression vector by seamless cloning connection in the upstream design, and expressed in a tag-free manner, which can be understood by technicians in the same field.

[0054] Example 2 SF-680SE marked HCR

[0055] Protein dissolution: Use a concentrator tube to replace the buffer of the BAHCR protein solution with 0.1M NaHCO3 to adapt to the requirements of the labeling system.

[0056] Dye dissolution: After the activated Super Flour SE dye solid powder is placed in a desiccator from the refrigerator and slowly warmed to room temperature, the dye is prepared with anhydrous DMSO to a concentration of 1 mg / mL.

[0057] Labeling: Slowly add an appropriate amount of dye solution (protein: dye molar ratio = 1:20-50; the mass ratio can be optimized within the following range: 10-200 μg Super Flour SE per mg IgG antibody) to 1 mL of BAHCR protein solution, and slowly stir for 1 hour at room temperature in the dark. In this step, the same labeling effect can be obtained by directly adding the protein solution directly to the reagent bottle of the solid powder of the dye and slowly stirring for 1 hour at room temperature in the dark.

[0058] Purification: The product was purified using Sephadex G25.

[0059] 8 mL of dextran Sephadex G25 filler was filled, and PBS solution was used for balance. Then the labeled BAHCR protein solution was purified through Sephadex G25 column to wash away the excess fluorescent probe not labeled on BAHCR. The labeled protein solution was eluted with PBS solution, and the eluted components were collected in sections according to the reading of the UV detector. The results were detected by SDS-PAGE. Figure 4 BAHCR-Super Flour SE was eluted from the chromatography column first, and the purified component elution sample 1 with high concentration was collected for later use.

[0060] Example 3 HCR-SF-680SE fluorescent probe molecule specifically binds to N2a cells

[0061] Take out the frozen N2a cell line from liquid nitrogen, and thaw it as quickly as possible by shaking rapidly in a constant temperature water bath at 37°C, following the correct principle of "slow freezing and fast thawing" for cell recovery. Transfer the cell freezing solution (about 1mL) in the cryopreservation tube to a 5mL centrifuge tube, add 2mL of conventional cell culture medium, mix well by blowing, and centrifuge at a low speed of 900r / min for 3min. After centrifugation, remove the supernatant, add 1mL of conventional cell culture medium to blow N2a cells, mix well, and use the pipette to absorb the cell suspension into a 10cm diameter culture dish containing 12mL of cell culture medium. After gently shaking left and right, the suspension can be placed in a cell culture incubator with a concentration of 5% CO2, 90% humidity, and a constant temperature of 37°C for culture.

[0062] When the cells grow to about 80% fusion, they can be passaged. Use a pipette to suck the old culture medium into the waste bottle. After washing the cultured cells 2-3 times with 2 mL of sterile PBS solution, add 1 mL of 0.25% pancreatin to digest the cells. Note that you can hit the pancreatin on the wall of the culture dish to let it flow down to avoid damaging the cells. Carefully shake the culture dish to disperse the pancreatin evenly on the surface of the cells to be digested. Then place the digesting culture dish in the cell culture incubator for 1-2 minutes. Use a pipette to inject 1 mL of culture medium containing fetal bovine serum to neutralize the digestion effect of pancreatin. Use a pipette to blow the cells carefully. After digestion is complete, it can be blown down easily. Use a pipette to suck the cell digestion solution into a 10 mL centrifuge tube and centrifuge the cell suspension at 900 r / min for 3 minutes. After centrifugation, the supernatant was removed by aspiration, and the cells were resuspended in 1 mL of culture medium. After careful pipetting and mixing of the cells, the cell suspension was transferred to a 10 cm diameter culture dish containing 12 mL of cell culture medium at a ratio of 1:4.

[0063] At the same time as cell passage, N2a cells were plated on 24-well plates at 10 cells per well. 5 Labeled BAHCR-Super Flour SE was added to each well to a final concentration of 2 μM, and the cells were incubated overnight. The binding of N2a cells and labeled BAHCR-Super Flour SE was observed under a laser confocal microscope. Figure 5It is shown that most of the labeled proteins bind to the receptors on the N2a cell membrane, so red fluorescence can be observed on the cell membrane, while the labeled irrelevant protein BSA-SuperFlour SE does not bind to the N2a cells, and no fluorescence is observed. The BAHCR provided by the present invention can be used as a fluorescent probe molecule to study neuroendocrine tumors. Generally, according to research needs, BAHCR can be coupled with any other fluorescent probe according to the method provided by the dye supplier, which is understandable to those skilled in the art.

[0064] Obviously, 89 Zr, 68 Ga, 99 Tc, 111 In, 90 Nuclides such as Y are labeled with BAHCR through bifunctional chelators such as DOPA, DTPA, and HYNIC; 18 F by first synthesizing 18 F precursor molecule to label BAHCR; 131 I BAHCR is labeled by chloramine T method. The SV2 receptor binding domain BAHCR of the recombinant botulinum toxin type A heavy chain is labeled with a nuclide. The nuclide-labeled BAHCR can become a nuclear imaging probe molecule or a nuclear medicine molecule with therapeutic effects, which can be understood by those skilled in the art.

[0065] The toxin molecules are coupled to BAHCR by conventional chemical methods. The BAHCR protein coupled with toxin small molecules can become a nuclear medicine molecule with therapeutic effects, which can be understood by technicians in the same field. Such toxin small molecules include: microtubule generation inhibitors such as auristatin, maytansine and its analogs; DNA damaging factors such as calicheamicin, duocarmycins, anthracyclines, pyrrolobenzodiazepine dimers; DNA transcription inhibitors such as amatoxin and quinoline alkaloid (SN-38).

[0066] The nucleotide sequence involved in the present invention is:

[0067] Seq ID No:1

[0068] BoNT / A HCR

[0069] ATGATTATCAACACCAGCATTCTCAACCTCCGTTATGAGAGCAATCATCTGATCGATCTG

[0070] AGCCGCTACGCGAGCAAAATCAACATCGGCAGCAAAGTTAATTTCGATCCGATTGATA

[0071] AGAACCAGATTCAGCTGTTTAATCTGGAGAGCAGTAAGATCGAAGTGATCCTCAAGAA

[0072] CGCGATCGTTTACAATAGCATGTACGAAAACTTTAGTACCAGCTTCTGGATTCGCATCC

[0073] CGAAGTACTTTATAGCATTAGCCTCAATAACGAATACACCATCATCAACTGCATGGAA

[0074] AATAATAGCGGCTGGAAGGTTAGTCTGAACTATGGCGAGATCATTTGGACCCTCCAAGA

[0075] TACCCAAGAAATCAAACAACGCGTGGTGTTTAAATAGCCAAATGATCAACATTAGCG

[0076] ATTATATCAACCGCTGGATCTTCGTGACCATCACGAACAACCGTCTGAATAATAGCAAG

[0077] ATTTACATCAACGGTCGTCTGATCGATCAGAAGCCGATCAGCAACCTCGGTAACATTCA

[0078] CGCCAGCAATAACATTAGTTTAAGCTCGACGGCTGCCGTGACACCCACCGCTACATCT

[0079] GGATTAAATACTTCAATCTGTTTGATAAGGAACTGAACGAAAAAGAAATCAAAGATCT

[0080] GTATGACAACCAGAGCAACAGTGGCATCCTCAAGGACTTCTGGGGCGACTATCTCCAG

[0081] TACGATAAGCCGTACTATATGCTCAATCTCTATGACCCGAACAAATACGTTGACGTGAA

[0082] CAACGTGGGCATTCGCGGCTACATGTACCTCAAAGGTCCGCGCGGCAGTGTGATGACG

[0083] ACGAACATCTATCTGAACAGCAGCCTCTATCGCGGTACCAAATTCATCATCAAGAAATA

[0084] CGCCAGTGGTAATAAAGACAACATCGTGCGCAACAATGATCGCGTTTATATCAACGTGG

[0085] TGGTGAAGAATAAAGAATACCGTCTGGCGACCAACGCGAGCCAAGCCGGCGTTGAGA

[0086] AAATTCTGAGCGCGCTGGAAATCCCAGATGTGGGCAATCTCAGTCAAGTTGTGGTGAT

[0087] GAAGAGTAAGAATGACCAAGGCATCACCAATAAGTGTAAAATGAACCTCCAAGATAAC

[0088] AACGGCAACGACATTGGCTTCATCGGTTTCCACCAATTCAACAATATCGCGAAGCTGGT

[0089] TGCGAGCAATTGGTACAATCGCCAGATCGAGCGTAGCAGCCGCACGCTCGGTTGCAGT

[0090] TGGGAATTTATCCCGGTGGATGATGGTTGGGGCGAACGCCCGCTGTAA

[0091] The protein sequence related to the present invention:

[0092] Seq ID No:2

[0093] BoNT / A HCR

[0094] MIINTSILNLRYESNHLIDLSRYASKINIGSKVNFDPIDKNQIQLFNLESSKIEVILKNAIVYNSMYENFSTSFWIRIPKYFNSISLNNEYTIINCMENNSGWKVSLNYGEIIWTLQDTQEIKQRVVFKYSQMINISDYINRWIFVTITNNRLNNSKIYINGRLIDQKPISNLGNIHASNNIMFKLDGCRDTHRYIWIKYFNLFDKELNEKEIKDLYDNQSNSGILKDFWGDYLQYDKPYYMLNLYDPNKYVDVNNVGIRGYMYLKGPRGSVMTTNIYLNSSLYRGTKFIIKKYASGNKDNIVRNNDRVYINVVVKNKEYRLATNASQAGVEKILSALEIPDVGNLSQVVVMKSKNDQGITNKCKMNLQDNNGNDIGFIGFHQFNNIAKLVASNWYNRQIERSSRTLGCSWEFIPVDDGWGERPL*。

Claims

1. A preparation of a probe molecule of the SV2 receptor binding domain of a recombinant botulinum toxin type A heavy chain, characterized in that The protein sequence of the probe molecule is Seq ID No:

2.

2. The preparation of a probe molecule of the SV2 receptor binding domain of a recombinant botulinum toxin type A heavy chain according to claim 1, characterized in that The host of the probe molecule is Escherichia coli.

3. The preparation of a probe molecule of the SV2 receptor binding domain of a recombinant botulinum toxin type A heavy chain according to any one of claims 1 to 2, characterized in that The probe molecule is purified by collecting the flow-through component using anion exchange as the pre-column sample of the second step chromatography, and the second step uses cation exchange chromatography to bind the target probe molecule.

4. The preparation of a probe molecule of the SV2 receptor binding domain of a recombinant botulinum toxin type A heavy chain according to any one of claims 1 to 3, characterized in that The pH of the probe molecule purification buffer is 6.0 to 8.

0.

5. The preparation of a probe molecule of the SV2 receptor binding domain of a recombinant botulinum toxin type A heavy chain according to any one of claims 1 to 4, characterized in that The probe molecule is coupled to any fluorescent probe molecule using conventional methods.

6. The preparation of a probe molecule of the SV2 receptor binding domain of a recombinant botulinum toxin type A heavy chain according to any one of claims 1 to 4, characterized in that The probe molecule is coupled to any nuclide molecule by conventional methods, and the nuclide molecule is selected from any one of the following: 68 Ga, 99 Tc, 131 I, 89 Zr, 111 In, 90 Y, 18 F.

7. The preparation of a probe molecule of the SV2 receptor binding domain of a recombinant botulinum toxin type A heavy chain according to any one of claims 1 to 4, characterized in that The probe molecule is coupled to any chemical toxin molecule by conventional methods, and the chemical toxin molecule is selected from any one of the following: auristatin, maytansine and its analogs, calicheamicin, duocarmycins, anthracyclines, pyrrolobenzodiazepine dimers, amatoxin, and quinoline alkaloid (SN-38).

8. A recombinant botulinum toxin type A heavy chain SV2 receptor binding domain probe molecule, which can be used in the preparation of neuroendocrine tumor nuclear imaging probe molecules.

9. A probe molecule of the SV2 receptor binding domain of a recombinant botulinum toxin type A heavy chain, which can be used in the preparation of radioactive drugs or chemical toxin small molecule conjugated drugs targeting neuroendocrine tumors.

10. A recombinant botulinum toxin type A heavy chain SV2 receptor binding domain probe molecule, which can be used in the preparation of fluorescently labeled probe molecular tools targeting neuroendocrine tumors.

Images