Application of small molecule compound in preparation of ASFV E165R protein activity related disease drug or E165R protein activity inhibition reagent

Abstract

The invention discloses application of a small molecule compound in preparation of a medicine for treating diseases related to ASFV E165R protein activity or a reagent for inhibiting E165R protein activity, and belongs to the field of chemical drugs, the small molecule compound is Z423747092, and the molecular formula of the small molecule compound is C24H19ClN6O3. According to the present invention, based on the ASFV E165R protein crystal structure, the small molecule compound Z423747092 specifically bound with the ASFV E165R is obtained through the virtual screening technology; the small molecule compound ASFV E165R has high affinity, has no obvious cytotoxicity on the cellular level, has a remarkable inhibition effect on ASFV E165R protein activity at the concentration of 0.5-128 mu M, and has the potential of serving as an active ingredient of an African swine fever virus medicine.

Description

Technical Field

[0001] The present invention relates to the application of a small molecule compound in preparing a disease medicine related to ASFV E165R protein activity or a reagent for inhibiting the activity of the E165R protein, and belongs to the field of chemical medicines. Background Art

[0002] African swine fever (ASF) is an acute and severe infectious disease caused by African swine fever virus (ASFV) and characterized by fever and systemic bleeding in pigs. African swine fever is a notifiable animal disease required by the World Organization for Animal Health (OIE). my country's list of animal pathogenic microorganisms lists it as a Class I disease.

[0003] ASF was introduced to Europe in the 1950s, and it took 40 years to eliminate the disease from the whole of Europe. However, the disease was introduced into Georgia from East Africa again in 2007, and quickly spread to Eastern European countries, and was introduced into the Russian Far East in 2017. In August 2018, African swine fever was first discovered in Shenyang, my country. Within just one year, the disease spread to 30 provinces, municipalities and autonomous regions across the country, dealing a huge blow to my country's pig farming industry. Since there is still no vaccine and special treatment drug, once an African swine fever epidemic occurs, it can only be controlled by culling, but this method not only causes economic losses, but also cannot meet the needs of large-scale pig farming in my country. Therefore, how to effectively control the ASF epidemic is one of the huge challenges currently facing the world's pig farming industry, and it is also a major problem that needs to be urgently solved in my country's ASF prevention and control.

[0004] The E165R protein is a nonstructural protein encoded by ASFV that functions as deoxyuridine triphosphate enzyme (dUTPase). This protein can effectively reduce the concentration of deoxyuridine and provide substrates for thymidine synthase, thereby ensuring the integrity of DNA during viral replication. Since dUTPase is mainly present in actively dividing and differentiating cells, and porcine macrophages, which are mainly infected by ASFV, are resting cells and do not have dUTPase. Therefore, ASFV must rely on its own encoded E165R to ensure normal replication in porcine macrophages. The E165R protein is a homotrimeric dUTPase that contains five highly conserved motifs that exhibit active enzymatic sites with specific pyrophosphatase activity. In addition, E165R also contains a unique two-subunit active site and has extremely high tolerance to high temperatures. Cell high-throughput screening is a common method for finding anti-ASFV drugs. Although this method has a high accuracy rate, it is relatively expensive, and the targeting mechanism of the screened compounds is unclear, which may have side effects on host proteins. Compounds that directly target viruses are often virus-specific and exert their antiviral effects mainly by directly acting on viral proteins or viral genomes. However, drug research targeting the E165R protein of African swine fever virus is not common. Literature reports that compounds designed based on the active site of the ASFV E165R protein do not inhibit ASFV replication at the cellular level. Therefore, it is more meaningful to find compounds targeting E165R that can inhibit ASFV replication in cells. Summary of the invention

[0005] Purpose of the invention: The purpose of the present invention is to provide an application of a small molecule compound in the preparation of a drug for a disease related to the activity of the ASFV E165R protein or an agent for inhibiting the activity of the E165R protein.

[0006] Technical solution: The present invention provides an application of a small molecule compound in the preparation of a drug for a disease related to the activity of ASFV E165R protein or an agent for inhibiting the activity of E165R protein, wherein the small molecule compound is Z423747092, and its molecular formula is C 24 H 19 C1N 6 O 3 , the structural formula is:

[0007]

[0008] The IUPAC name of the small molecule is N-[5-(2-chlorophenyl)-4H-1,2,4-triazol-3-yl]-2-[4-methyl-4-(naphthalen-2-yl)-2,5-dioxoimid azolidin-1-yl]acetamide

[0009] Furthermore, the disease associated with E165R protein activity is African swine fever.

[0010] Furthermore, the concentration of the small molecule compound in the drug is 0.5 to 128 μM.

[0011] Furthermore, the drug also includes a pharmaceutically acceptable carrier, and the pharmaceutically acceptable carrier includes at least one of an excipient, a glidant, a diluent, a preservative, a colorant, a flavoring agent, a wetting agent, a suspending agent, a stabilizer, an isotonic agent, a solvent, and an emulsifier.

[0012] Furthermore, the dosage form of the drug is selected from any one of tablets, sprays, granules, capsules, oral solutions, injections, and suspensions.

[0013] The present invention also provides an anti-African swine fever virus drug, wherein the active ingredient in the drug is a small molecule compound Z423747092.

[0014] Furthermore, the concentration of the small molecule compound in the drug is 0.5 to 128 μM.

[0015] The present invention also provides a reagent for inhibiting the activity of E165R protein, wherein the active ingredient in the reagent is a small molecule compound Z423747092.

[0016] Furthermore, the concentration of the small molecule compound in the reagent is 0.5 to 128 μM.

[0017] Beneficial effects: Compared with the prior art, the present invention has the following outstanding advantages: Based on the crystal structure of ASFVE165R protein, the present invention obtains a small molecule compound Z423747092 that specifically binds to ASFV E165R through virtual screening technology. The small molecule compound ASFV E165R has a high affinity, no obvious cytotoxicity at the cellular level, and has a significant inhibitory effect on the activity of ASFV E165R protein at a concentration of 0.5 to 128 μM, and has the potential to be an active ingredient of African swine fever virus drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 : The docking results of the small molecule compound Z423747092 and ASFV E165R protein are displayed.

[0019] Figure 2: Expression, purification and identification of ASFV E165R protein; A is SDS-PAGE identification of the purification of ASFV E165R protein, wherein lane M is Protein Marker, lanes 1 and 2 are sample effluents, lane 3 is washing solution, and lanes 4, 5, 6, and 7 are purified proteins; B is Western Blot identification of the purification of ASFV E165R protein, wherein lane M is ProteinMarker, lanes 1 and 4 are pCold empty load controls, lanes 2 and 3 are recombinant bacterial lysates, and lanes 5 and 6 are E165R purified proteins.

[0020] Figure 3 :SPR affinity identification results of small molecule compound Z423747092 and ASFV E165R protein. Figure A is the sensor diagram of different concentrations of Z423747092 binding to E165R protein; Figure B is the fitting curve of different concentrations of Z423747092 binding to E165R protein. Among them, the vertical axis represents the signal value detected by the sensor; the horizontal axis represents the time of sample interaction in the sensor.

[0021] Figure 4 : The results of the identification of the cytotoxicity of compound Z423747092 on PAM cells detected by CCK-8 method.

[0022] Figure 5 : Standard curve of different concentrations of pyrophosphate and 575nm light absorption value.

[0023] Figure 6 : The enzyme activity inhibition experiment was used to determine the inhibitory effect of compound Z423747092 on the activity of African swine fever virus E165R protein.

[0024] Figure 7 : The inhibition rate of different concentrations of Z423747092 on the activity of African swine fever virus E165R protein. DETAILED DESCRIPTION

[0025] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0026] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt conventional techniques in the field of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields. These techniques are well described in the literature, see Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001; Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987 and periodic updates; the series METHODS IN ENZYMOLOGY, Academic Press, San Diego; Wolffe, CHROMATIN STRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998; METHODS IN ENZYMOLOGY, Vol. 304, Chromatin (P. M. Wassarman and A. P. Wolffe, eds.), Academic Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol. 304, Chromatin (P. M. Wassarman and A. P. Wolffe, eds.), Academic Press, San Diego, 1999. BIOLOGY, Vol. 119, Chromatin Protocols (PB Becker, ed.) Humana Press, Totowa, 1999, etc.

[0027] Example 1 Screening of small molecule compounds based on the E165R protein structure

[0028] Download the ASFV E165R structural data (PDB ID: 6LJ3) from the protein structure library, delete water molecules and other irrelevant molecules, and minimize the energy of the entire protein structure. With the help of AutodockVina software, 448,388 compounds in the Enamine Advanced drug database were virtually docked with the protein structure. The specific steps are as follows: integrate the EnamineAdvanced database compound format; set the center position of the box (Box) according to the E165R active site (X axis: -9.695, Y axis: 14.741, Z axis: -7.291), and set the box size to Remove the E165R water molecules, ligands, etc., import the structure into the binding site file, perform docking under the AutodockVina software, and screen for E165R inhibitors. The quality of the small molecule compounds is screened by the prediction results, and the small molecule compound with the highest score is selected as the candidate compound (Z423747092) for the next step of compound functional verification. The prediction results of the small molecule compound Z423747092 and the protein interaction model ( Figure 1 ).

[0029] Example 2 ASFV E165R protein expression and purification

[0030] (1) Construction of prokaryotic expression plasmid pCold-E165R

[0031] First, design primers with restriction sites for XhoⅠ and XbaⅠ:

[0032] Forward primer: 5'-ATGGAGCTCGGTACCCTCGAGATGGCAACAAATTTTTTTATTCAACC-3'

[0033] (SEQ ID NO: 1);

[0034] Reverse primer: 5'-agcagagattacctatctagaTTAAGTTCTCATAATCCCGGCC-3' (SEQ ID NO: 2).

[0035] Then, using the genome of the African swine fever virus CHINA / 2018 / AnhuiXCGQ strain as a template and the sequences of SEQ ID NO: 1 and SEQ ID NO: 2 as amplification primers, PCR amplified E165R (SEQ ID NO: 3: ATGGCAACAAATTTTTTTATTCAACCTATCACCGAAGAAGCTGAAGCATACTACCCACCTTCCGTGATAACGAATAAACGGAAGGACCTGGGGGTAGACGTATACTGTTGCTCCGACCTAGTGCTTCAACCTGGACTAAATATTGTTCGCCTGCATATTAAAGTAGCATGCGAACACATGGGCAAAAAATGCGGTTTTAAAATCATGGCGAGAAGCAGTATGTGCACCCATGAACGGCTGCTCATCCTTGCAAACGGAATTGGTTTAATAGACCCGGGT The E165R product and pCold vector (Cat. No. 3361, TAKARA) were double-digested and recovered, connected with C115 DNA ligase, transformed into DH5α, and coated with resistant LB solid medium for screening. Positive clones were picked for identification, and the prokaryotic expression plasmid pCold-E165R was obtained after sequencing (Qingke Biotech Co., Ltd.) correctly.

[0036] (2) Expression and purification of E165R protein

[0037] The prokaryotic expression plasmid pCold-E165R was transferred into the expression competent BL21. The monoclonal strain was selected and cultured in LB resistance medium at 37°C until OD = 0.6-0.8. 0.5mM IPTG was added to induce expression at 15°C. It was found that the E165R protein was expressed. The target protein was subjected to His affinity chromatography using a nickel column to obtain a high-purity E165R protein. The correctness of the target protein was confirmed by Western Blot ( Figure 2 ).

[0038] Example 3 Affinity Identification of Small Molecule Compound Z423747092 and Artificially Expressed E165R Protein (SPR)

[0039] Surface plasmon resonance (SPR) technology was used to determine the binding of the compound to the E165R protein. The instrument used in the experiment was Biacore T200, and the materials used in the experiment were: NTA sensor chip; E165R protein; compound Z423747092 (Shanghai Taoshu Biological Company); HBS buffer; NTAreagent kit; analytical grade DMSO.

[0040] The specific experimental steps are as follows:

[0041] (1) Nickel chelation chip surface: Inject a nickel solution pulse for 1 minute to saturate the NTA chip with nickel at a flow rate of 10 μL / min. Then wash with running buffer containing 3 mM EDTA.

[0042] (2) Protein coupling: E165R ligand solution was prepared with running buffer HBS at a concentration of 20 μg / mL. The recombinant E165R protein prepared in Example 2 was immobilized on the NTA chip by nickel ion coupling method, with Fc-2 as the test channel and Fc-1 as the reference channel.

[0043] (3) Preparation of running buffer and compound: The running buffer for compound Z423747092 was 1×HBS containing 5% DMSO. A 5% DMSO concentration calibration curve (4-8 gradient concentration points) was prepared using 4.5% and 5.8% calibration stock solutions. The compound was prepared into multiple gradient concentrations containing 5% DMSO using the half-dilution method. A repeat concentration was set at intervals and a zero concentration was added.

[0044] (4) Multi-cycle kinetics detection: Kinetics detection was performed in the LNW kinetics module. The analytes with gradient concentrations were placed on the sample rack, and channel Fc 2-1 was selected. The injection time was 60 s, the dissociation time was 120 s, and the flow rate was 30 μL / min for kinetic detection.

[0045] (5) Data analysis: Data analysis was performed using Biacore T200 Evaluation Software. First, solvent correction analysis was performed in the solvent correction module. The solvent correction curve is generally required to fall within -500 to +1000 RU, with two vertical lines falling within the correction curve range and the fitted Chi2 less than 2. Affinity fitting analysis was then performed in Kinetics / Affinity. Select Steady State Affinity in Affinity for fitting analysis to obtain affinity KD data.

[0046] The results showed that the equilibrium dissociation constant KD of the interaction between the small molecule compound Z423747092 and the artificially expressed ASFV E165R protein was 25.13 μM ( Figure 3 ).

[0047] Example 4 CCK-8 method to detect the cytotoxicity of compound Z423747092 at different concentrations on PAM cells

[0048] 1.5×10 5 PAM cells were inoculated into 96-well cell plates and cultured in a 37°C cell culture incubator. After the cells were completely attached, the small molecule compound Z423747092 was diluted in a gradient manner with 1640 medium containing 2% serum and added to the cells. Three replicate wells were set for each concentration. After culturing in a 37°C cell culture incubator for 48 hours, the cell culture medium was discarded under light-proof conditions, and 100 μL of serum-free 1640 medium and 10 μL of CCK-8 solution (Dongren Chemical Technology Co., Ltd.) were added to each well. After continuing to incubate in the cell culture incubator for 1 hour, the absorbance value at a wavelength of 450 nm was measured using an ELISA reader.

[0049] The results showed that the small molecule compound Z423747092 had a survival rate of more than 80% in PAM cells at a concentration of 100 μM and did not affect the survival of PAM cells ( Figure 4 ).

[0050] Example 5 Standard curve of different concentrations of pyrophosphate and 575nm light absorption value

[0051] Draw a standard curve of pyrophosphate according to Grindey's method, and dilute the prepared pyrophosphate into a 1mmol / L standard solution. Take 10 1.5mL enzyme-free centrifuge tubes, add pyrophosphate standard solution (1mmol / L) in a gradient from 0 to 90μL, add DEPC water to each tube to 800μL, and vortex for 30s. Add 50μL of molybdate reagent, 100μL of A solution (5g sodium bisulfite and 0.25g sodium sulfite dissolved in 50mL distilled water), and 50μL of C solution (5g sodium bisulfite and 0.25g sodium sulfite dissolved in 50mL distilled water) in sequence, vortex for 30s, and let stand at room temperature for 10min. Then add 100 μL of B solution (liquid B is obtained by diluting solution A 15 times with distilled water), 50 μL of C solution, and 100 μL of anhydrous ethanol in sequence, vortex oscillator for 30 seconds, measure the OD value at 575 nm, and draw a linear correlation curve between pyrophosphate concentration and OD value at 575 nm.

[0052] The results showed that the correlation between different concentrations of pyrophosphate and its 575nm light absorption value was 0.9925 ( Figure 5 ).

[0053] Example 6 Enzyme Activity Inhibition Experiment Determination of the Inhibition Activity of African Swine Fever Virus E165R Protein by Compound Z423747092

[0054] Remove the enzyme centrifuge tube, add 5 μL of the recombinant ASFV E165R protein (1.05 mg / mL) prepared in Example 2 and 5 μL of different concentrations of Z423747092 (0.5 μM, 1 μM, 2 μM, 4 μM, 8 μM, 16 μM, 32 μM, 64 μM, 128 μM) to the enzyme reaction system, and place in a metal bath at 37°C for 3 min. Add 1 μL dUTP (100 mmol / L) to each tube respectively, place it in a 37°C metal bath, stop the hot bath after 1 min, add DEPC to the centrifuge tube to 800 μL, vortex oscillate for 30 s, add 50 μL molybdate reagent, 100 μL A solution (5 g sodium bisulfite and 0.25 g sodium sulfite dissolved in 50 mL distilled water), and 50 μL C solution (5 g sodium bisulfite and 0.25 g sodium sulfite dissolved in 50 mL distilled water) in sequence, vortex oscillate for 30 s, and let stand at room temperature for 10 min. Then add 100 μL of B solution (liquid B is obtained by diluting solution A 15 times with distilled water), 50 μL of C solution, and 100 μL of anhydrous ethanol in sequence, vortex oscillator for 30 s, detect the OD value at 575 nm, substitute the OD value into the pyrophosphate standard curve to convert the enzyme activity value, and calculate the inhibition rate of different concentrations of compound Z423747092 on E165R protease activity.

[0055] The experimental results show that the compound Z423747092 of the present invention can significantly inhibit the activity of E165R protein at a concentration of 0.5 to 128 μM in a dose-dependent manner ( Figure 6 ); when the concentration is 128μM, the inhibition rate can reach 60% ( Figure 7 ).

Claims

1. Use of a small molecule compound in the preparation of a drug for a disease related to the activity of ASFV E165R protein or an agent for inhibiting the activity of E165R protein, characterized in that: The small molecule compound is Z423747092, and its molecular formula is C 24 H 19 ClN6O3, the structural formula is:

2. The use according to claim 1, characterized in that: The disease associated with E165R protein activity is African swine fever.

3. The use according to claim 1, characterized in that: The concentration of the small molecule compound in the medicine is 0.5-128 μM.

4. The use according to claim 1, characterized in that: The drug also includes a pharmaceutically acceptable carrier, which includes at least one of an excipient, a glidant, a diluent, a preservative, a colorant, a flavoring agent, a wetting agent, a suspending agent, a stabilizer, an isotonic agent, a solvent, and an emulsifier.

5. The use according to claim 1, characterized in that: The dosage form of the drug is selected from any one of tablets, sprays, granules, capsules, oral solutions, injections, and suspensions.

6. An anti-African swine fever virus drug, characterized in that: The active ingredient in the medicine is a small molecule compound Z423747092.

7. The anti-African swine fever virus drug according to claim 6, characterized in that: The concentration of the small molecule compound in the medicine is 0.5-128 μM.

8. An agent for inhibiting the activity of E165R protein, characterized in that: The active ingredient in the reagent is a small molecule compound Z423747092.

9. The anti-African swine fever virus drug according to claim 8, characterized in that: The concentration of the small molecule compound in the reagent is 0.5-128 μM.

Images