SNP (Single Nucleotide Polymorphism) marker combination associated with high muscle elasticity character of large yellow croaker and breeding application

Abstract

The invention provides a larimichthys crocea high muscle elasticity character associated SNP marker combination and breeding application, the combination is prepared from a probe of 13 SNP molecular marker combinations for detecting larimichthys crocea muscle elasticity characters, and information of positions, alleles with changed sites and reference genes of all SNP molecular markers on chromosomes is shown in a table 1. By means of the SNP marker combination, the optimal large yellow croaker individuals with the high muscle elasticity potential and a certain scale can be selected from breeding offspring in advance, breeding and breed conservation are carried out, the large yellow croaker individuals are bred to the parent, breeding and breed conservation do not need to be carried out on a large number of offspring seeds in the breeding process, and the breeding cost can be greatly reduced. The SNP marker combination can solve the problem that non-lethal detection of the muscle elasticity of the pseudosciaena crocea cannot be realized in a traditional breeding mode, and can ensure smooth development of breeding work of the high muscle elasticity character of the pseudosciaena crocea.

Description

Technical Field

[0001] The invention belongs to the field of fish genetic breeding, relates to the technical field of fish molecular marker-assisted breeding, and specifically relates to a SNP marker combination associated with a high muscle elasticity trait of large yellow croaker and a breeding application thereof. Background Art

[0002] Large yellow croaker is currently an important marine cage-cultured fish in China, with an annual aquaculture output of over 280,000 tons. With the breakthrough in artificial breeding technology of large yellow croaker, research on genetic breeding of large yellow croaker has also been gradually carried out. So far, four new varieties of large yellow croaker, "Minyou No. 1", "Donghai No. 1", "Yongdai No. 1" and "Fufa No. 1", have been bred one after another. However, problems such as germplasm degradation, frequent diseases, lack of high-quality and highly resistant varieties, and low coverage of improved varieties are still prominent problems facing the current development of the large yellow croaker industry. Therefore, with the development of the aquaculture industry, especially the innovation and upgrading of aquaculture models, the existing new varieties of large yellow croaker are far from meeting the actual needs of the current development of the large yellow croaker industry.

[0003] With the rapid development of the large yellow croaker farming industry and the increasing demand for high-quality fish, research on fish quality breeding has become more and more urgent. In recent years, the problem of declining quality of farmed large yellow croaker has become a problem in the industry. According to the Ningde local standard "Technical Specifications for Farmed Large Yellow Croaker Grade Assessment" and the Fujian local standard "Grade Specifications for Farmed Large Yellow Croaker", muscle elasticity is one of the quantifiable indicators for determining the quality of large yellow croaker. Since the detection of muscle elasticity can cause death and damage to fish, conventional biochemical detection methods cannot be used to screen the breeding population, and breeding work for large yellow croaker with high muscle elasticity must be carried out at the genotype level. However, the breeding cost based on the whole genome selection method is too high, so the technical route of using molecular markers to assist breeding is more feasible. As we all know, the change of phenotypic traits is the result of both environmental and genetic influences. Therefore, it is necessary to select large yellow croakers with high muscle elasticity under the same farming mode (same environmental factors), determine the SNP marker combination associated with the large yellow croaker's high muscle elasticity trait by analyzing its genotype, and then carry out breeding work for large yellow croaker with high muscle elasticity through molecular marker-assisted technology. In view of this, a molecular marker-assisted breeding technology is needed for the selection of large yellow croaker with high muscle elasticity. Summary of the invention

[0004] In response to the above technical problems, the present invention provides a SNP marker combination associated with high muscle elasticity trait of large yellow croaker and corresponding breeding applications, which can achieve low-cost and efficient genetic improvement of high muscle elasticity trait of large yellow croaker, and can be used for genotype identification, muscle elasticity trait association analysis and genome selection breeding of large yellow croaker breeding populations.

[0005] In order to achieve the above object, the technical solution provided by the present invention is as follows:

[0006] In the first aspect of the present invention, a combination of SNP markers associated with high muscle elasticity traits of large yellow croaker is provided, which is based on whole genome resequencing of large yellow croaker populations with high and low muscle elasticity, and uses whole genome association analysis ( Figure 1 The 13 SNP markers were screened by Manhattan plot, and the nucleotide sequences of these SNP markers are shown in Table 1.

[0007] Table 1 Nucleotide sequences where SNP markers are located

[0008]

[0009] The specific meanings of the English headings in Table 1 above are as follows: Mark represents the number of the single nucleotide polymorphism marker;

[0010] Chr (chromosome) represents the chromosome number; Position represents the physical position of the SNP marker on the chromosome; REF represents the reference allele of the SNP site; ALT represents the altered allele of the SNP site; P represents the significant value of the SNP marker in the whole genome association analysis. MAF represents the frequency of the minor allele, and MarkerR2, that is, the phenotypic explanation rate PVE, represents the proportion of phenotypic differences explained by each SNP marker.

[0011] The sequences of 50 bp before and after the 13 sites on the genome are as follows, where the SNP sites are in brackets.

[0012] LG3_22063281

[0013] CTTAGTCAATAAATTATTGTATTCATAACTTGATTGACTGCTTTTATCAA(G / T)ACAT TTGCATTTCATAACAGAAGCCATGTGTGCGTAATGAAACTGGAATT(SEQ ID NO.1); LG3_25705237

[0014] TACATATTATTTCAAAAGTTTCAAAATGTTTGACTTTTGGGTGACATTTATG(G / T)AA AATGTAAAAGGTTCATGGTACAGTGACCTATCATGAAAGTAGGACATT(SEQ ID NO. 2);

[0015] LG4_353695

[0016] CCGCTGTATAAAAGCAAACGTCTAATTTGAGACTAATTAGCCAGACAAGGA(G / C)T TGCAATAAAATGTCACACAATACCTCACAGATCACCCACCTAGATCTCT(SEQ ID NO.3);

[0017] LG6_20286926

[0018] AGGAAGTGTAAATTGATGAAGAAATGTATGGGGAAAAATGACAACACATC(G / A)CCCTTTGATTTGAAATTACCTTGATCAACATGGCAATTTGGGGGACTAA(SEQ ID NO.4);

[0019] LG8_5191273

[0020] CTCCTTGAGTAAACACACACAGACTGTAGGCATGTGGCAGGGTGAGGAAA(G / T)ATGGTGAGCGAGGGAGCGTTATGGCGTCGTCGTTCAAGATGAAGGACAAT(SEQ ID NO.5);

[0021] LG9_5135105

[0022] TGGTCCAACAACCCAGGATTCTTCTTCGCTTCTGAGGGATCCTTTGAGAG(T / A)TT ATGGCGTTTTCCGGAGATCCCTGGAGGGCTTTTTCACAGCCTGCTGTTC(SEQ ID NO.6);

[0023] LG10_19857056

[0024] GGTCAACATTTATTCAGCACCAGCTCAGCCAAGTCCAGTTAGTTTTCAT(T / A)TA CATTTCATTGCAGTTGCTCTGTCTGTTAAGCGGAGATGTTATAAATA(SEQ ID NO.7);LG10_24024503

[0025] CTGCAAACTAGTTATCTTAGTTACTGTAACTTGCTTATCTCGGAAATTGA(T / C)AA ACTCGGCTGTAATTTTCCAGGTGTTCCCAATTAACCCCTGTGTGTGAG(SEQ ID NO.8);

[0026] LG21_10164961

[0027] TCCTGTATAATCGTCACGTTCTTCTTCTCCAGTTTCTTTGTGCAGCTCAG(C / T)GTG TCAGCATTTGGCTTCAGAGCAGCCGAGGTCTCTCGAGGAAAAACTTC(SEQ ID NO.9);

[0028] LG21_10180334

[0029] ACATTGCCCTATCATGGTAGGCAGTGTGTTACGTACCAGAGTTACCTTCT(G / A)TA GTAACCACAGAGGTGCTCATAGCCTGGCTGCTGCCGCTGCTGTGAGGT(SEQ ID NO.10);

[0030] LG22_10770525

[0031] TCCAGAATGAAACTTGGTCCCTGATGGTCTCTTAAGTGCAGTGTGACGGC(G / A)G GTTGTAAGTCATTCCTCAGAATAGACTGGAGCACTTTGTTTACCTCTGC(SEQ ID NO.11);

[0032] LG22_10781614

[0033] ATATATTTATGCAATTATGCACACATGTACATACCTGTACACACAGAGAC(G / A)CAC ACACATACTTCTCTATCCTTTCCTTCCCCTCTTTTCATCCTTTCTCC(SEQ ID NO.12);

[0034] LG22_19147022

[0035] CTGAGATTTTTTGACTTGAGTCACATCATTCTTGTCTAAAGCTGCCATCT(A / T)TTT CTACCAAATGATGTCTAAAAAGGCAGTGATGCCAAGAAAAAGAAAAAA (SEQ ID NO. 13).

[0036] In a second aspect, the present invention provides a chip loaded with the above-mentioned large yellow croaker high muscle elasticity trait associated SNP marker combination.

[0037] Preferably, the chip is a solid-state chip or a liquid-phase chip.

[0038] The third aspect of the present invention provides the use of the above-mentioned SNP marker combination or chip associated with the high muscle elasticity trait of large yellow croaker in the genotype identification of the high muscle elasticity trait of large yellow croaker or the breeding of the high muscle elasticity trait.

[0039] In a fourth aspect, the present invention provides a method for breeding large yellow croaker with high muscle elasticity, comprising the following steps:

[0040] (1) Collect and keep alive the basic population of large yellow croaker for breeding, and cultivate it to parents as candidate parents, with a female-to-male ratio of 3:1;

[0041] (2) Using a non-lethal sampling method, collect fin ray samples from the dorsal fin of large yellow croaker parents, store them in anhydrous ethanol, and replace the anhydrous ethanol every 12 hours within 24 hours;

[0042] (3) extracting DNA from parental fin samples, performing genotyping on the above-mentioned SNP markers, and ensuring that the genotyping of all SNP markers is successful;

[0043] (4) According to the genotyping results, the RandomForest model was used to calculate the breeding value GEBV of parental individuals using the R language package randomForest;

[0044] (5) The parent individuals of large yellow croaker were ranked according to their GEBV levels, and the top 10% of the individuals were selected as breeding parents for artificial breeding. The male-female ratio was controlled at 3:1. The offspring obtained were new large yellow croaker germplasm with high muscle elasticity.

[0045] The research results show that the muscle elasticity value of the large yellow croaker with high muscle elasticity bred by the present invention is increased by more than 15% compared with the non-selected breeding group.

[0046] Therefore, the fifth aspect of the present invention also provides the application of the above-mentioned SNP marker combination associated with high muscle elasticity trait of large yellow croaker in the genetic improvement of muscle elasticity.

[0047] Functions and Effects of the Invention

[0048] (1) The 13 SNP marker combinations of the present invention can be used to quickly and accurately select large yellow croaker breeding parents with high muscle elasticity, greatly improving breeding efficiency.

[0049] (2) The SNP marker combination of the present invention can be used to select the best large yellow croaker individuals of a certain size with high muscle elasticity potential from the breeding offspring in advance, and then culture and preserve the seeds and cultivate them to the parents. There is no need to culture and preserve a large number of offspring seedlings during the breeding process, which can greatly reduce the breeding cost.

[0050] (3) The use of the SNP marker combination of the present invention can solve the problem that the traditional breeding method cannot realize non-lethal detection of large yellow croaker muscle elasticity, and can ensure the smooth development of large yellow croaker high muscle elasticity trait breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 Manhattan plots of genome-wide association analyses are shown. DETAILED DESCRIPTION

[0052] The present invention is described in detail below in conjunction with the embodiments and the accompanying drawings. However, the following embodiments should not be considered as limiting the scope of the present invention.

[0053] Example 1 Detection of SNP marker combinations in large yellow croaker populations with high and low muscle elasticity

[0054] In 2022, a genotyping experiment of large yellow croaker with high muscle elasticity and low muscle elasticity was carried out, following the following steps:

[0055] (1) The muscle elasticity of individual yellow croakers was detected using a texture analyzer. According to the size of the muscle elasticity, the yellow croaker population was divided into a high muscle elasticity group (muscle elasticity value 1.52±0.14mm) and a low muscle elasticity group (muscle elasticity value 0.82±0.10mm), with no less than 300 fish in each group.

[0056] (2) The genomic DNA of large yellow croaker individuals with high and low muscle elasticity was extracted and whole genome resequencing was performed.

[0057] (3) The genotyping success rate of the SNP markers included in the present invention is 100%.

[0058] (4) The detection of the SNP marker combination included in the present invention in the large yellow croaker populations with high and low muscle elasticity is shown in Table 2:

[0059] Table 2 Detection of SNP marker combinations in large yellow croaker populations with high and low muscle elasticity

[0060]

[0061]

[0062] Example 2 Cultivation of new germplasm of large yellow croaker with high muscle elasticity

[0063] In 2023, the present invention was used to carry out the breeding of large yellow croaker with high muscle elasticity, and a new F1 generation of large yellow croaker with high muscle elasticity was obtained. The specific steps are as follows:

[0064] (1) More than 800 large yellow croaker parents were selected from the breeding base population as candidate parents, with a male-female ratio of 3:1.

[0065] (2) Collect fin ray samples from the posterior end of the dorsal fin of candidate large yellow croaker parents, store them in anhydrous ethanol, and replace the anhydrous ethanol every 12 hours within 24 hours.

[0066] (3) Extract genomic DNA from samples and perform genotyping using SNP liquid phase breeding chips.

[0067] (4) The genotyping success rate of the SNP marker combination of the present invention is 100%.

[0068] (5) The breeding value (GEBV) of the parent individuals was calculated using the RandomForest model and the R language package randomForest. The GEBV of the candidate parent individuals was calculated (the larger the value, the higher the muscle elasticity). The male and female individuals were ranked according to their height, and the top 10% of the individuals were selected as the breeding parent group, with a male-female ratio of 3:1 (see Table 3).

[0069] Table 3 Breeding values ​​of breeding parents

[0070]

[0071] (6) In May 2023, approximately 1 million F1 generation yellow croaker germplasm seedlings with high muscle elasticity will be obtained through artificial induction of abortion.

[0072] (7) In May 2024, 60 large-sized F1 generation fish (average body weight 120 g) were randomly selected, and the individual muscle elasticity values ​​were detected using a texture analyzer (Table 4). The research results showed that the muscle elasticity value of the large yellow croaker with high muscle elasticity bred by the present invention was increased by more than 15% compared with the non-selected population.

[0073] Table 4 Muscle elasticity values ​​of large yellow croaker in breeding and non-breeding populations

[0074]

[0075] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only for explaining the principles of the present invention. The present invention may be subject to various changes and improvements without departing from the spirit and scope of the present invention. These changes and improvements fall within the scope of the present invention. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A SNP marker combination associated with high muscle elasticity trait of large yellow croaker, characterized in that: The probes were prepared from 13 SNP molecular marker combinations for detecting the muscle elasticity of large yellow croaker. The location of each SNP molecular marker on the chromosome, the allele of the site change, and the reference gene information are shown in the following table:

2. A chip loaded with the SNP marker combination associated with the high muscle elasticity trait of large yellow croaker according to claim 1.

3. The chip according to claim 2, characterized in that: The chip is a solid chip or a liquid chip.

4. Use of the SNP marker combination associated with the high muscle elasticity trait of large yellow croaker according to claim 1 in genotype identification of the high muscle elasticity trait of large yellow croaker or breeding of the high muscle elasticity trait.

5. A method for breeding large yellow croaker with high muscle elasticity, characterized in that: The method is carried out using the SNP marker combination according to claim 1, comprising the following steps: (1) Collecting and keeping alive the basic population of large yellow croaker for breeding, and cultivating it to parents as candidate parents; (2) Samples were collected using a non-lethal sampling method and stored in anhydrous ethanol, with the anhydrous ethanol replaced every 12 hours within 24 hours; (3) extracting DNA from parental samples, performing genotyping on the above-mentioned SNP markers, and ensuring that the genotyping of all SNP markers is successful; (4) Calculate the breeding value GEBV of the parent individuals based on the genotyping results; (5) The parent individuals of large yellow croaker were ranked according to their GEBV levels, and the individuals with the highest ranking were selected as breeding parents for artificial breeding. The male-female ratio was controlled at 3:

1. The offspring obtained were the new large yellow croaker germplasm with high muscle elasticity.

6. The method for breeding large yellow croaker with high muscle elasticity trait according to claim 5, characterized in that: In step (1), the male-female ratio of the candidate parents is 3:1; In step (2), a non-lethal sampling method is used to collect a fin ray sample from the end of the dorsal fin of the large yellow croaker parent; In step (3), DNA is extracted from the parental fin ray sample; In step (4), the RandomForest model is used to calculate the breeding value GEBV of parent individuals using the R language package randomForest.

7. The method for breeding large yellow croaker with high muscle elasticity trait according to claim 5, characterized in that: in, Males and females were ranked according to GEBV, and the top 10% of the individuals were selected as the breeding parent group, with a male-female ratio of 3:

1.

8. Use of the SNP marker combination associated with high muscle elasticity trait of large yellow croaker according to claim 1 in genetic improvement of muscle elasticity of large yellow croaker.

Images