Probe for isothermal amplification and application thereof

Abstract

The invention provides a probe for isothermal amplification and application thereof, the probe is provided with a fluorophore, two quenching groups and tetrahydrofuran, and the fluorophore is located at the fifth end of the probe sequence; the second quenching group is positioned at the end 3 of the probe sequence; the first quenching group is located between the fluorophore and the second quenching group and is 12-20 basic groups away from the fluorophore; tetrahydrofuran is located between the fluorophore and the first quenching group and is 10-18 basic groups away from the fluorophore; the total length of the probe sequence is 27-32 basic groups, and compared with an existing isothermal amplification probe, the isothermal amplification probe is obviously shortened, can be more conveniently designed and used, is particularly suitable for RAA or RPA multiple amplification, can realize multiple amplification of more than three times, can be used as a probe and a primer, can be used for preparing a universal probe, can also be used for preparing a probe of an RAA-LFD system, and can be used for preparing an isothermal amplification system. The detection accuracy can be obviously improved, and the application prospect is wide.

Description

Technical Field

[0001] The invention relates to the field of gene amplification detection in molecular biology, and in particular to a probe for isothermal amplification and application thereof. Background Art

[0002] Nucleic acids are basic molecules in cells. They play a role in encoding and regulating the expression of genetic information in organisms. They have a vital impact on major life phenomena such as growth, development, reproduction, inheritance, and mutation. Therefore, rapid and accurate detection of nucleic acid sequences will play an important role in biological research and disease diagnosis.

[0003] PCR technology is the most widely used. It can not only amplify and separate target genes, but also can see important information such as single nucleotide polypeptides and genome structural variations. It requires repeated thermal denaturation to unwind the DNA double strands. With the development of technology, many experts and laboratories are committed to studying isothermal DNA amplification technology that does not require thermal denaturation. One type of amplification technology is a technology based on the principle of interaction between recombinase and single-stranded binding protein, such as recombinase-mediated isothermal nucleic acid amplification technology (RAA, Recombinase Aided Amplification), and recombinase polymerase amplification technology (RPA, recombinase polymerase amplification) by using recombinase, single-stranded binding protein and DNA polymerase and other enzymes under constant temperature conditions (generally in the range of 37-42°C) for nucleic acid amplification. The optimal temperature of this type of isothermal DNA amplification technology is between 37 and 42°C, and no denaturation is required, which can undoubtedly greatly speed up the amplification detection. In addition, since no temperature control equipment is required, isothermal DNA amplification technology can truly realize portable rapid nucleic acid detection.

[0004] However, the RAA or RPA primer probe sequence is relatively long. If it is too short, the recombination rate will be reduced, affecting the amplification speed and detection sensitivity. Therefore, the design of RAA primer probe is relatively difficult, multiple amplification is not easy, and the sensitivity is not high when used for nucleic acid detection.

[0005] In view of the problems of existing isothermal amplification technology, such as long RAA or RPA primer probe sequences, difficult design, difficulty in multiple amplification, and low sensitivity when used for nucleic acid detection, it is urgent to find a better RAA or RPA primer design probe method that is easy to design, easy to perform multiple amplification and application, and has better detection sensitivity for the nucleic acid to be tested. Summary of the invention

[0006] To solve the above problems, the present invention provides a probe for isothermal amplification and its application, wherein the probe is provided with a fluorescent group, two quenching groups and tetrahydrofuran, wherein the fluorescent group is located at the 5 end of the probe sequence; the second quenching group is located at the 3 end of the probe sequence; the first quenching group is located between the fluorescent group and the second quenching group, at a position 12 to 20 bases away from the fluorescent group; the tetrahydrofuran is located between the fluorescent group and the first quenching group, at a position 10 to 18 bases away from the fluorescent group; the total length of the probe sequence is 27 to 32 bases, which is significantly shorter than that of the existing RAA or RPA probes, can be more convenient to design and use, is particularly suitable for RAA or RPA multiple amplification, can achieve triple or more multiple amplification, and can be used as a probe and a primer, and can also be used to prepare a universal probe, and can also be used to prepare a probe for a RAA-LFD system, can significantly improve detection accuracy, and has broad application prospects.

[0007] On the one hand, the present invention provides a probe for isothermal amplification, the probe comprising a fluorescent group and two quenching groups; the fluorescent group is located at the 5' end of the probe sequence; the first quenching group is located between the fluorescent group and the second quenching group, and the second quenching group is located at the 3' end of the probe sequence, or between the first quenching group and the 3' end; the isothermal amplification includes RAA and RPA isothermal amplification.

[0008] It is understandable that the difference between RAA and RPA isothermal amplification lies in the different types of enzymes, while there is no obvious difference in the probes. Therefore, the probe for isothermal amplification provided by the present invention can be used for both RAA isothermal amplification and RPA isothermal amplification.

[0009] In some embodiments, the isothermal amplification is RAA isothermal amplification.

[0010] The sequences of existing RAA or RPA probes are relatively long, mainly due to two reasons:

[0011] (1) Since the amplification efficiency of RAA or RPA is lower than that of PCR, in order to achieve good detection sensitivity and prevent nonspecific amplification, the sequence length of the RAA probe needs to be longer;

[0012] (2) In order to increase the recombination rate of RAA or RPA and amplify the signal, it is usually necessary to place the fluorescent group and the quenching group in the middle of the RAA or RPA probe sequence, close to each other, with only 2 to 3 bases in between. Because the fluorescent group and the quenching group are close to each other, the response speed can be increased, thereby improving the detection sensitivity.

[0013] Since both the fluorescent group and the quenching group need to be modified on the "T" base, and the fluorescent group and the quenching group are set in the middle of the probe sequence, and between the fluorescent group and the quenching group, it is also necessary to set the recognition cleavage site tetrahydrofuran (THF) of the nucleic acid exosection, thus forming a "TNT" structure, wherein N is 1 to 3 arbitrary nucleotides, and the nucleotides are replaced by tetrahydrofuran. Therefore, the existing RAA or RPA probe must have a "TNT" structure in the middle of the sequence. The presence of the "TNT" structure makes it difficult for this part of the sequence of the RAA or RPA probe to bind to the target sequence. In order to ensure that the RAA or RPA probe can still bind to the target sequence smoothly in the presence of the "TNT" structure and prevent non-specific binding, the sequences on both sides of the "TNT" structure must be long enough, resulting in a longer RAA or RPA probe sequence.

[0014] Therefore, the existing design method makes the RAA or RPA probes very long, reaching 46-52pb. Such a length makes the design and application of RAA or RPA probes more complicated, and it is difficult to achieve multiple amplification. As long as triple or more amplification is reached, mutual interference is likely to occur, such as primers or probes binding or amplifying each other, forming dimers, etc.

[0015] The RAA or RPA probe provided by the present invention moves the fluorescent group from the middle position of the sequence to the 5' end, which will inevitably cause the distance between the fluorescent group and the quenching group to increase, affecting the detection sensitivity. In order to make up for this deficiency, a double quenching method is adopted to add a quenching gene at the 3' end or between the first quenching group and the 3' end, thereby improving the response efficiency of luminescence and quenching and improving the detection sensitivity. At the same time, such a design method makes the "TNT" structure no longer exist in the structure of the RAA probe, and only a simple "T" structure is needed to modify the first quenching group. Its effect on the binding of RAA to the target sequence is within a negligible range. Therefore, there is no need to set a certain length of sequence on both sides of the "T" structure, and it can still smoothly bind to the target sequence, thereby greatly shortening the sequence length of the RAA probe.

[0016] The setting position of the second quenching group can be adjusted according to the quenching effect, but the closer the positions of the two quenching groups are, the worse the quenching effect is, because the closer the two quenching groups are, the farther they are from the fluorescent group in the three-dimensional structure.

[0017] The design method of the RAA or RPA probe provided by the present invention can significantly shorten the length of the existing RAA probe. Although this method may also be used in PCR probes, the design rules of PCR probes and RAA probes are completely different, and this method will not shorten the PCR probe sequence at all.

[0018] PCR amplification has a higher amplification efficiency, so its probe sequence does not need to be set very long, and the fluorescent group and the quenching group do not need to be very close. Usually, the fluorescent group is directly set at the 5' end, and the quenching group is directly set at the 3' end. Although a quenching group can be added between the fluorescent group and the quenching group to improve the quenching effect, it does not shorten the PCR probe, but may extend the length of the PCR probe. Therefore, for PCR amplification, this probe design method has no obvious advantages, but for RAA or RPA isothermal amplification, this design method has a significant improvement effect, which significantly shortens the length of the RAA or RPA probe, makes design and application more convenient, and has higher detection sensitivity.

[0019] The RAA or RPA probe provided by the present invention makes the design more convenient and significantly reduces the cost. The cost of each existing RAA or RPA probe is about 1,000 yuan, while the cost of each RAA or RPA probe provided by the present invention can be reduced to about 700 yuan.

[0020] Furthermore, tetrahydrofuran is included, and the tetrahydrofuran is located on the probe sequence between the fluorescent group and the first quenching group.

[0021] Tetrahydrofuran (THF) is the recognition site of nuclease exonuclease. When the RAA or RPA probe binds to the target sequence to form a double strand, the exonuclease cuts the RAA or RPA probe from THF, separating the first quenching group from the fluorescent group, and the fluorescent group emits fluorescence, thereby being detected.

[0022] Furthermore, the first quenching group is located 12 to 20 bases away from the fluorescent group.

[0023] Furthermore, the first quenching group is located 13 to 16 bases away from the fluorescent group.

[0024] The closer the first quenching group in the RAA or RPA probe is to the fluorescent group, the better the quenching effect. However, once they are close, a "TNT" structure will be formed, which will affect the binding of the RAA or RPA probe to the target sequence. Therefore, the first quenching group and the fluorescent group must be separated by a certain distance. Maintaining an appropriate distance can achieve both a quenching effect and a binding effect with the target sequence. Studies have shown that the first quenching group is more suitable for being 12 to 20 bases away from the fluorescent group, preferably 13 to 16 bases.

[0025] Furthermore, the tetrahydrofuran is located 10 to 18 bases away from the fluorescent group.

[0026] Furthermore, the tetrahydrofuran is located 10 to 13 bases away from the fluorescent group.

[0027] Tetrahydrofuran needs to be placed between the fluorescent group and the first quenching group so that the exonuclease can recognize and cut, separating the fluorescent group from the quenching group. At the same time, after the exonuclease cuts, the remaining partial sequence with the fluorescent group also needs to maintain a specific length so that it can continue to bind to the target sequence to emit fluorescence or continue to amplify, that is, the fluorescent group at the 5' end and the tetrahydrofuran must also maintain a suitable distance. Studies have shown that the distance between tetrahydrofuran and the fluorescent group is more suitable at 10 to 18 bases, preferably 10 to 13 bases.

[0028] Furthermore, the second quencher group is located at the 3' end of the probe sequence; the second quencher group is 10 to 18 bases away from the first quencher group.

[0029] The farther the second quencher group is from the first quencher group, the better the quenching effect on the fluorescent group will be, so it is preferably at the 3' end of the probe sequence. However, if the second quencher group is too far away from the first quencher group, it will also cause the probe sequence to become longer and affect the recombination rate. The preferred length is 10 to 18 bases.

[0030] Furthermore, the second quencher group is 12 to 15 bases away from the first quencher group; and the total length of the probe is 27 to 32 bases.

[0031] The RAA or RPA probe designed by the method provided by the present invention has a total length of only 27 to 32 bases, which is 20 to 50% shorter than the existing RAA or RPA probes (46 to 52 bases), while still achieving the amplification and detection effects of the existing RAA or RPA probes. At the same time, the design and application are more convenient and the application is wider.

[0032] On the other hand, the present invention provides a primer probe set for isothermal amplification, the primer probe set comprising the probe as described above and primers, and the isothermal amplification comprises RAA and RPA isothermal amplification.

[0033] On the other hand, the present invention provides an isothermal amplification kit, comprising the isothermal amplification primer probe set as described above, and reagents for isothermal amplification, wherein the reagents include a recombinase and an exonuclease; the isothermal amplification includes RAA and RPA isothermal amplification.

[0034] In another aspect, the present invention provides a method for isothermal amplification, wherein the method uses the probe as described above to perform isothermal amplification, and the isothermal amplification includes RAA and RPA isothermal amplification.

[0035] On the other hand, the present invention provides a use of a probe for preparing a reagent for shortening the probe length of an isothermal amplification system, wherein the probe is used for isothermal amplification, and the probe includes a fluorescent group and two quenching groups; the fluorescent group is located at the 5' end of the probe sequence; the first quenching group is located between the fluorescent group and the second quenching group, and the second quenching group is located at the 3' end of the probe sequence, or between the first quenching group and the 3' end; the isothermal amplification includes RAA and RPA isothermal amplification.

[0036] On the other hand, the present invention provides a probe for preparing a reagent for improving the success rate of multiple amplification, wherein the probe is used for isothermal amplification, and the isothermal amplification includes RAA and RPA isothermal amplification; the probe includes a fluorescent group and two quenching groups; the fluorescent group is located at the 5' end of the probe sequence; the first quenching group is located between the fluorescent group and the first quenching group, and the second quenching group is located at the 3' end of the probe sequence, or between the first quenching group and the 3' end.

[0037] As mentioned above, the existing RAA or RPA probes are 46-52pb in length, which makes it difficult to achieve multiplex amplification. Once triple or more amplification is achieved, mutual interference is likely to occur, such as primers or probes binding or amplifying each other, forming dimers, and so on.

[0038] The RAA or RPA probe provided by the present invention has a length shortened to 30-50% of the existing RAA or RPA probe, and can easily achieve triple or more amplifications, and even ten-fold amplifications without mutual interference. Moreover, due to its short length, the design is more convenient and the detection sensitivity is higher.

[0039] On the other hand, the present invention provides a use of a probe for preparing an isothermal amplification reagent that can be used as both a probe and a primer, wherein the probe is used for isothermal amplification, and the probe includes a fluorescent group and two quenching groups; the fluorescent group is located at the 5' end of the probe sequence; the first quenching group is located between the fluorescent group and the second quenching group, and the second quenching group is located at the 3' end of the probe sequence, or between the first quenching group and the 3' end, and the isothermal amplification includes RAA and RPA isothermal amplification.

[0040] Existing RAA or RPA probes can only play the role of luminescence and detection after being cut by nuclease exonuclease to separate the fluorescent group and quenching group, and cannot continue to amplify as primers. The reason is that the fluorescent group is very close to the site where tetrahydrofuran is located, resulting in the 5' end sequence after the cut being affected by the fluorescent group and cannot be amplified smoothly.

[0041] The RAA or RPA probe provided by the present invention has a fluorescent group located at the 5' end, which is far away from the site where tetrahydrofuran is located. Therefore, after being cut by the exonuclease, the sequence containing the fluorescent group can also serve as a primer for continued amplification. In other words, the improved RAA or RPA probe can be used as a probe for luminescent detection and as a primer for amplification, thereby improving the detection sensitivity. At the same time, since the base length of the RAA or RPA probe is relatively short, when used as a primer, the length of the amplified product is also relatively short, the amplification effect is better, the recombination rate is higher, and the detection sensitivity can be further improved.

[0042] On the other hand, the present invention provides a use of a probe for preparing a universal probe, wherein the probe is used for isothermal amplification, and the probe comprises a fluorescent group and two quenching groups; the fluorescent group is located at the 5' end of the probe sequence; the first quenching group is located between the fluorescent group and the second quenching group, and the second quenching group is located at the 3' end of the probe sequence, or between the first quenching group and the 3' end, and the isothermal amplification comprises RAA and RPA isothermal amplification.

[0043] A universal probe means that when targeting multiple target sequences, one or two primers are taken from the primer set for each target sequence, and a sequence consistent with the probe is connected to the end of the primer, so that the product amplified by the primer set of each target sequence is complementary to the probe. Only one probe is needed to detect all target sequences. This probe is called a universal probe.

[0044] Universal probes are easier to implement in PCR amplification systems. However, in existing RAA or RPA amplification systems, since the RAA or RPA probe sequences are relatively long, if they are connected to primers, the primers will be too long and affect the recombination rate, making it difficult to prepare universal probes.

[0045] The isothermal amplification probe provided by the present invention has a base length of only 30-50% of the length of the existing RAA or RPA probe, and can therefore be used to prepare a universal probe, so that the RAA or RPA amplification system can also use the universal probe for amplification, simplifying the RAA or RPA detection process of multiple target sequences and reducing the probe cost, thereby making the application field of the isothermal amplification probe broader.

[0046] On the other hand, the present invention provides a probe for preparing a reagent that can be used for isothermal amplification fluorescence detection and RAA-LFD detection, wherein the RAA or RPA probe comprises a fluorescent group and two quenching groups; the fluorescent group is located at the 5' end of the probe sequence; the first quenching group is located between the fluorescent group and the first quenching group, and the second quenching group is located at the 3' end of the probe sequence, or between the first quenching group and the 3' end, and the isothermal amplification comprises RAA and RPA isothermal amplification.

[0047] Existing probes can either only be used for isothermal amplification followed by fluorescence detection, or can only be used for RAA-LFD detection.

[0048] Among them, the RAA probe used for RAA amplification and then fluorescence detection must have both a fluorescent group and a quenching group. The existing RAA probe has a fluorescent group that is very close to the site of tetrahydrofuran, resulting in the 5' end sequence after being cut by the nuclease exonuclease being unable to form a new amplification product with the reverse primer because the fluorescent group is right next to it, and it cannot be used for LFD detection.

[0049] Although the RAA probe used for RAA-LFD detection also has a fluorescent group and is set at the 5' end, it does not contain a quenching group. It only has a blocking group at the 3' end. After the site where the tetrahydrofuran is located is cut by the nuclease exonuclease, the remaining 5' end sequence and the reverse primer containing biotin form a new amplification product for LFD detection. Since there is no quenching group, the fluorescence will not change whether the reaction is amplified or not, so it cannot be used for fluorescence detection.

[0050] The isothermal amplification probe provided by the present invention has a quenching group that can act as a blocking group, and a fluorescent group is set at the 5' end. After the site where tetrahydrofuran is located is cut by the exonuclease, the remaining 5' end sequence will not be affected by the fluorescent group, and can still form a new amplification product with a reverse primer containing biotin to continue amplification, thereby enabling LFD detection. At the same time, since the isothermal amplification probe provided by the present invention has a shorter sequence, a higher recombination rate, a better amplification effect, and a shorter amplification product that is easier to detect, the sensitivity of LFD detection after fluorescence detection is also higher.

[0051] On the other hand, the present invention provides a probe for preparing a reagent for improving the detection sensitivity of the RAA-LFD system, wherein the probe is used for isothermal amplification, and the probe includes a fluorescent group and two quenching groups; the fluorescent group is located at the 5' end of the probe sequence; the first quenching group is located between the fluorescent group and the second quenching group, and the second quenching group is located at the 3' end of the probe sequence, or between the first quenching group and the 3' end, and the isothermal amplification includes RAA and RPA isothermal amplification.

[0052] On the other hand, the present invention provides a use of a probe for preparing a reagent for a multi-probe detection system for improving the sensitivity of target nucleic acid detection, wherein the probe is used for isothermal amplification, and the probe includes a fluorescent group and two quenching groups; the fluorescent group is located at the 5' end of the probe sequence; the first quenching group is located between the fluorescent group and the second quenching group, and the second quenching group is located at the 3' end of the probe sequence, or between the first quenching group and the 3' end, and the isothermal amplification includes RAA and RPA isothermal amplification.

[0053] Existing RAA or RPA probes cannot realize a multi-probe detection system because the existing RAA or RPA probe base sequences are long and the amplification product sequences are long. This problem easily leads to self-pairing and mutual pairing between multiple probes and primers, significantly reducing the amplification efficiency and may cause false positive results.

[0054] The probe for isothermal amplification provided by the present invention can avoid the self-pairing and mutual pairing of primers or probes due to the short base sequence and short amplification product, thereby improving the amplification efficiency. Therefore, multiple probes can be used simultaneously to detect the same target sequence, and the detection sensitivity can be significantly improved compared to the case of using only one probe.

[0055] The probe for isothermal amplification provided by the present invention has the following beneficial effects:

[0056] 1. The base sequence is shorter, only 30-50% of the existing isothermal amplification probe, with a simpler and more convenient design and low cost;

[0057] 2. Due to the shortened probe sequence, the problem of the existing isothermal amplification system being difficult to achieve multiple amplification is solved, and more than three multiple amplifications can be achieved;

[0058] 3. The probe provided for isothermal amplification can be used as both a probe and a primer;

[0059] 4. The probe provided for isothermal amplification can be used to prepare universal probes;

[0060] 5. The probes provided for isothermal amplification can be used for RAA or RPA amplification fluorescence detection, and can also be used for RAA-LFD detection;

[0061] 6. Improve the detection sensitivity of nucleic acid amplification by RAA or RPA. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] Figure 1 This is a schematic diagram of the design of the RAA probe provided in Example 1;

[0063] Figure 2 Schematic diagram of the design of the existing RAA probe in Example 1;

[0064] Figure 3 is the amplification curve of the RAA probe CS-RP system designed in the prior art in Example 2; Figure 4 is the amplification curve of the RAA probe CS-P system in Example 2;

[0065] Figure 5 10 of the RAA probes designed in two ways in Example 6 7copies / ml template amplification curve;

[0066] Figure 6 10 of the RAA probes designed in two ways in Example 6 6 copies / ml template amplification curve;

[0067] Figure 7 10 of the RAA probes designed in two ways in Example 6 5 copies / ml template amplification curve;

[0068] Figure 8 This is a graph showing the fluorescence detection result of the RAA probe FPV-RP designed according to the prior art in Example 10;

[0069] Fig. 9 This is a graph showing the fluorescence detection results of the RAA probe designed in Example 10 according to the design method of commonly used probes in existing LFD reagent strips;

[0070] Fig.10 This is a graph showing the fluorescence detection results of the RAA probe FPV-P designed according to the method provided by the present invention in Example 10;

[0071] Fig.11 is the test result of the LFD reagent strip of combination 1 in Example 10;

[0072] Fig.12 The test results of the LFD reagent strip of combination 2 in Example 10;

[0073] Fig.13 This is the test result of the LFD reagent strip of combination 3 in Example 10. DETAILED DESCRIPTION

[0074] The preferred embodiments of the present invention are further described in detail below in conjunction with the accompanying drawings. It should be noted that the embodiments described below are intended to facilitate the understanding of the present invention and do not have any limiting effect on it. The raw materials and equipment used in the specific embodiments of the present invention are all known products and are obtained by purchasing commercially available products.

[0075] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention.

[0076] Example 1: Design of the RAA probe provided by the present invention

[0077] The design of the RAA probe used in this embodiment is as follows: the RAA probe includes a fluorescent group and two quenching groups; the fluorescent group is located at the 5' end of the probe sequence; the first quenching group is located between the fluorescent group and the second quenching group, and the second quenching group is located at the 3' end of the probe sequence; tetrahydrofuran is provided on the probe sequence between the fluorescent group and the first quenching group, the first quenching group is located at a position 12 to 20 bases away from the fluorescent group, the tetrahydrofuran is located at a position 10 to 18 bases away from the fluorescent group, the second quenching group is located 10 to 18 bases away from the first quenching group, and the total length of the RAA probe is 27 to 32 bases. The schematic diagram of the design of the RAA probe provided in this embodiment is as follows Figure 1 As shown. The schematic diagram of the design method of the RAA probe provided by the existing method is as follows Figure 2 As shown, the total length needs to be at least 46-52pb. The design method of the RAA probe provided in this embodiment shortens the base length of the RAA probe by 20-50%, while still achieving the amplification and detection effects of the existing RAA probe, and is more convenient to design and apply.

[0078] Example 2: Comparison of two RAA probes (Cryptosporidium amplification)

[0079] 1. Primer probe design

[0080] In this example, a RAA amplification primer probe set is designed for the conserved sequence (Seq ID NO.1) in the 18S gene of Cryptosporidium. Two sets of probes are designed according to the design methods of the existing RAA probes and the RAA probes provided by the present invention, respectively. See Table 1 for details.

[0081] Table 1. Primer probe sets

[0082]

[0083] The RAA probe CS-RP designed in the present embodiment according to the existing method has a base length of 45 bp and a design cost of 924 yuan. However, the RAA probe CS-P designed according to the method provided by the present invention has a base length of only 30 bp, which is shortened by 33.3% and the design cost is only 800 yuan.

[0084] 2. Test methods

[0085] RAA amplification was performed using 25ul of fluorescent nucleic acid amplification reagent (RAA method) customized by Hangzhou Zhongce Biotechnology Co., Ltd. The amplification system was prepared according to Table 2:

[0086] Table 2. RAA amplification reagents

[0087]

[0088] Take 20ul of the above RAA amplification reagent and add it to the reagent tube containing lyophilized powder (lyophilized powder contains recombinase, recombinase auxiliary factor, single-stranded binding protein, nuclease, lyophilization protective agent, dNTP, creatine kinase, ATP, etc., such as recombinase 600ng / μl; single-stranded DNA binding protein 150ng / μl; DNA polymerase 400ng / μl; exonuclease 300ng / μl; polyethylene glycol, 4%; Tris, 20mM; potassium acetate, 120mM; dithiothreitol, 6mM; adenosine phosphate, 4mM; creatine phosphate disodium salt, 50mM; phosphocreatine, 120ng / μl; deoxyribonucleoside triphosphate, 300μM; trehalose), and then add 5ul of 10 containing Cryptosporidium 18S gene 3 , 10 4 , 10 5 The template and negative control were 500 copies / ml, capped, and placed in Hangzhou Xunling Biological Isothermal Fluorescence Nucleic Acid Detector (NAT-08A) at 40°C, 40 cycles for 30 seconds, and FAM fluorescence was collected. Each group was repeated twice and the Ct value was detected.

[0089] 3. Analysis of experimental results

[0090] The Ct value detection results are shown in Table 3, and the amplification curve is shown in Figure 3 and Figure 4 As shown, Figure 3 This is the amplification curve of the CS-RP system using the RAA probe designed in the existing way. Figure 4 This is an amplification curve of the RAA probe CS-P system designed using the RAA probe design method provided by the present invention.

[0091] Table 3. Ct value detection results of two groups of RAA probes

[0092]

[0093] According to Table 3, the lower the Ct value, the higher the RAA amplification efficiency. The Ct value of the RAA amplification detection result of the RAA probe CS-P designed in the manner provided by the present invention is significantly lower than the detection result of the existing RAA probe CS-RP. It can be seen that the RAA amplification efficiency and detection sensitivity are higher when CS-P is used. At the same time, the length of CS-P is significantly shorter than that of CS-RP, and the price is also lower, which has obvious advantages.

[0094] Example 3: Selection of base distance between the first quenching group and the fluorescent group

[0095] In this embodiment, the RAA amplification primer probe group is designed for the conserved sequence (Seq ID NO.1) in the 18S gene of Cryptosporidium. Two probes and primers are designed according to the design method of the RAA probe provided in this embodiment 1 and the design method of the existing RAA probe, respectively, as shown in Table 4. Among them, the RAA probe designed according to the method provided by the present invention is CS-RP, and the RAA probe designed according to the design method provided in this embodiment includes three groups of probes of different lengths, and the length difference is that the base distance between the first quenching group and the fluorescent group is different. The base distance between the first quenching group and the fluorescent group in CS-P1 is 14bp, the base distance between the first quenching group and the fluorescent group in CS-P2 is 18bp, and the base distance between the first quenching group and the fluorescent group in CS-P3 is 9bp. For each probe, previous studies have shown that the different primer sequences between each probe do not bring about differences in amplification effects, so the differences are mainly caused by the design method and the different base distances between the first quenching group and the fluorescent group.

[0096] Table 4. Primer probe sets

[0097]

[0098]

[0099] RAA amplification was performed using 25ul of fluorescent nucleic acid amplification reagent (RAA method) customized by Hangzhou Zhongce Biotechnology Co., Ltd. The amplification system was prepared according to Table 5.

[0100] Table 5. RAA amplification reagents

[0101] name Single serving(ul) 20T volume (ul) CS-R 1 20 CS-F 1 20 CS-RP or CS-P1~3 0.3 6 TE 3.7 74 Starter 14 280 Total 20 400

[0102] Take 20ul of the above RAA amplification reagent and add it to a reagent tube containing lyophilized powder (the lyophilized powder specifically contains recombinase, recombinase auxiliary factor, single-stranded binding protein, nuclease, lyophilization protective agent, dNTP, creatine kinase, ATP, etc., for example, in this embodiment, 600ng / μl of recombinase; 150ng / μl of single-stranded DNA binding protein; 400ng / μl of DNA polymerase; 300ng / μl of exonuclease; polyethylene glycol, 4%; Tris, 20mM; potassium acetate, 120mM; dithiothreitol, 6mM; adenosine phosphate, 4mM; disodium phosphocreatine, 50mM; phosphocreatine, 120ng / μl; deoxyribonucleoside triphosphate, 300μM; trehalose), and then add 5ul of 10% lyophilized water containing the Cryptosporidium 18S gene. 3 , 10 4 , 10 5The template and negative control with 100 copies / ml were capped and placed in the Hangzhou Xunling Biological Isothermal Fluorescence Nucleic Acid Detector (NAT-08A) at 40°C for 40 cycles for 30 seconds. FAM fluorescence was collected and Ct value was detected.

[0103] The Ct value detection results are shown in Table 6, where combination 1 is the detection result of CS-RP, combination 2 is the detection result of CS-P1, combination 3 is the detection result of CS-P2, and combination 4 is the detection result of CS-P3.

[0104] Table 6. Ct value detection results of two groups of RAA probes

[0105]

[0106] According to Table 6, the lower the Ct value, the higher the RAA amplification efficiency. Comparison of combinations 1 to 4 shows that the RAA amplification efficiency when using CS-P is generally higher than that of CS-RP, and the detection sensitivity is higher; comparison of combinations 2 to 4 shows that the use of RAA probes of different lengths, in which the first quenching group is 12 to 20 bases away from the fluorescent group, is more suitable, and the optimal is 13 to 16 bases (14 in combination 2), which can keep the first quenching group and the fluorescent group at a suitable distance, which can not only play a quenching effect, but also ensure the binding effect with the target sequence, thereby improving the detection sensitivity.

[0107] Example 4: Selection of the distance between tetrahydrofuran and fluorescent group

[0108] In this embodiment, the RAA amplification primer probe group is designed for the conserved sequence (Seq ID NO.1) in the 18S gene of Cryptosporidium. Two groups of probes and primers are designed according to the design method of the RAA probe provided in this embodiment 1 and the design method of the existing RAA probe, respectively, as shown in Table 7. Among them, the RAA probe designed according to the method provided by the present invention is CS-RP, and the RAA probe designed according to the design method provided in this embodiment includes three groups of probes of different lengths, the length difference being that the distance between tetrahydrofuran and the fluorescent group base is different, the distance between tetrahydrofuran and the fluorescent group base in CS-P1 is 14bp, the distance between tetrahydrofuran and the fluorescent group base in CS-P2 is 11bp, and the distance between tetrahydrofuran and the fluorescent group base in CS-P3 is 8bp. For each probe, previous studies have shown that the different primer sequences between each probe do not bring about differences in amplification effects, so the differences are mainly caused by the design method and the different distances between tetrahydrofuran and the fluorescent group base.

[0109] Table 7. Primer probe set

[0110]

[0111] RAA amplification was performed using 25ul of fluorescent nucleic acid amplification reagent (RAA method) customized by Hangzhou Zhongce Biotechnology Co., Ltd. The amplification system was prepared according to Table 5.

[0112] Take 20ul of the above RAA amplification reagent and add it to a reagent tube containing lyophilized powder (the lyophilized powder specifically contains recombinase, recombinase auxiliary factor, single-stranded binding protein, nuclease, lyophilization protective agent, dNTP, creatine kinase, ATP, etc., for example, in this embodiment, 600ng / μl of recombinase; 150ng / μl of single-stranded DNA binding protein; 400ng / μl of DNA polymerase; 300ng / μl of nuclease; polyethylene glycol, 4%; Tris, 20mM; potassium acetate, 120mM; dithiothreitol, 6mM; adenosine phosphate, 4mM; disodium phosphocreatine, 50mM; phosphocreatine, 120ng / μl; deoxyribonucleoside triphosphate, 300μM; trehalose)), and then add 5ul of 10 containing the Cryptosporidium 18S gene 3 , 10 4 , 10 5 The template and negative control with 100 copies / ml were capped and placed in the Hangzhou Xunling Biological Isothermal Fluorescence Nucleic Acid Detector (NAT-08A) at 40°C for 40 cycles for 30 seconds. FAM fluorescence was collected and Ct value was detected.

[0113] The Ct value detection results are shown in Table 8, where combination 1 is the detection result of CS-RP, combination 2 is the detection result of CS-P1, combination 3 is the detection result of CS-P2, and combination 4 is the detection result of CS-P3.

[0114] Table 8. Ct value detection results of two groups of RAA probes

[0115]

[0116]

[0117] According to Table 8, the lower the Ct value, the higher the RAA amplification efficiency. Comparison of combinations 1 to 4 shows that the RAA amplification efficiency when using CS-P is generally higher than that of CS-RP, and the detection sensitivity is higher; comparison of combinations 2 to 4 shows that the use of RAA probes of different lengths, where the distance between tetrahydrofuran and the fluorescent group is 10 to 18 bases is more suitable, and preferably 10 to 13 bases (combination 3 is 11 bases), can keep the tetrahydrofuran and the fluorescent group at a suitable distance, so that the exonuclease can recognize and cut, and the fluorescent group is separated from the quenching group. At the same time, after the exonuclease cuts, the remaining partial sequence with the fluorescent group can also maintain a specific length, continue to bind to the target sequence to emit fluorescence or continue to amplify, thereby improving the detection sensitivity.

[0118] Example 5: Selection of the distance between the second quenching group and the first quenching group

[0119] In this embodiment, the RAA amplification primer probe group is designed for the conserved sequence (Seq ID NO.1) in the 18S gene of Cryptosporidium. Two groups of probes and primers are designed according to the design method of the RAA probe provided in this embodiment 1 and the design method of the existing RAA probe, respectively, as shown in Table 9. Among them, the RAA probe designed according to the method provided by the present invention is CS-RP, and the RAA probe designed according to the design method provided in this embodiment includes three groups of probes of different lengths, the length difference is that the base distance between tetrahydrofuran and the fluorescent group is different, the second quenching group in CS-P1 is 14bp away from the first quenching group, the second quenching group in CS-P2 is 10bp away from the first quenching group, and the second quenching group in CS-P3 is 8bp away from the first quenching group. For each probe, previous studies have shown that the different primer sequences between each probe do not bring about differences in amplification effects, so the differences are mainly caused by the design method and the different base distances between the second quenching group and the first quenching group.

[0120] Table 9. Primer probe set

[0121]

[0122] RAA amplification was performed using 25ul of fluorescent nucleic acid amplification reagent (RAA method) customized by Hangzhou Zhongce Biotechnology Co., Ltd. The amplification system was prepared according to Table 5.

[0123] Take 20ul of the above RAA amplification reagent and add it to a reagent tube containing lyophilized powder (the lyophilized powder specifically contains recombinase, recombinase auxiliary factor, single-stranded binding protein, nuclease, lyophilization protective agent, dNTP, creatine kinase, ATP, etc., for example, in this embodiment, 600ng / μl of recombinase; 150ng / μl of single-stranded DNA binding protein; 400ng / μl of DNA polymerase; 300ng / μl of exonuclease; polyethylene glycol, 4%; Tris, 20mM; potassium acetate, 120mM; dithiothreitol, 6mM; adenosine phosphate, 4mM; disodium phosphocreatine, 50mM; phosphocreatine, 120ng / μl; deoxyribonucleoside triphosphate, 300μM; trehalose), and then add 5ul of 10% lyophilized water containing the Cryptosporidium 18S gene. 3 , 10 4 , 10 5 The template and negative control with 100 copies / ml were capped and placed in the Hangzhou Xunling Biological Isothermal Fluorescence Nucleic Acid Detector (NAT-08A) at 40°C for 40 cycles for 30 seconds. FAM fluorescence was collected and Ct value was detected.

[0124] The Ct value detection results are shown in Table 10, where combination 1 is the detection result of CS-RP, combination 2 is the detection result of CS-P1, combination 3 is the detection result of CS-P2, and combination 4 is the detection result of CS-P3.

[0125] Table 10. Ct value detection results of two groups of RAA probes

[0126]

[0127] According to Table 10, the lower the Ct value, the higher the RAA amplification efficiency. Comparison of combinations 1 to 4 shows that the RAA amplification efficiency when using CS-P is generally higher than that of CS-RP, and the detection sensitivity is higher; comparison of combinations 2 to 4 shows that the use of RAA probes of different lengths, in which the distance between the second quenching group and the first quenching group is 10 to 18 bases, is more suitable, and preferably 12 to 15 bases (combination 2 is 14 bases), can keep the second quenching group and the first quenching group at a suitable distance, have a better quenching effect on the fluorescent group, and will not be too close to affect the recombination rate, thereby improving the detection sensitivity.

[0128] Example 6: Comparison of two RAA probes (FCV amplification)

[0129] 1. Primer probe design

[0130] Feline calicivirus (FCV) has very few conserved sequences, with the longest sequence not exceeding 120 bp. According to the current RAA primer probe design, it is very difficult and has low sensitivity. In this embodiment, the RAA amplification primer probe group is designed for the conserved sequence (Seq ID NO.2) in FCV, and two groups of probes are designed according to the design methods of the existing RAA probe and the RAA probe provided by the present invention.

[0131] The FCV targeting sequence is as follows:

[0132] GAGCAATTTAACAAAATTCTTGAGCAGAGGGTACAAGGCCCCATCCAGTCTGTGCGACTTGC

[0133] AC GTGCTGCTGGATTTAGGGTTGACCCTTACTCATACACAAATCAAAA TTTTTATGACGATCAATTA

[0134] AATGCAATTAGGCTATCAT

[0135] The designed primer probe sets are shown in Table 11.

[0136] Table 11. Primer probe set

[0137] name sequence FCV-RP GCTGCTGGATTTAGGGTTGACCCT(FAM-DT)AthfBHQ1-dTCATACACAAATCAAAA-C3 FCV-P FAM-TTTAGGGTTGACCC(THF)(BHQ1-dT)ACTCATACACAAAT-BHQ1 FCV-R TGATAGCCTAATTGCATTTAATTGATCGTCAT FCV-F ATTTAACAAAATTCTTGAGCAGAGGGTA

[0138] The RAA probe FCV-RP designed in the present embodiment according to the existing method has a base length of 44 bp, while the RAA probe FCV-P designed according to the method provided by the present invention only needs a base length of 30 bp, which is shortened by about 30%.

[0139] 2. Test methods

[0140] Use 25ul of RT-fluorescent nucleic acid amplification reagent (RAA method) customized by Hangzhou Zhongce Biotechnology Co., Ltd. to perform RAA amplification, and the amplification system is prepared according to Table 12.

[0141] Table 12. RAA Amplification Reagents

[0142]

[0143] Take 20ul of the above RAA amplification reagent and add it to the reagent tube containing lyophilized powder (the lyophilized powder specifically contains recombinase, recombinase auxiliary factor, single-stranded binding protein, nuclease, lyophilization protective agent, dNTP, creatine kinase, ATP, etc., for example, in this embodiment, 600ng / μl of recombinase; 150ng / μl of single-stranded DNA binding protein; 400ng / μl of DNA polymerase; 300ng / μl of nuclease; polyethylene glycol, 4%; Tris, 20mM; potassium acetate, 120mM; dithiothreitol, 6mM; adenosine phosphate, 4mM; disodium phosphocreatine, 50mM; phosphocreatine, 120ng / μl; deoxyribonucleoside triphosphate, 300μM; trehalose), and then add 5ul of 10% FCV. 7 , 10 6 , 10 5 The template and negative control with 100 copies / ml were capped and placed in the Biori 9600 isothermal fluorescence nucleic acid detector at 40°C, 40 cycles for 30s, and FAM fluorescence was collected to detect the Ct value.

[0144] 3. Analysis of experimental results

[0145] The Ct value detection results are shown in Table 13, and the amplification curve is shown in Figure 5 to Figure 7 As shown, Figure 5 For 10 7 copies / ml template diagram, Figure 6 For 10 6 copies / ml template diagram, Figure 7 For 10 5 copies / ml template diagram.

[0146] Table 13. Ct value detection results of two groups of RAA probes

[0147]

[0148]

[0149] According to Table 13, the lower the Ct value, the higher the RAA amplification efficiency. Most of the Ct values ​​of the RAA amplification detection results of the RAA probe FCV-P designed in the manner provided by the present invention are significantly lower than the detection results of the existing RAA probe FCV-RP. It can be seen that the RAA amplification efficiency and detection sensitivity are higher when FCV-P is used. At the same time, the length of FCV-P is significantly shorter than that of FCV-RP, and the price is also lower, which has obvious advantages.

[0150] Example 7: Differences between two RAA probes for multiplex amplification

[0151] 1. Primer probe design

[0152] In this example, RAA amplification primer probe sets were designed for feline herpesvirus FHV (Seq ID NO.3), Mycoplasma MYC (Seq ID NO.4), and Chlamydia CHY (Seq ID NO.5). Two sets of primer probe sets for triple amplification were designed according to the design methods of existing RAA probes and the RAA probes provided by the present invention.

[0153] Among them, the primer probe set for triple amplification designed according to the existing RAA probe design method is as follows:

[0154] FHV Primer Probe Set:

[0155] FHV-R:TCCTGTTATTGTGGATAGTCTGGAATGT

[0156] FHV-F:AATGCTATACTGGCGTAGTCTCTTTGAA

[0157] FHV-RP:

[0158] 5'GTCTCTTTGAAACTGATGTTGTCGGTGGFAM-dTTHFBHQ1-dTCTATGCCGTCCAGGA-C3 3'(probe)

[0159] MYC Primer Probe Set:

[0160] MYC-F:AGTTGTTACAGGAATTGAAATGTTCCGTAA

[0161] MYC-R:TAAATTGCAGCTTCGAATTCTGTGTGAGGG

[0162] MYC-RP:

[0163] TGGATTATTACTTCGTGGAGTAAACCGTGAAGA(ROX-Dt)(thf)(bhq2-dT)TGAACGTGGACAAG-C3(probe)

[0164] FCD Primer Probe Set:

[0165] FCD-F:TCTTTTCAGGAAGGTATATCCCTAGTAC

[0166] FCD-R:TTAGATCCAGCCGTTTGTGTTAGAGATT

[0167] FCD-RP:ATGAAGCATGTTTCTAAATTTTCCCAACCHEX-dT(THF)BHQ1-dTTACCCTATCCGCAG-C3(probe)

[0168] The primer probe set for triple amplification designed according to the design method of the RAA probe provided by the present invention is as follows:

[0169] FHV Primer Probe Set:

[0170] FHV-F:CTCTTTGAAACTGATGTTGTCGGTGGTAT

[0171] FHV-R:TCTTGCTTGATAGTGGGCGGTGATATAGG

[0172] FHV-P:FAM-CTCTTTGAAA(thf)(BHQ1-dT)GATGTTGTCGGTGGTAT-BHQ1(probe)

[0173] MYC Primer Probe Set:

[0174] MYC-F:GAAGTTGAAATAGTTGGATTACATGCTAC

[0175] MYC-R:GTGTGAGGGATAATTGAACCTGGTTTAGC

[0176] MYC-P:ROX-TTCAATATCTTCACG(THF)(BHQ2-dT)TTACTCCACGAA-BHQ2(probe)

[0177] FCD Primer Probe Set:

[0178] FCD-F:TACTGTTACGGTACAAGGACCTTTGGGAA

[0179] FCD-R:GGGTTCCAGGTTGTTAAGTTTAGGATTGC

[0180] FCD-P:HEX-TACATTGTGAGCAAGAG(THF)(BHQ1-dT)TGATTGGCATA-BHQ1(probe)

[0181] 2. Test methods

[0182] Use 25ul of fluorescent nucleic acid amplification reagent (RAA method) customized by Hangzhou Zhongce Biotechnology Co., Ltd. to perform RAA amplification, and the amplification system is prepared according to Table 14.

[0183] Table 14. RAA amplification system

[0184] name Single serving(ul) FHV-F 0.5 FHV-R 0.5 FHV-P or FHV-RP 0.2 MYC-F 0.5 MYC-R 0.5 MYC-P or MYC-RP 0.2 FCD-F 0.5 FCD-R 0.5 FCD-P or FCD-RP 0.2 TE 2.4 Starter 14 Total 20

[0185] Take 20ul of the above RAA amplification reagent and add it to a container containing lyophilized powder (the lyophilized powder specifically contains recombinase, recombinase auxiliary factor, single-stranded binding protein, nuclease, lyophilization protective agent, dNTP, creatine kinase, ATP, etc. For example, in this embodiment, 600ng / μl of recombinase; 150ng / μl of single-stranded DNA binding protein; 400ng / μl of DNA polymerase; 300ng / μl of nuclease; polyethylene glycol, 4%; Tris, 20mM; potassium acetate, 120mM; dithiothreitol, 6mM; adenosine phosphate, 4mM; creatine phosphate disodium salt, 50mM; phosphocreatine, 120ng / μl; deoxyribonucleoside triphosphate, 300μM; trehalose) reagent tube, then add 5ul mixed positive template (FHV, MYC, CHY each containing 1000 copies) and negative control to the reaction solution, cover the tube cap, put it into Biori 9600 isothermal fluorescence nucleic acid detector, 40℃, 40cycles 30s, collect FAM, HEX and ROX fluorescence.

[0186] 3. Experimental results

[0187] The Ct value detection results are shown in Table 15.

[0188] Table 15. Detection results of multiple amplification

[0189]

[0190]

[0191] According to Table 15, the lower the Ct value, the higher the RAA amplification efficiency. When the RAA probe designed in the manner provided by the present invention is used for triple amplification, most of the Ct values ​​of its RAA amplification detection results are significantly lower than the detection results of the existing RAA probe. It can be seen that the amplification efficiency is higher, and there will be no mutual influence leading to false negative or false positive detection results; when the existing RAA probe is used, the existing RAA probe base sequence is long and the amplification product sequence is long. This problem easily leads to self-pairing and mutual pairing between multiple probes and primers, significantly reducing the amplification efficiency and false positive production. For example, in the example, FHV and FCD appear false positive according to the existing RAA probe, and MYC fails to be amplified smoothly, resulting in a negative test. At the same time, the length of the RAA probe provided by the present invention for triple amplification is significantly shorter than that of the existing RAA probe, and the price is also lower, which has obvious advantages.

[0192] Example 8: Multi-probe detection system

[0193] 1. Primer probe design

[0194] In this example, a RAA amplification primer probe set was designed for the DNT1 gene of Bordetella spp. (Seq ID NO. 6), and multiple probe sets were designed according to the design methods of the existing RAA probes and the RAA probes provided by the present invention.

[0195] The designed primer probe sets are shown in Table 16, wherein BB-RP and BB-R-P2 are RAA probes designed according to the existing method, and BB-P and BB-P2 are RAA probes designed according to the method provided by the present invention.

[0196] Table 16. Primer probe set

[0197] name sequence BB-RP CAGTGGTTGATCGCACTCGATGTCTA(FAM-dT)thf(bhq1-dT)CGGCGTGTTGATCG-C3 BB-R-P2 TCGGCGTGTTGATCGCCGCCT(FAM-dT)THF(BHQ1-dT)CCCGCACTGCGATCAGCGA-C3 BB-P FAM-CACTCGATGTCTAT(THF)(BHQ1-dT)CGGCGTGTTGATCG-BHQ1 BP-R TACTCGAATACCAGGTCGCTGATCGCAGTG BP-F CAGGATGCTCGTACATGGTTCTATTATC BP-P2 FAM-GGTTTCCAAT(THF)(BHQ1-dT)GAAGAAAATGCAGGTG-BHQ1

[0198] 2. Test methods

[0199] Use 25ul of fluorescent nucleic acid amplification reagent (RAA method) customized by Hangzhou Zhongce Biotechnology Co., Ltd. to perform RAA amplification, and the amplification system is prepared according to Table 17.

[0200] Table 17. RAA amplification system

[0201]

[0202]

[0203] Take 20ul of the above RAA amplification reagent and add it to the reagent tube containing lyophilized powder (the lyophilized powder specifically contains recombinase, recombinase auxiliary factor, single-stranded binding protein, nuclease, lyophilization protective agent, dNTP, creatine kinase, ATP, etc., for example, in this embodiment, 600ng / μl of recombinase; 150ng / μl of single-stranded DNA binding protein; 400ng / μl of DNA polymerase; 300ng / μl of nuclease; polyethylene glycol, 4%; Tris, 20mM; potassium acetate, 120mM; dithiothreitol, 6mM; adenosine phosphate, 4mM; disodium phosphocreatine, 50mM; phosphocreatine, 120ng / μl; deoxyribonucleoside triphosphate, 300μM; trehalose), and then add 5ul of 10% dNTP containing DNT1. 3 , 10 4 , 10 5 The template and negative control at 100 copies / ml were added to the reaction solution, the tube was capped, and the tube was placed in the Hangzhou Xunling Biological Isothermal Fluorescence Nucleic Acid Detector (NAT-08A) at 40°C, 40 cycles for 30s, and FAM fluorescence was collected to calculate the Ct value.

[0204] 3. Experimental results

[0205] The Ct value detection results are shown in Table 18.

[0206] Table 18. RAA amplification detection results of the multi-probe system

[0207]

[0208] According to Table 18, the lower the Ct value, the higher the RAA amplification efficiency. According to the above test results, it can be seen from the comparison of combinations 2, 5, and 6 that when using the existing RAA probe, multiple probes cannot be used for amplification (combination 2), which is easy to cause mutual influence and false positive results. The reason is that the existing RAA probe base sequence is long and the amplification product sequence is long. This problem easily leads to self-pairing and mutual pairing between multiple probes and primers, which significantly reduces the amplification efficiency and may cause false positives, as well as significantly reduced sensitivity.

[0209] The RAA probe designed in the manner provided by the present invention can realize multi-probe amplification (combinations 5 and 6). Compared with the amplification of a single probe (combinations 3 and 4) and the existing RAA probe (combination 1), multi-probe amplification can significantly improve the detection sensitivity by 2-5 times. By comparing combinations 5 and 6, it can be seen that compared with the case of using one existing RAA probe and one new probe combination (combination 5), the use of two RAA probes designed in the manner provided by the present invention (combination 6) at the same time has higher detection sensitivity and accuracy when performing multi-probe amplification.

[0210] Example 9: Universal Probe Amplification

[0211] 1. Primer probe design

[0212] In this example, RAA amplification primer probe sets were designed for the Hepatozoon canis HC gene (Seq ID NO.7) and the Bartonella henselae 16S (BH) gene (Seq ID NO.8), and multiple sets of probes were designed according to the design methods of the existing RAA probes and the RAA probes provided by the present invention.

[0213] Table 19, Primer probe sequences

[0214]

[0215] 2. Test methods

[0216] Use 25ul of fluorescent nucleic acid amplification reagent (RAA method) customized by Hangzhou Zhongce Biotechnology Co., Ltd. to perform RAA amplification, and the amplification system is prepared according to Table 20.

[0217] Table 20. RAA amplification system

[0218]

[0219] Take 20ul of the above RAA amplification reagent and add it to a reagent tube containing lyophilized powder (the lyophilized powder specifically contains recombinase, recombinase auxiliary factor, single-stranded binding protein, nuclease, lyophilization protective agent, dNTP, creatine kinase, ATP, etc., for example, in this embodiment, 600ng / μl of recombinase; 150ng / μl of single-stranded DNA binding protein; 400ng / μl of DNA polymerase; 300ng / μl of exonuclease; polyethylene glycol, 4%; Tris, 20mM; potassium acetate, 120mM; dithiothreitol, 6mM; adenosine phosphate, 4mM; disodium phosphocreatine, 50mM; phosphocreatine, 120ng / μl; deoxyribonucleoside triphosphate, 300μM; trehalose), and then add 5ul of 10% Hepatozoon canis 3 , 10 4 , 10 5 The template and negative control at 100 copies / ml were added to the reaction solution, the tube was capped, and the tube was placed in the Hangzhou Xunling Biological Isothermal Fluorescence Nucleic Acid Detector (NAT-08A) at 40°C, 40 cycles for 30s, and FAM fluorescence was collected to calculate the Ct value.

[0220] Use 25ul of fluorescent nucleic acid amplification reagent (RAA method) customized by Hangzhou Zhongce Biotechnology Co., Ltd. to perform RAA amplification, and the amplification system is prepared according to Table 21.

[0221] Table 21. RAA amplification system

[0222]

[0223] Take 20ul of the above RAA amplification reagent and add it to a reagent tube containing lyophilized powder (the lyophilized powder specifically contains recombinase, recombinase auxiliary factor, single-stranded binding protein, nuclease, lyophilization protective agent, dNTP, creatine kinase, ATP, etc., for example, in this embodiment, 600ng / μl of recombinase; 150ng / μl of single-stranded DNA binding protein; 400ng / μl of DNA polymerase; 300ng / μl of nuclease; polyethylene glycol, 4%; Tris, 20mM; potassium acetate, 120mM; dithiothreitol, 6mM; adenosine phosphate, 4mM; disodium creatine phosphate, 50mM; phosphocreatine, 120ng / μl; deoxyribonucleoside triphosphate, 300μM; trehalose), and then add 5ul of 10% BH 3 , 10 4 , 10 5 The template and negative control at 100 copies / ml were added to the reaction solution, the tube was capped, and the tube was placed in the Hangzhou Xunling Biological Isothermal Fluorescence Nucleic Acid Detector (NAT-08A) at 40°C, 40 cycles for 30s, and FAM fluorescence was collected to calculate the Ct value.

[0224] 3. Experimental results

[0225] The Ct value detection results are shown in Table 22.

[0226] Table 22. Universal probe test results

[0227]

[0228]

[0229] According to Table 21, the lower the Ct value, the higher the RAA amplification efficiency. The RAA probe designed according to the method provided by the present invention can realize the amplification of a plurality of target genes by universal probes. For example, for the HC gene, when the universal probe is used for amplification (combination 1), its detection sensitivity can also be basically consistent with the detection result of the current probe (combination 2); for the BH gene, when the universal probe is used for amplification (combination 5), its detection sensitivity can also be basically consistent with the detection result of the current probe (combination 4).

[0230] When using existing RAA probes, it is impossible to amplify universal probes. The reason is that the currently used probes are tailored for specific target sequences, and they can accurately recognize and bind to target DNA or RNA sequences. However, if the target sequence of the probe is missing or cannot be amplified during the amplification process, these probes will not be able to perform their intended functions; and the existing RAA probe sequence is relatively long. If it is connected to a primer, the primer will be too long and affect the recombination rate, so it is difficult to prepare a universal probe. For example, in combination 3, BH-P was used to prepare a universal probe, which was connected to the 5 end of BH-PF. Since the BH-P sequence is as long as 70bp, the amplification efficiency is now reduced, resulting in amplification failure. It was found that amplification could not be achieved and the detection failed.

[0231] Example 10: Simultaneous testing of fluorescence and test strips

[0232] 1. Primer probe design

[0233] In this example, a RAA amplification primer probe group is designed for the feline parvovirus FPV gene (Seq ID NO.9). Multiple groups of probes are designed according to the design methods of existing RAA probes and the RAA probes provided by the present invention, respectively, in the hope of finding a RAA probe that can be used for both fluorescence detection and LFD reagent strip detection.

[0234] The designed primer probe set is shown in Table 22, wherein FPV-RP is a fluorescent RAA probe designed according to the existing method, FPV-P is a RAA probe designed according to the method provided by the present invention, FPV-RP is a RAA probe designed according to the design method of the commonly used probes in the existing LFD reagent strips, and FPV-R-P2 is a RAA probe designed according to the existing RAA probe design method.

[0235] Table 22. Primer probe sequences

[0236] name sequence FPV-F BIO-GGGCTTACCACCATTTCTAAATTCTTTGC FPV-R AGTCTGTATTTCCCATTTGAGTTACACCAC FPV-P FAMCACCAAAGTTAGTAG(THF)(BHQ1-dT)CCTTCAGATTGAG-BHQ1 FPV-RP FAMACGTCTTTTATCTTGTTGAACTCCTATA(THF)CACCAAAGTTAGTAGCTC-C3 FPV-R-P2 ACGTCTTTTATCTTGTTGAACTCCTA(FAM-dT)THF(BHQ1-dT)CACCAAAGTTAGTAGCTC-C3

[0237] 2. Test methods

[0238] Use 25ul of fluorescent nucleic acid amplification reagent (RAA method) customized by Hangzhou Zhongce Biotechnology Co., Ltd. to perform RAA amplification, and the amplification system is prepared according to Table 23.

[0239] Table 23. RAA amplification system

[0240]

[0241]

[0242] Take 20ul of the above RAA amplification reagent and add it to the reagent tube containing lyophilized powder (the lyophilized powder specifically contains recombinase, recombinase auxiliary factor, single-stranded binding protein, nuclease, lyophilization protective agent, dNTP, creatine kinase, ATP, etc., for example, in this embodiment, 600ng / μl of recombinase; 150ng / μl of single-stranded DNA binding protein; 400ng / μl of DNA polymerase; 300ng / μl of nuclease; polyethylene glycol, 4%; Tris, 20mM; potassium acetate, 120mM; dithiothreitol, 6mM; adenosine phosphate, 4mM; disodium phosphocreatine, 50mM; phosphocreatine, 120ng / μl; deoxyribonucleoside triphosphate, 300μM; trehalose), and then add 5ul of FPV with a concentration of 10 5 Add the template and negative control of 100 copies / ml to the reaction solution, cover the tube cap, and put it into the Hangzhou Xunling Biological Isothermal Fluorescence Nucleic Acid Detector (NAT-08A), 40℃, 40 cycles 30s, and perform fluorescence detection and LFD reagent strip detection respectively. Fluorescence detection requires collecting FAM fluorescence and calculating Ct value; LFD reagent strip detection requires taking 5ul of amplification at room temperature, adding 195ul of water, shaking and mixing, taking 40ul and adding it to the test strip, and observing the test results after 5min.

[0243] The preparation method of the LFD reagent strip is as follows: the LFD reagent strip is composed of a sample pad, a gold label pad, a nitrocellulose filter membrane (NC membrane), an adsorption pad and a bottom plate stacked in succession; colloidal gold nanoparticles are synthesized by sodium citrate tannin reduction method, labeled with anti-FAM monoclonal antibody, and sprayed on the gold label pad; a detection line and a quality control line are provided, the detection line is coated with streptavidin (2.0 mg / mL), and the quality control line (C line) is coated with goat anti-mouse polyclonal secondary antibody (pAb, 2.0 mg / mL). The immobilized membrane is dried at 37°C for 12 hours, cut into 2.5 mm wide strips with a knife, assembled into LFD test strips, and stored in a vacuum bag at room temperature.

[0244] 3. Experimental results

[0245] The fluorescence detection results are shown in Table 24, and the amplification curves are shown in Figures 8 to 10 , wherein combination 1 is the fluorescence detection result of the RAA probe FPV-P designed according to the method provided by the present invention ( Figure 8 ); Combination 2 is the fluorescence detection result of the RAA probe designed according to the design method of the commonly used probes in the existing LFD reagent strips ( Fig. 9 ); Combination 3 is the fluorescence detection result of RAA probe FPV-RP designed according to the existing method ( Fig.10 ).

[0246] Table 24. Fluorescence detection results

[0247]

[0248] According to Table 24 and Figures 8 to 10 It can be seen that the lower the Ct value, the higher the RAA amplification efficiency and the higher the detection sensitivity. When the FPV-R-P2 probe (combination 3) designed in the existing manner is used, the detection sensitivity is significantly lower than the fluorescence detection result of the RAA probe FPV-P (combination 1) provided by the present invention. The reason is that the FPV-P probe sequence is shorter, the recombination rate is higher, the amplification effect is better, and the amplification product is also shorter and easier to detect. However, the RAA probe FPV-RP (combination 3) designed using the common probe design method of the existing LFD reagent strip has a very low detection sensitivity and cannot successfully detect 10 5 copies / ml of positive samples.

[0249] The test results of LFD test strips are shown in Figures 11 to 13 ,in Fig.11 is the detection result of combination 1, Fig.12 is the detection result of combination 2, Fig.13 is the test result of combination 3. Fig.13 It can be seen that the RAA probe FPV-R-2P designed in the existing manner can only realize fluorescence detection, but cannot realize LFD test strip detection, and the detection results are all false negatives; while the RAA probe FPV-P designed in the manner provided by the present invention can be used for both fluorescence detection and LFD test strip detection. The reason may be that the RAA probe FPV-P provided by the present invention, whose quenching group can act as a blocking group, and the fluorescent group is set at the 5' end. After the site where the tetrahydrofuran is located is cut by the nuclease exonuclease, the remaining 5' end sequence will not be affected by the fluorescent group, and can still form a new amplification product with the reverse primer to continue amplification, thereby enabling LFD detection.

[0250] Comparing the results of combination 1 and combination 2, it can be seen that the sensitivity of LFD detection by the RAA probe FPV-P (combination 1) provided by the present invention is higher. The reason may be that the FPV-RP probe sequence is shorter, the recombination rate is higher, the amplification effect is better, and the amplification product is also shorter and easier to detect, thereby making the sensitivity of LFD detection higher.

[0251] Example 11: The RAA probe provided by the present invention cannot be used in the QPCR system

[0252] 1. Primer probe design

[0253] In this example, the RAA amplification primer probe group was designed for the conserved sequence (Seq ID NO.10) in the 18S gene of Babesia. Two sets of probes were designed according to the design methods of the existing QPCR probe and the RAA probe provided by the present invention, respectively. The QPCR probe was BAC-P, and the RAA probe provided by the present invention was BAC-RP, as shown in Table 25 for details.

[0254] Table 25. Primer probe set

[0255] name sequence BAC-F CTGTCAGAGGTGAAATTCTTAGA BAC-R GGCATGGTTTATGGTTAGGA BAC-P FAM-ACTACTGCGAAAGCATTTGCCAAGGACG-BHQ1 BAC-RF GATTTGTTAAAGACGAACTACTGCGAAAGC BAC-RR TTATGGTTAGGACTACGACGGTATCTGAT BAC-RP FAM-TTGCCAAGGACGTTTCC(THF)(BHQ1-dT)TAATCAAGAACGAA-BHQ1

[0256] 2. Test methods

[0257] Use Beijing Quanshijin Biotechnology Co., Ltd. IIProbe qPCR SuperMix (AQ711-01) reagents were used for QPCR amplification. The amplification system was prepared according to Table 26:

[0258] Table 26. QPCR Amplification Reagents

[0259]

[0260] Then add 5ul of 10 5 The template and negative control were 500 copies / ml, capped, and placed in the Biori 9600 detection instrument, 94℃, 30s, 40 cycles: 95℃10s, 60℃30s to collect FAM fluorescence,

[0261] RAA amplification was performed using 25ul of fluorescent nucleic acid amplification reagent (RAA method) customized by Hangzhou Zhongce Biotechnology Co., Ltd. The amplification system was prepared according to Table 3:

[0262] Table 3. RAA amplification reagents

[0263]

[0264]

[0265] Take 20ul of the above RAA amplification reagent and add it to the reagent tube containing lyophilized powder (lyophilized powder contains recombinase, recombinase auxiliary factor, single-stranded binding protein, nuclease, lyophilization protective agent, dNTP, creatine kinase, ATP, etc., such as recombinase 600ng / μl; single-stranded DNA binding protein 150ng / μl; DNA polymerase 400ng / μl; nuclease 300ng / μl; polyethylene glycol, 4%; Tris, 20mM; potassium acetate, 120mM; dithiothreitol, 6mM; adenosine phosphate, 4mM; creatine phosphate disodium salt, 50mM; phosphocreatine, 120ng / μl; deoxyribonucleoside triphosphate, 300μM; trehalose), and then add 5ul of 10% 18S gene containing Babesia spp. 5 The template and negative control were 100 copies / ml, capped, and placed in the Hangzhou Xunling Biological Isothermal Fluorescence Nucleic Acid Detector (NAT-08A) at 40°C, 40 cycles for 30s, and FAM fluorescence was collected. Each group was repeated twice and the Ct value was detected.

[0266] 3. Analysis of experimental results

[0267] The Ct value detection results are shown in Table 3.

[0268] Table 3. Ct value detection results of two groups of probes

[0269]

[0270] According to Table 3, the newly designed RAA probe BAC-RP can only be used in the RAA system of combination 3 and cannot be detected in the QPCR system of combination 2. Similarly, BAC-P can only be used in the QPCR system of combination 1 and cannot be detected in the RAA system.

[0271] Although the above description has been given with general description and preferred implementation cases, it is not intended to limit the present invention. Any modification, equivalent substitution, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

[0272]

[0273]

[0274]

Claims

1. A probe for isothermal amplification, characterized in that: It includes a fluorescent group and two quenching groups; the fluorescent group is located at the 5' end of the probe sequence; the first quenching group is located between the fluorescent group and the second quenching group, and the second quenching group is located at the 3' end of the probe sequence, or between the first quenching group and the 3' end; the isothermal amplification includes RAA and RPA isothermal amplification.

2. The probe according to claim 1, characterized in that Also included is tetrahydrofuran, which is located on the probe sequence between the fluorescent group and the first quencher group.

3. The probe according to claim 2, characterized in that The first quenching group is located 12 to 20 bases away from the fluorescent group.

4. The probe according to claim 3, characterized in that The tetrahydrofuran is located 10 to 18 bases away from the fluorescent group.

5. The probe according to claim 5, characterized in that The second quencher group is located at the 3' end of the probe sequence; the second quencher group is 10 to 18 bases away from the first quencher group.

6. The probe according to claim 7, characterized in that The total length of the probe is 27 to 32 bases.

7. An isothermal amplification primer probe set, characterized in that: It comprises the probe according to any one of claims 1 to 8, and primers, and the isothermal amplification comprises RAA and RPA isothermal amplification.

8. An isothermal amplification kit, characterized in that: It comprises the isothermal amplification primer probe set as described in claim 7, and reagents for isothermal amplification, wherein the reagents comprise recombinase and exonuclease; and the isothermal amplification comprises RAA and RPA isothermal amplification.

9. A method for isothermal amplification, characterized in that: Isothermal amplification is performed using the probe according to any one of claims 1 to 8, wherein the isothermal amplification includes RAA and RPA isothermal amplification.

10. Use of a probe for preparing a reagent for a multi-probe detection system for improving the sensitivity of target nucleic acid detection, characterized in that: The probe includes a fluorescent group and two quenching groups; the fluorescent group is located at the 5' end of the probe sequence; the first quenching group is located between the fluorescent group and the first quenching group, and the second quenching group is located at the 3' end of the probe sequence, or between the first quenching group and the 3' end; The probe is used for isothermal amplification, and the isothermal amplification includes RAA and RPA isothermal amplification.

Images