Lactobacillus fermentum TY-M20 and application thereof

Abstract

The invention belongs to the technical field of microorganisms, and discloses lactobacillus fermentum TY-M20 and application thereof, and the preservation number of the lactobacillus fermentum TY-M20 is CGMCC (China General Microbiological Culture Collection Center) No.28304. The lactobacillus fermentum TY-M20 can relieve acute pancreatitis and protect related intestinal injuries.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a fermented lactobacillus TY-M20 and an application thereof. Background Art

[0002] Pancreatitis is a necrotizing inflammation of the pancreas. It manifests as acute pancreatitis in the early stage, and the initial onset is rapid and produces severe abdominal pain. Its histological characteristics are acinar cell necrosis and substantial inflammatory infiltration. The clinical manifestations range from local inflammation to destructive systemic pathological conditions. Acute pancreatitis is usually mild. If not treated in time, some patients will develop severe acute pancreatitis in the later stage. Severe acute pancreatitis is a serious disease with a high mortality rate, which seriously threatens the patient's life safety.

[0003] At present, the cause of acute pancreatitis has not been fully elucidated. The most common causes include: 1. Premature and massive activation of pancreatic enzymes in the pancreas leads to self-digestion of pancreatic tissue, causing acute chemical inflammation; 2. Alcoholism is the second most common cause of acute pancreatitis. Alcohol increases the damage to acinar cells by interfering with the body's defense mechanism against tissue oxidative stress, thereby leading to the occurrence of pancreatitis; 3. Other triggers such as genetic factors, hyperlipidemia, hypercalcemia, drugs and viral infections can also lead to the occurrence of acute pancreatitis.

[0004] The occurrence of acute pancreatitis is a process of a series of inflammatory cascade reactions. In the early stage of acute pancreatitis, excessive activation of leukocytes and the outbreak of inflammatory cells can cause organ failure. Specifically, abnormal activation of pancreatic enzymes can stimulate immune cells in pancreatic tissue and damaged pancreatic acini to produce a large number of inflammatory mediators. These inflammatory mediators interact with each other to trigger excessive activation of leukocytes, leading to systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Therefore, preventing the activation of proinflammatory inflammatory mediators or preventing the synthesis of inflammatory mediators may be an effective way to treat acute pancreatitis. In addition, one of the main complications of acute pancreatitis also includes intestinal mucosal barrier damage. Under normal conditions, intestinal pathogens and large molecular harmful substances are difficult to penetrate the intestinal wall under the protection of intestinal mucosal barrier function, which helps to maintain the stability of the internal intestinal environment. When acute pancreatitis occurs, damage to the intestinal mucosal barrier leads to increased intestinal permeability, stimulates endothelial cell activation, and releases inflammatory mediators and cytokines, leading to secondary infection of pancreatic tissue. Therefore, protecting the integrity of the intestinal barrier is of great significance for the prevention and treatment of acute pancreatitis.

[0005] With the advancement of science and technology, the treatment of acute pancreatitis has been significantly improved. However, due to the unclear pathogenesis and lack of targeted treatment, there is still no way to completely cure the disease. Probiotics, as an active microorganism, can have beneficial effects on the body after ingestion. Therefore, the application of probiotics in the prevention and treatment of acute pancreatitis provides new ideas and intervention measures for alleviating acute pancreatitis and protecting related intestinal damage. Summary of the invention

[0006] The invention discloses a strain of bacteria separated from homemade yak yogurt made by herders in Hongyuan County, Aba Tibetan and Qiang Autonomous Prefecture, Sichuan Province. The strain belongs to fermented lactobacillus (Lactobacillus paracasei) after identification, and can relieve acute pancreatitis and protect related intestinal damage.

[0007] In order to achieve the above object, the present invention can adopt the following technical solutions:

[0008] The present invention provides a Lactobacillus paracasei TY-M20, whose deposit number is CGMCC No.28304.

[0009] Preferably, the 16SrDNA sequence of the above-mentioned Lactobacillus fermentum TY-M20 comprises the sequence shown in SEQ ID NO.1.

[0010] Another aspect of the present invention provides a composition comprising the fermented Lactobacillus TY-M20 of the present invention.

[0011] Preferably, the composition comprises one or more combinations of lysate, culture or fermentation product made from Lactobacillus fermentum TY-M20.

[0012] Preferably, the above composition further comprises one or more combinations of probiotics, prebiotics, dietary fiber and Chinese patent medicines.

[0013] In another aspect, the present invention provides a preparation comprising the above-mentioned composition of the present invention, and the preparation includes food, medicine or health care product.

[0014] Preferably, the above preparation is in the form of tablets, pills, capsules, powders, gels, granules or liquids.

[0015] In another aspect, the present invention provides a use of the fermented Lactobacillus TY-M20 of the present invention or the composition of the present invention in the preparation of a preparation for relieving acute pancreatitis and / or protecting related intestinal damage.

[0016] Preferably, the above application includes one or more combinations of the following:

[0017] (a) Use of Lactobacillus fermentum TY-M20 or a composition in the preparation of a preparation for improving the degree of pancreatic edema;

[0018] (b) Use of Lactobacillus fermentum TY-M20 or the composition in the preparation of a preparation for inhibiting amylase activity and lipase activity in serum;

[0019] (c) Use of Lactobacillus fermentum TY-M20 or the composition in preparing a preparation for improving pancreatic tissue pathological damage;

[0020] (d) Use of Lactobacillus fermentum TY-M20 or the composition in the preparation of a preparation for inhibiting the expression level of inflammatory factors in pancreatic tissue;

[0021] (e) Use of Lactobacillus fermentum TY-M20 or a composition in the preparation of a preparation for inhibiting the expression level of inflammatory factors in intestinal tissue;

[0022] (f) Use of Lactobacillus fermentum TY-M20 or the composition in the preparation of a preparation for improving intestinal damage and maintaining the integrity of the intestinal mucosal barrier.

[0023] Preferably, in the above application,

[0024] Application (a) includes: application of fermented Lactobacillus TY-M20 or the composition in the preparation of a preparation for inhibiting the activity level of MPO;

[0025] In application (d), the pancreatic tissue inflammatory factors include one or more combinations of IL-6, IL-1β, or TNF-α;

[0026] In application (e), the expression level of inflammatory factors in intestinal tissue includes the mRNA expression level of IL-6, IL-1β, TNF-α or MCP-1;

[0027] Application (f) includes: application of fermented Lactobacillus TY-M20 or the composition in the preparation of a preparation for reducing the LPS content in serum;

[0028] Application (f) also includes: application of fermented Lactobacillus TY-M20 or the composition in the preparation of a preparation for increasing the mRNA expression level of ZO-1, Occludin or Claudin-1 in colon tissue.

[0029] The fermented lactobacillus preservation information of the present invention is as follows:

[0030] Depository: China General Microbiology Center (CGMCC);

[0031] Storage address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing;

[0032] Deposit date: August 31, 2023;

[0033] Deposit number: CGMCC No.28304;

[0034] Classification name: Lactobacillus paracasei.

[0035] The beneficial effects of the present invention include at least:

[0036] (1) The fermented Lactobacillus TY-M20 provided by the present invention can inhibit the activity level of MPO and effectively improve the degree of pancreatic edema.

[0037] (2) The fermented Lactobacillus TY-M20 provided by the present invention can inhibit the activity of amylase and lipase in serum, and effectively improve the condition of acute pancreatitis.

[0038] (3) The fermented Lactobacillus TY-M20 provided by the present invention can improve the pathological damage of pancreatic tissue, greatly reduce the degree of interstitial edema of pancreatic tissue, the range of necrosis of pancreatic lobules and acinar cells, and the degree of infiltration of inflammatory cells.

[0039] (4) The fermented Lactobacillus TY-M20 provided by the present invention may be able to inhibit the levels of inflammatory factors IL-6, IL-1β or TNF-α in pancreatic tissue and alleviate the inflammatory response of acute pancreatitis.

[0040] (5) The fermented Lactobacillus TY-M20 provided by the present invention can inhibit the mRNA expression level of intestinal tissue inflammatory factors IL-6, IL-1β, TNF-α or MCP-1, and effectively inhibit intestinal inflammation induced by acute pancreatitis.

[0041] (6) The fermented Lactobacillus TY-M20 provided by the present invention can reduce the LPS content in serum and effectively improve intestinal damage; it can also increase the mRNA expression level of ZO-1, Occludin or Claudin-1 in colon tissue, thereby maintaining the integrity of the intestinal mucosal barrier. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 This is the colony morphology of TY-M20.

[0043] Figure 2 This is the Gram staining result of TY-M20.

[0044] Figure 3 This is a cell adhesion diagram of TY-M20.

[0045] Figure 4 The effect of TY-M20 on the body weight of mice.

[0046] Figure 5 This is the effect of TY-M20 on the food intake of mice.

[0047] Figure 6 This is the effect of TY-M20 on the water intake of mice.

[0048] Figure 7 This is the effect of TY-M20 on pancreatic tissue edema in mice.

[0049] Figure 8 This is the effect of TY-M20 on serum amylase activity in mice.

[0050] Fig. 9 This is the effect of TY-M20 on the activity of serum lipase in mice.

[0051] Fig.10 This is the effect of TY-M20 on the activity of serum MPO in mice.

[0052] Fig.11 This is the effect of TY-M20 on mouse pancreatic tissue.

[0053] Fig.12 This is the effect of TY-M20 on the IL-6 content in mouse pancreatic tissue.

[0054] Fig.13 This is the effect of TY-M20 on the IL-1β content in mouse pancreatic tissue.

[0055] Fig.14 This is the effect of TY-M20 on the TNF-α content in mouse pancreatic tissue.

[0056] Fig.15 This is the effect of TY-M20 on the relative expression of IL-6 mRNA in mouse colon tissue.

[0057] Fig.16 This is the effect of TY-M20 on the relative expression of IL-1β mRNA in mouse colon tissue.

[0058] Fig.17 This is the effect of TY-M20 on the relative expression of TNF-α mRNA in mouse colon tissue.

[0059] Fig.18 This is the effect of TY-M20 on the relative expression of MCP-1 mRNA in mouse colon tissue.

[0060] Fig.19 This is the effect of TY-M20 on the endotoxin content in mouse serum.

[0061] Fig. 20 This is the effect of TY-M20 on the relative expression of ZO-1 mRNA in mouse colon tissue.

[0062] Fig.21This is the effect of TY-M20 on the relative expression of Occludin mRNA in mouse colon tissue.

[0063] Fig. 22 This is the effect of TY-M20 on the relative expression of Claudin-1 mRNA in mouse colon tissue.

[0064] In the above figure, "*" represents the statistical difference between the two groups P<0.05, "**" represents the statistical difference between the two groups P<0.01, "***" represents the statistical difference between the two groups P<0.001, and "****" represents the statistical difference between the two groups P<0.0001. DETAILED DESCRIPTION

[0065] The examples are provided to better illustrate the present invention, but the present invention is not limited to the examples. Therefore, those skilled in the art may make non-essential improvements and adjustments to the implementation scheme according to the above invention content, which still fall within the protection scope of the present invention.

[0066] The terms used herein are only used to describe specific embodiments and are not intended to limit the present disclosure. Unless the context has a significantly different meaning, expressions in the singular include expressions in the plural. As used herein, it should be understood that terms such as "include", "have", "include" are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials or combinations. The terms of the present invention are disclosed in the specification, and are not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials or combinations thereof may exist or may be added. As used herein, " / " may be interpreted as "and" or "or", depending on the circumstances.

[0067] The Latin name "Lactobacillus paracasei" of "fermented lactobacillus" in the present invention is the old Latin name of fermented lactobacillus, and its new Latin name is "Limosilactobacillus fermentum". The "fermented lactobacillus" in the present invention is also called "fermented lactobacillus TY-M20" or "TY-M20".

[0068] The embodiment of the present invention provides a fermented lactobacillus (Lactobacillus paracasei) TY-M20, which is deposited in the General Microbiological Center of China Microorganism Culture Collection Administration, with a deposit number of CGMCC No.28304.

[0069] It should be noted that the fermented lactobacillus TY-M20 was derived from homemade yak yogurt in the homes of herders in Hongyuan County, Aba Tibetan and Qiang Autonomous Prefecture, Sichuan Province. The Gram staining results showed that it was rod-shaped and was determined to be a Gram-positive bacterium (G + ); and by PCR amplification of 16SrDNA sequence, it was determined that the 16SrDNA sequence contained the sequence shown in SEQ ID NO.1, and homology analysis was performed to determine that the strain was fermented Lactobacillus.

[0070] In addition, the fermented lactobacillus TY-M20 of the present invention has strong gastric juice tolerance and bile salt tolerance, the survival rate in gastric juice can reach 106.77%, the growth efficiency in bile salt can reach 20.59%, and the number of adhered fermented lactobacillus TY-M20 cells in 100 cells is 1058, which means that the fermented lactobacillus TY-M20 of the present invention has good digestive tract resistance and intestinal colonization ability in the body.

[0071] The embodiment of the present invention also provides a composition comprising the fermented Lactobacillus TY-M20 of the present invention.

[0072] It should be noted that, in order to improve the application effect of Lactobacillus fermentum TY-M20, Lactobacillus fermentum TY-M20 can be applied in the form of a composition.

[0073] In some embodiments, the composition comprises one or more combinations of lysate, culture or fermentation product made from Lactobacillus fermentum TY-M20.

[0074] It should be noted that in the above-mentioned composition, fermented lactobacillus TY-M20 has good digestive tract resistance in the body, and can be prepared into a composition that can be used for food, medicine or health products. The form of the above-mentioned composition can be a lysate, culture or fermented product containing fermented lactobacillus TY-M20, wherein the lysate refers to the destruction of bacterial cell walls by physical or chemical methods to release intracellular substances; the culture refers to the microbial colony (including products such as proteins, peptides, secretions or metabolites obtained by culture) obtained by culture and breeding under artificially specified conditions; the fermented product refers to the various substances produced by fermentation process using fermented lactobacillus TY-M20 under suitable culture conditions. In the specific use process, the different forms of the bacteria can be selected according to specific needs to be prepared into a composition to play a role.

[0075] In some embodiments, the composition further comprises one or more combinations of probiotics, prebiotics, dietary fiber and Chinese patent medicine.

[0076] It should be noted that the above-mentioned fermented Lactobacillus TY-M20 and its different forms can also be used in combination with one or more of probiotics, dietary fiber and pharmaceutically active compounds; for example, fermented Lactobacillus TY-M20 can be used in combination with Bacillus subtilis, Bifidobacterium or lactic acid bacteria so that the composition has the efficacy of fermented Lactobacillus TY-M20 and other probiotics at the same time; for another example, fermented Lactobacillus TY-M20 can be used in combination with prebiotics, which can provide an energy source for fermented Lactobacillus TY-M20 and improve the effect of fermented Lactobacillus TY-M20; for another example, fermented Lactobacillus TY-M20 can be used in combination with dietary fiber, which can assist fermented Lactobacillus TY-M20 in colonization, thereby improving the effect of fermented Lactobacillus TY-M20; for another example, fermented Lactobacillus TY-M20 can also be used in combination with Chinese patent medicines to form a composition, while exerting the effects of fermented Lactobacillus TY-M20 and Chinese patent medicines.

[0077] An embodiment of the present invention further provides a preparation comprising the composition of the present invention, and the preparation is a food, a medicine or a health product.

[0078] It should be noted that food, medicine or health products are products known in the art, and may be selected according to dosage form, such as being prepared into probiotic beverages, dairy beverages (such as yogurt), or may be prepared into foods such as probiotic biscuits and probiotic powders; Of course, it is also possible to prepare medicines with therapeutic effects with pharmaceutical excipients; Similarly, it is possible to prepare health products with certain health functions, and specifically it is possible to prepare according to the effect achieved as needed. During actual preparation, the above-mentioned composition comprising fermented lactobacillus TY-M20 and its different forms may be added to food, medicine or health products.

[0079] In some specific embodiments, the dosage form of the preparation is tablets, pills, capsules, powders, gels, granules or liquids. It should be noted that the solid dosage forms such as tablets, pills, granules or capsules can be in the form of products such as probiotic tablets, probiotic sugar pills, probiotic powders or probiotic capsules; the liquid can be in the form of products such as probiotic beverages; the gel can be in the form of products such as probiotic jelly, probiotic milk caps or solidified yogurt. The specific form of the preparation is a form known in the art, and there are differences in the excipients added to different dosage forms. For example, the preparation of tablets mainly uses diluents (such as starch, dextrin, sucrose or mannose, etc.), absorbents (calcium sulfate, calcium hydrogen phosphate or light magnesium oxide, etc.), binders (polyvidone, syrup or hydroxypropyl methylcellulose, etc.), wetting agents (water, etc.) or disintegrants (dry starch, sodium hydroxymethyl starch or cross-linked polyvidone, etc.); for example, the preparation of liquids mainly uses solubilizers, suspending agents, emulsifiers or colorants, etc. Different types of agents can be added as known in the art.

[0080] In some specific examples, the above-mentioned preparation can be an inactivated bacterial agent or a microecological bacterial agent.

[0081] It should be noted that the above-mentioned preparations can be preparations prepared from inactivated bacteria agents, or can be microecological preparations prepared from live bacteria. The specific dosage form can be selected according to specific needs, and the preparation method can be selected by those known in the art.

[0082] The embodiments of the present invention also provide a use of the fermented Lactobacillus TY-M20 of the present invention or the composition of the present invention in the preparation of a preparation for relieving acute pancreatitis and / or protecting related intestinal damage.

[0083] It should be noted that the fermented lactobacillus TY-M20 of the present invention or the composition of the present invention can be used in the preparation of a preparation, and the preparation can be a food, a medicine or a health product; it should be understood that the fermented lactobacillus TY-M20 of the present invention, as a probiotic, has the properties of a functional food, a therapeutic drug and a health product. When it plays the functional role of a food, the above-mentioned preparation is a food, when it plays a therapeutic role, the above-mentioned preparation is a medicine, and when it plays a health care role, the above-mentioned preparation is a health product.

[0084] It should also be noted that, as mentioned above, the above-mentioned preparations can be powders, tablets, liquid dosage forms, granules or capsule dosage forms, etc., and the excipients added to different dosage forms are different and can be added according to what is known in the art.

[0085] In some specific examples, the above application includes one or more combinations of the following applications:

[0086] (a) Use of Lactobacillus fermentum TY-M20 or a composition in the preparation of a preparation for improving the degree of pancreatic edema;

[0087] (b) Use of Lactobacillus fermentum TY-M20 or the composition in the preparation of a preparation for inhibiting amylase activity and lipase activity in serum;

[0088] (c) Use of Lactobacillus fermentum TY-M20 or the composition in preparing a preparation for improving pancreatic tissue pathological damage;

[0089] (d) Use of Lactobacillus fermentum TY-M20 or the composition in the preparation of a preparation for inhibiting the expression level of inflammatory factors in pancreatic tissue;

[0090] (e) Use of Lactobacillus fermentum TY-M20 or a composition in the preparation of a preparation for inhibiting the expression level of inflammatory factors in intestinal tissue;

[0091] (f) Use of Lactobacillus fermentum TY-M20 or the composition in the preparation of a preparation for improving intestinal damage and maintaining the integrity of the intestinal mucosal barrier.

[0092] It should be noted that the fermented lactobacillus TY-M20 in the present invention can effectively alleviate pancreatic damage and related intestinal damage in acute pancreatitis mice, which is mainly reflected in: after the fermented lactobacillus TY-M20 intervention, the pancreatic tissue edema of mice is alleviated, serum amylase, serum lipase and MPO activity levels are significantly reduced, and the expression levels of inflammatory factors IL-6, IL-1β and TNF-α in pancreatic tissue are significantly reduced, which alleviates pancreatic inflammation in mice. In addition, the fermented lactobacillus TY-M20 intervention reduces the expression level of mRNA of colon tissue inflammatory factors (IL-6, IL-1β, TNF-α and MCP-1), which alleviates the intestinal inflammation of acute pancreatitis mice. At the same time, the fermented lactobacillus TY-M20 intervention also significantly reduces the serum endotoxin content of mice, significantly increases the relative expression level of the mRNA of intestinal tight junction proteins ZO-1, Occludin and Claudin-1, and protects the intestinal barrier function of mice.

[0093] In some specific examples, in the above applications,

[0094] Application (a) includes: application of fermented Lactobacillus TY-M20 or the composition in the preparation of a preparation for inhibiting the activity level of MPO; specifically, the above-mentioned improvement of the degree of pancreatic edema mainly includes the preparation of a preparation for relieving pancreatic tissue edema and inflammatory exudation;

[0095] In application (d), the pancreatic tissue inflammatory factors include one or more combinations of IL-6, IL-1β, or TNF-α;

[0096] In application (e), the expression level of inflammatory factors in intestinal tissue includes the mRNA expression level of IL-6, IL-1β, TNF-α or MCP-1;

[0097] Application (f) includes: application of fermented Lactobacillus TY-M20 or the composition in the preparation of a preparation for reducing the LPS content in serum; specifically, the above-mentioned reduction of the LPS content in serum mainly includes application in the preparation of a preparation for improving intestinal damage.

[0098] Application (f) also includes: the use of fermented Lactobacillus TY-M20 or the composition in the preparation of a preparation for improving the mRNA expression level of ZO-1, Occludin or Claudin-1 in colon tissue; specifically, the above-mentioned improvement of the mRNA expression level of ZO-1, Occludin or Claudin-1 in colon tissue mainly includes the use in a preparation for maintaining the integrity of the intestinal mucosal barrier.

[0099] 1. Isolation, purification and identification of Lactobacillus fermentum TY-M20

[0100] 1. Experimental Materials

[0101] Fermented Lactobacillus TY-M20 was isolated from homemade yak yogurt made by herders in Hongyuan County, Aba Tibetan and Qiang Autonomous Prefecture, Sichuan Province, and was deposited in the General Microbiology Center of China Culture Collection Administration, with the deposit number CGMCC No.28304.

[0102] Sampling method: Use a sterile spoon to take the homemade yak yogurt from the herders' home, put it into a 15mL sterile centrifuge tube containing an appropriate amount of sterile calcium carbonate and soluble starch, stir evenly, refrigerate and transport it back to the laboratory for immediate purification and separation of lactic acid bacteria.

[0103] (II) Isolation and purification of Lactobacillus fermentum TY-M20

[0104] Pipette 1 mL of the retrieved sample into 9 mL of sterile saline to obtain 10 -1 The sample diluent was then diluted 10 times in sequence to obtain concentrations of 10 -5 , 10 -6 and 10 -7 Dilution. Take appropriate amount of the three dilutions above, then spread on MRS solid medium, and invert and culture at 37°C for 48h. After the culture, observe the colony morphology, select single colonies of medium size, raised, neat and round edges, and use the plate streak method to isolate the strain, and repeat the above steps until the purified strain is obtained.

[0105] (III) Morphological and structural observation

[0106] The colony morphology of the purified strains was as follows Figure 1 As shown. Figure 1 It can be seen that the colony morphology of the purified strain is consistent, with a smooth surface, flat edges, hemispherical shape and white color.

[0107] The purified strain was subjected to Gram staining, and then the purple cell morphology was observed under a 10×100x microscope. Figure 2 As shown ( Figure 2 The original image is purple after grayscale processing. Figure 2 It can be seen that the cells are rod-shaped and are identified as Gram-positive bacteria (G + ).

[0108] (IV) PCR amplification of 16S rDNA sequence

[0109] A 25 μL reaction system was used for PCR amplification: 1 μL template, 1 μL upstream primer (10 μM), 1 μL downstream primer (10 μM), 12.5 μL 2×Taq PCR Master Mix, and the mixture was made up to 25 μL with sterile ultrapure water.

[0110] The primer sequences are: upstream primer AGAGTTTGATCCTGGCTCAG (SEQ ID NO. 2), downstream primer TACGACTTAACCCCAATCGC (SEQ ID NO. 3).

[0111] PCR amplification conditions: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, for a total of 35 cycles; terminal extension at 72°C for 10 min.

[0112] After sequence amplification, the qualified PCR amplification products were sequenced by Sangon Biotech (Shanghai) Co., Ltd., and the sequence was shown in SEQ ID No. 1. BLAST (http: / / www.ncbi.nlm.nih.gov / BLAST) was used to search and compare similarities in GeneBank, and the results showed that the strain of the present invention was Lactobacillus fermentum.

[0113] 2. Determination of digestive tract resistance and cell adhesion ability of Lactobacillus fermentum TY-M20

[0114] 1. Experimental Materials

[0115] Fermented Lactobacillus TY-M20 was isolated from homemade yak yogurt made by herders in Hongyuan County, Aba Tibetan and Qiang Autonomous Prefecture, Sichuan Province, and was deposited in the General Microbiology Center of China Culture Collection Administration, with the deposit number CGMCC No.28304.

[0116] (II) Determination of the tolerance of Lactobacillus fermentum TY-M20 to pH 3.0 artificial gastric juice

[0117] The strain was inoculated into MRS liquid medium at a 2% inoculum, and after culturing at 37°C for 18 hours, the activated strain culture solution was taken, centrifuged at 4000r / min for 10 minutes to collect the bacterial precipitate, and resuspended in an equal volume of sterile saline to obtain a bacterial suspension. 1ml of the bacterial suspension was mixed with 9ml of artificial gastric juice (0.2% NaCl, 0.35% pepsin 1:10000, pH=3 adjusted with 1mol / L HCl, filtered and sterilized for later use), mixed well, and placed in a constant temperature oscillator, cultured at 37°C and 100r / min for 3 hours, and the number of viable bacteria at 0h and 3h was determined by the pour plate method.

[0118]

[0119] Before probiotics enter the human intestine to exert their functions, they must first pass through the stomach (the pH of gastric juice is around 3.0, and the retention time is 1h-3h). The highly acidic stomach environment is not conducive to the survival of probiotics. Therefore, probiotics should have a certain survival ability in a highly acidic environment. The above experimental results show that the survival rate of fermented Lactobacillus TY-M20 in simulated gastric juice with a pH of 3.0 for 3 hours is 106.77%, which has a very strong tolerance to gastric juice.

[0120] (III) Determination of tolerance of Lactobacillus fermentum TY-M20 to 0.3% bile salt

[0121] The strain was inoculated into MRS liquid culture medium at a rate of 2%, cultured at 37°C for 18 h, and then inoculated into MRS-THIO culture medium (0.2% sodium thioglycolate was added to MRS liquid culture medium) containing 0.0% and 0.3% porcine bile salts at a rate of 2%. After mixing, the strain was placed in a constant temperature oscillator and cultured at 37°C and 100 r / min for 24 h. The growth efficiency was calculated.

[0122]

[0123] Probiotics that survive the stomach will come into contact with bile salts in the small intestine, and will be inhibited by bile salts in the small intestine after entering the intestine. The concentration of bile salts in the human intestinal environment is also constantly changing, and the fluctuation range is 0.03%-0.3%. The above experimental results show that the growth efficiency of fermented Lactobacillus TY-M20 in a bile salt concentration of 0.3% is 20.59%, and it has good bile salt tolerance.

[0124] (IV) Determination of cell adhesion ability of Lactobacillus fermentum TY-M20

[0125] HT-29 cells (human colon cancer cells) were cultured normally and passaged. The cultured cells were collected and resuspended in McCoy's 5A medium (supplemented with penicillin-streptomycin and fetal bovine serum). The cell number was adjusted to 2×10 by hemocytometer counting method. 5 / mL; put the acid-washed and sterilized coverslip into the 6-well culture plate and add 2mL of cell suspension to each well; wash with sterile PBS 3 times overnight, add bacterial suspension (bacterial concentration is 10 8 CFU / mL), incubate for 2 hours, wash 5 times with sterile PBS, add 2mL methanol to each well for fixation at room temperature for 1 hour, discard methanol and add Gram stain. The total number of Lactobacillus fermentum TY-M20 adhered to 100 cells was recorded under a microscope (20 fields of view were randomly selected), which was the adhesion value.

[0126] After the human body ingests probiotics, the growth and reproduction of probiotics are affected to a certain extent by the digestion of gastric acid and bile, and it is impossible to show a good growth trend in a short period of time. If the probiotics have good adhesion ability, they can prolong their residence time in the human intestine, which is conducive to the growth and reproduction of the strains. If the number of strains adhered to 100 cells is less than 40, it means that the strain has no adhesion ability; if the number of strains adhered to 100 cells is between 41-100, it means that the strain has average adhesion ability; if the number of strains adhered to 100 cells exceeds 100, it means that the strain has strong adhesion ability.

[0127] The experimental results of cell adhesion ability are as follows Figure 3 As shown, according to Figure 3 It can be seen that the number of 100 cells adhering to Lactobacillus fermentum TY-M20 is 1058, which has a very strong cell adhesion ability.

[0128] 3. Efficacy of Lactobacillus fermentum TY-M20 in relieving acute pancreatitis and protecting related intestinal damage

[0129] 1. Experimental Materials

[0130] Fermented Lactobacillus TY-M20 was isolated from homemade yak yogurt made by herders in Hongyuan County, Aba Tibetan and Qiang Autonomous Prefecture, Sichuan Province, and was deposited in the General Microbiology Center of China Culture Collection Administration, with the deposit number CGMCC No.28304.

[0131] Mouse model: 30 C57BL / 6 male mice (20g-25g) aged 6-8 weeks were selected and all mice were housed in standardized cages, with 5 mice in each cage. The temperature was constant (23±3℃), the humidity was constant (35±5﹪), and the lighting cycle was 12 hours (lights on at 8:00 in the morning and off at 20:00 in the evening). The experiment began after one week of adaptive feeding, with free access to food and water, and under the care of a dedicated person.

[0132] Grouping: After the adaptation period, the mice were randomly divided into three groups according to their body weight, with 10 mice in each group, named as: Control group (blank control group), Caerulein group (caerulein group) and Lactobacillus fermentum TY-M20 group (probiotic group).

[0133] Experiment: The fermented Lactobacillus TY-M20 group was intragastrically administered with 1.0×10 9CFU / kg of fermented Lactobacillus TY-M20 suspension, and the Control group and Caerulein group were gavaged with an equal amount of normal saline. On the 29th day, the three groups of mice were fasted for 16 hours before modeling, and the fermented Lactobacillus TY-M20 group and Caerulein group were gavaged with fermented Lactobacillus TY-M20 suspension and normal saline, respectively. One hour later, a caerulein solution (purchased from Tocris Bioscience) was intraperitoneally injected, 50ug / kg body weight per injection, once per hour, for a total of 8 times; the Control group was given an equal amount of normal saline. The mice were sacrificed 1 hour after the last injection according to the above method.

[0134] Mouse sample collection and processing: After sacrificing mice, the eyeballs were removed to collect blood, which was kept at 4°C for 1 hour and centrifuged at 3000r / min for 15 minutes to collect the upper serum; at the same time, the mouse pancreas and lung tissues were collected.

[0135] (II) Monitoring of mouse growth performance

[0136] The weight, food intake and water intake of mice can reflect their growth and health status to a certain extent. Initially, the weight of mice in each group was basically the same, with no significant difference (P>0.05), and the mice were randomly divided into groups to avoid uneven initial weight. The weight, food intake and water intake of mice were recorded every other day during the experiment. The results recorded after the experiment are as follows: Figure 4 , Figure 5 and Figure 6 shown.

[0137] according to Figure 4 It can be seen that after 28 consecutive days of intervention with Lactobacillus fermentum TY-M20, the weight of mice in each group increased to varying degrees, but there was no significant difference in weight gain (P>0.05).

[0138] according to Figure 5 and Figure 6 It can be seen that there was no significant difference in the changes in food intake and water intake of mice in each group (P>0.05). This result shows that the intervention of fermented Lactobacillus TY-M20 did not interfere with the daily life and growth and development of mice, indicating that it has no side effects.

[0139] 3. Determination of pancreatic tissue edema

[0140] The degree of pancreatic edema is measured by the ratio of the weight of the fresh pancreatic sample (pancreatic wet weight) to the weight of the dried pancreatic sample (pancreatic dry weight). Cut a portion of the fresh pancreatic tissue, remove the fat, wipe the surface of the pancreatic tissue with filter paper, and weigh the wet weight on an analytical balance. Dehydrate the pancreatic tissue in a 65°C oven, weigh the dry weight after 48 hours, and calculate the wet-to-dry weight ratio of the pancreatic tissue:

[0141]

[0142] When acute pancreatitis occurs, the aggregation and infiltration of a large number of immune cells in the pancreas will cause edema of the pancreatic tissue. Therefore, the degree of pancreatic edema can directly reflect the severity of acute pancreatitis. The specific calculation results are as follows: Figure 7 shown.

[0143] according to Figure 7 It can be seen that after the caerulein modeling, the pancreatic tissue of mice developed obvious edema. Compared with the blank group, the ratio of pancreatic wet weight to dry weight was significantly increased (P<0.0001). Compared with the caerulein group, the ratio of pancreatic wet weight to dry weight in the fermented Lactobacillus TY-M20 group was significantly decreased (P<0.001). The results showed that fermented Lactobacillus TY-M20 can effectively improve the degree of pancreatic edema in mice.

[0144] (IV) Determination of the activity of amylase and lipase in mouse serum

[0145] The content of amylase and lipase in serum is one of the main criteria for clinical doctors to diagnose acute pancreatitis and has been used clinically for many years. In order to determine the activity of amylase and lipase in mouse serum, the amylase and lipase kits used in the present invention (purchased from Nanjing Jiancheng Bioengineering Institute) were as follows: Figure 8 and Fig. 9 shown.

[0146] according to Figure 8 and Fig. 9 It can be seen that compared with the blank group, the serum amylase activity (P<0.0001) and lipase activity (P<0.0001) levels in the caerulein group were significantly increased, proving that the acute pancreatitis model was successfully induced. The pretreatment with fermented Lactobacillus TY-M20 significantly prevented the increase in the levels of amylase activity (P<0.0001) and lipase activity (P<0.0001), indicating that fermented Lactobacillus TY-M20 can effectively alleviate the onset of acute pancreatitis.

[0147] (V) Determination of the activity of myeloperoxidase (MPO) in mouse serum

[0148] The cause of pancreatic tissue edema is the aggregation and infiltration of inflammatory cells. Neutrophils, as a critical immune cell in the immune system, play an important role in the inflammatory response process. In the initial stage of acute pancreatitis, the damaged and inflamed sites of the pancreas will recruit and infiltrate a considerable number of neutrophils. MPO is a peroxidase mainly secreted by neutrophils. As a marker of neutrophil activation and function, it can be used to characterize the infiltration of neutrophils and is one of the sensitive indicators of acute inflammation clinically. In order to determine the activity of MPO in mouse serum, the present invention uses an MPO kit (purchased from Nanjing Jiancheng Bioengineering Institute) to determine the activity of MPO in mouse serum. The measurement results are shown in the following table. Fig.10 shown.

[0149] according to Fig.10 It can be seen that compared with the blank group, the activity level of MPO in the caerulein group was significantly increased (P<0.0001), while pretreatment with Lactobacillus fermentum TY-M20 significantly downregulated the activity level of MPO (P<0.0001). The results showed that MPO was involved in the inflammatory response of acute pancreatitis, and Lactobacillus fermentum TY-M20 could inhibit the activity level of MPO and effectively improve the degree of pancreatic edema.

[0150] (VI) Pathological histological observation of mouse pancreas

[0151] After the paraffin sections of pancreatic tissue were stained with hematoxylin-eosin, the morphological changes of pancreatic tissue were observed. The specific results are as follows: Fig.11 shown.

[0152] according to Fig.11 It can be seen that the pancreatic tissue of the mice in the Control group was normal, the pancreatic acinar and lobular structures were clear and complete, there was no edema, bleeding and necrosis, and no inflammatory cell infiltration was observed; the pancreatic tissue structure of the mice in the Caerulein group was disordered, the pancreatic lobular spaces were widened, the acinar cells were swollen or even necrotic, and there was inflammatory cell infiltration in the parenchyma and interstitium, indicating that caerulein induced severe damage to the pancreatic tissue of the mice and the acute pancreatitis model was successfully established; the degree of interstitial edema of the pancreatic tissue of the mice in the fermentation Lactobacillus TY-M20 group, the range of necrosis of the pancreatic lobules and acinar cells, and the degree of inflammatory cell infiltration were greatly reduced compared with those in the caerulein group, and pretreatment with Lactobacillus fermentation TY-M20 effectively attenuated the pathological damage of the pancreatic tissue of the mice induced by intraperitoneal injection of caerulein.

[0153] (VII) Determination of inflammatory factor levels in mouse pancreatic tissue

[0154] The course of acute pancreatitis is a series of inflammatory cascade reactions, accompanied by the release of local proinflammatory cytokines in the pancreas, which will aggravate the systemic inflammatory response. In order to study the effect of Lactobacillus fermentum TY-M20 on the inflammatory response during the course of acute pancreatitis. The embodiment of the present invention uses enzyme-linked immunosorbent assay to detect the expression levels of inflammatory factors interleukin-6 (IL-6), interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α) in mouse pancreatic tissue according to the relevant operating instructions of the corresponding ELISA kit (purchased from Shanghai ELISA Biotechnology Co., Ltd.). The test results are as follows. Fig.12 , Fig.13 and Fig.14 shown.

[0155] according to Fig.12 , Fig.13 and Fig.14 It can be seen that compared with the Control group, the levels of IL-6 (P<0.001), IL-1β (P<0.0001) and TNF-α (P<0.0001) in the pancreatic tissue of mice in the Caerulein group were significantly increased; but after the intervention of Lactobacillus fermentum TY-M20, the high levels of IL-6 (P<0.001), IL-1β (P<0.001) and TNF-α (P<0.0001) in the pancreatic tissue of mice were significantly reduced and returned to normal levels. The above results show that Lactobacillus fermentum TY-M20 can effectively reduce pancreatic inflammation in mice and play a protective role against acute pancreatitis.

[0156] (VIII) Determination of mRNA expression levels of inflammatory factors in mouse colon tissue

[0157] After acute pancreatitis occurs, inflammatory mediators in the pancreas reach the intestine through the microcirculatory system. The aggravation of intestinal inflammation will destroy the cell membrane structure of intestinal cells, leading to endothelial cell swelling, increased permeability of local capillaries, and slower blood flow. The adhesion and migration of neutrophils cause intestinal microcirculation disorders and intestinal mucosal damage, leading to continuous invasion of intestinal bacteria and endotoxins into the body. Therefore, the intestinal inflammation caused by acute pancreatitis was explored by detecting the mRNA expression level of inflammatory factors in colon tissue.

[0158] The present invention uses TRIzol reagent to extract total RNA from colon tissue, and uses a reverse transcription kit to reverse transcribe it into cDNA, and uses a fluorescent quantitative PCR instrument to detect the mRNA expression levels of the target genes IL-6, IL-1β, TNF-α and monocyte chemoattractant protein-1 (MCP-1). The primer sequences are shown in Table 1. -ΔΔCt The relative expression level of the target gene mRNA was calculated by the method. Fig.15 , Fig.16 , Fig.17 and Fig.18 shown.

[0159] Table 1 Primer sequences

[0160] Gene Sequence (5′-3′) IL-6-F TAGTCCTTCCTACCCCAATTTCC(SEQ ID No.4) IL-6-R TTGGTCCTTAGCCACTCCTTC(SEQ ID No.5) IL-1β-F GCAACTGTTCCTGAACTCAACT(SEQ ID No.6) IL-1β-R ATCTTTTGGGGTCCGTCAACT(SEQ ID No.7) TNF-α-F CCCTCACACTCAGATCATCTTCT(SEQ ID No.8) TNF-α-R GCTACGACGTGGGCTACAG(SEQ ID No.9) MCP-1-F TTAAAAACCTGGATCGGAACCAA(SEQ ID No.10) MCP-1-R GCATTAGCTTCAGATTTACGGGT(SEQ ID No.11)

[0161] According to 15, Fig.16 , Fig.17 and Fig.18 It can be seen that compared with the Control group, the mRNA expression levels of IL-6 (P<0.05), IL-1β (P<0.01), TNF-α (P<0.05) and MCP-1 (P<0.0001) in the colon tissue of the mice in the Caerulein group were significantly increased; while the intervention of Lactobacillus fermentum TY-M20 significantly reduced the mRNA expression levels of IL-6 (P<0.01), IL-1β (P<0.001), TNF-α (P<0.01) and MCP-1 (P<0.001) caused by acute pancreatitis. The above results show that Lactobacillus fermentum TY-M20 can effectively inhibit intestinal inflammation induced by acute pancreatitis.

[0162] 9. Determination of intestinal barrier function in mice

[0163] Excessive release of inflammatory factors plays an important role in the intestinal physical barrier disorder caused by acute pancreatitis. It can change the tight junctions of the intestinal epithelium and participate in the destruction of intestinal barrier function. Intestinal damage and destruction of the integrity of the intestinal mucosal barrier are one of the early signs of severe acute pancreatitis.

[0164] 1. Determination of endotoxin (LPS) content in mouse serum

[0165] The level of endotoxin (LPS) in serum is an important indicator of intestinal barrier damage. In this experiment, the endotoxin content in mouse serum was detected by ELISA. The results are as follows: Fig.19 shown.

[0166] according to Fig.19 It can be seen that compared with the Control group, the serum endotoxin content of mice in the Caerulein group was significantly increased (p<0.01), and pretreatment with Lactobacillus fermentum TY-M20 could significantly inhibit this increasing trend (P<0.05) and effectively improve intestinal damage.

[0167] 2. Determination of mRNA expression level of tight junction proteins in the mouse intestine

[0168] In order to study the effect of fermented Lactobacillus TY-M20 on intestinal barrier function, this experiment first determined the mRNA expression levels of the main tight junction proteins zonula occludens-1 (ZO-1), Occludin, and Claudin-1 in the colon. The present invention uses TRIzol reagent to extract total RNA from colon tissue, and uses a reverse transcription kit to reverse transcribe it into cDNA. The mRNA expression levels of the target genes ZO-1, Occludin, and Claudin-1 are detected by fluorescent quantitative PCR. The primer sequences are shown in Table 1, and 2 -ΔΔCt The relative expression level of the target gene mRNA was calculated by this method.

[0169] Table 2 Primer sequences

[0170] Gene Sequence (5′-3′) ZO-1-F GCTTTAGCGAACAGAAGGAGC(SEQ ID No.12) ZO-1-R TTATTTTTCCGAGACTTCACCA(SEQ ID No.13) Occludin-F TTGAAAGTCCACCTCCTTACAGA(SEQ ID No.14) Occludin-R CCGGATAAAAAGAGTACGCTGG(SEQ ID No.15) Claudin-1-F GCCTTGATGGTAATTGGCATCC(SEQ ID No.16) Claudin-1-R GGCCACTAATGTCGCCAGAC(SEQ ID No.17)

[0171] The results of the relative expression levels of ZO-1 mRNA, Occludin mRNA and Claudin-1 mRNA in the colon of the above mice are shown in the following table. Fig. 20 , Fig.21 and Fig. 22 shown.

[0172] according to Fig. 20 , Fig.21 and Fig. 22 It can be seen that compared with the Control group, the relative mRNA expression levels of ZO-1 (P<0.01), Occludin (P<0.0001) and Claudin-1 (P<0.0001) in the Caerulein group were significantly decreased. After intervention with Lactobacillus fermentum TY-M20, the mRNA expression of ZO-1 (p<0.01), Occludin (p<0.0001) and Claudin-1 (p<0.01) remained at normal levels, thereby maintaining the integrity of the intestinal mucosal barrier.

[0173] In summary, the fermented Lactobacillus TY-M20 in the present invention has good digestive tract resistance and intestinal colonization ability; the fermented Lactobacillus TY-M20 intervention can effectively alleviate pancreatic damage and related intestinal damage in mice with acute pancreatitis, which is mainly reflected in: after the intervention of fermented Lactobacillus TY-M20, the edema of the pancreatic tissue of the mice was alleviated, the activity levels of serum amylase, serum lipase and MPO were significantly reduced, and the expression levels of inflammatory factors IL-6, IL-1β and TNF-α in the pancreatic tissue were significantly decreased, thereby alleviating pancreatic inflammation in the mice.

[0174] In addition, the intervention of Lactobacillus fermentum TY-M20 reduced the mRNA expression level of inflammatory factors (IL-6, IL-1β, TNF-α and MCP-1) in colon tissue and alleviated intestinal inflammation in mice with acute pancreatitis. At the same time, the intervention of Lactobacillus fermentum TY-M20 also significantly reduced the serum endotoxin content of mice, significantly increased the relative expression level of mRNA of intestinal tight junction proteins ZO-1, Occludin and Claudin-1, and protected the intestinal barrier function of mice.

[0175] Therefore, the fermented Lactobacillus TY-M20 of the present invention can be used as an effective intervention to reduce the severity of acute pancreatitis and related intestinal barrier damage. The mechanism of this protective effect may be related to the inflammation inhibition of fermented Lactobacillus TY-M20 and the protective effect of intestinal mucosal barrier function.

[0176] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution of the present invention, which should be covered by the scope of the claims of the present invention.

Claims

1. A fermented lactobacillus (Lactobacillus paracasei) TY-M20, whose deposit number is CGMCC No.28304.

2. The fermented Lactobacillus TY-M20 according to claim 1, characterized in that The 16SrDNA sequence of Lactobacillus fermentum TY-M20 includes the sequence shown in SEQ ID NO.

1.

3. A composition comprising the fermented Lactobacillus TY-M20 according to claim 1 or 2.

4. The composition according to claim 3, characterized in that The composition comprises one or more combinations of lysate, culture or fermentation product prepared from Lactobacillus fermentum TY-M20.

5. The composition according to claim 4, characterized in that The composition also includes one or more combinations of probiotics, prebiotics, dietary fiber and Chinese patent medicines.

6. A preparation comprising the composition according to any one of claims 3 to 5, wherein the preparation is a food, a medicine or a health product.

7. The preparation according to claim 6, characterized in that The dosage form of the preparation is tablet, pill, capsule, powder, gel, granule or liquid.

8. Use of the fermented Lactobacillus TY-M20 according to claim 1 or 2 or the composition according to any one of claims 3 to 5 in the preparation of a preparation for relieving acute pancreatitis and / or protecting related intestinal damage.

9. The use according to claim 8, characterized in that: Applications include one or a combination of the following: (a) Use of Lactobacillus fermentum TY-M20 or a composition in the preparation of a preparation for improving the degree of pancreatic edema; (b) Use of Lactobacillus fermentum TY-M20 or the composition in the preparation of a preparation for inhibiting amylase activity and lipase activity in serum; (c) Use of Lactobacillus fermentum TY-M20 or the composition in preparing a preparation for improving pancreatic tissue pathological damage; (d) Use of Lactobacillus fermentum TY-M20 or the composition in the preparation of a preparation for inhibiting the expression level of inflammatory factors in pancreatic tissue; (e) Use of Lactobacillus fermentum TY-M20 or a composition in the preparation of a preparation for inhibiting the expression level of inflammatory factors in intestinal tissue; (f) Use of Lactobacillus fermentum TY-M20 or the composition in the preparation of a preparation for improving intestinal damage and maintaining the integrity of the intestinal mucosal barrier.

10. The use according to claim 9, characterized in that: in, Application (a) includes: application of fermented Lactobacillus TY-M20 or the composition in the preparation of a preparation for inhibiting the activity level of MPO; In application (d), the pancreatic tissue inflammatory factors include one or more combinations of IL-6, IL-1β, or TNF-α; In application (e), the expression level of inflammatory factors in intestinal tissue includes the mRNA expression level of IL-6, IL-1β, TNF-α or MCP-1; Application (f) includes: application of fermented Lactobacillus TY-M20 or the composition in the preparation of a preparation for reducing the LPS content in serum; Application (f) also includes: application of fermented Lactobacillus TY-M20 or the composition in the preparation of a preparation for increasing the mRNA expression level of ZO-1, Occludin or Claudin-1 in colon tissue.

Images