Human embryo kidney monoclonal cell strain and application thereof in packaging recombinant adeno-associated virus

Abstract

The invention discloses a construction method of a human embryonic kidney cell monoclonal cell strain and application of the human embryonic kidney cell monoclonal cell strain in adeno-associated virus vector production. The cell strain constructed by the invention adapts to suspension culture of a chemical component determination culture medium, the growth is rapid, the toxin production level can be 3-9 times that of a female parent cell, the highest virus titer is about 1.20 E14VG / L, and the yield of the leading toxin production cell strain in the industry is achieved.

Description

Technical Field

[0001] The present invention relates to the fields of molecular biology and biopharmaceuticals, and in particular to a method for constructing a human embryonic kidney monoclonal cell line and its application in packaging viral vectors, especially in the production of recombinant adeno-associated virus (rAAV). Background Art

[0002] Adeno-associated virus (AAV) is a non-pathogenic single-stranded DNA virus and a small virus. Due to its natural low immunogenicity, relatively high infection efficiency and long-lasting expression effect, recombinant AAV (rAAV) is widely used as a vector for gene delivery and gene therapy, and is used to treat a variety of diseases such as genetic diseases, cancer, and neurological diseases. With the vigorous development of rAAV gene therapy products, many rAAV gene therapies have been approved for marketing worldwide, and new candidate products continue to enter the clinical trial stage.

[0003] However, the current limited production capacity of rAAV vectors is a major challenge to the continued expansion of clinical and commercial product development needs. Limited production capacity is one of the main reasons for the high cost of gene therapy, and the high price has seriously reduced the accessibility of patients to drugs. A key issue with limited production capacity is the low efficiency of host cell AAV production, which particularly limits the dosing of high-dose indications. rAAV vector production is a complex process. The production of high-quality rAAV vectors requires an efficient cell culture system, an effective vector construction strategy, and precise and robust process control. Among them, high-yield host cells are the top priority in the rAAV vector production process. Therefore, the construction of high-yield cell lines is of great significance for reducing the production cost of rAAV vectors and increasing production capacity.

[0004] The current mainstream rAAV production process is to use transfection reagents such as PEI and other cationic polymers to transiently transfect three plasmids (including target gene plasmid, Rep-Cap plasmid and Helper plasmid) into host cells (usually adherent HEK293 cells). This process is difficult to scale up and costly, and the culture of adherent HEK293 cells requires animal-derived culture additives such as fetal bovine serum FBS, which poses a greater safety risk. In recent years, animal-free culture media and suspension culture methods have gradually become more promising development directions, which are of great significance for improving production capacity and product safety. Summary of the invention

[0005] The purpose of the present invention is to provide a high-productivity human embryonic kidney monoclonal cell line and a construction method thereof, and to apply the cell line to recombinant adeno-associated virus packaging.

[0006] The first aspect of the present invention provides a human embryonic kidney monoclonal cell line and its progeny cells, wherein

[0007] (1) The cell line is acclimated with an animal-free medium and adapted to suspension culture; (2) the doubling time of the cell line during culture is ≤24 hours; (3) the cell line is suitable for packaging adeno-associated virus (AAV), and its virus expression titer is at least twice that of the parent cell.

[0008] In another preferred embodiment, the virus expression titer of the cell line is 3-9 times that of the parent cell.

[0009] In another preferred embodiment, the human embryonic kidney monoclonal cell line is human embryonic kidney cell HEK293-ORB1H8 with a preservation number of CCTCC NO: C2024174.

[0010] In another preferred embodiment, the animal-derived component-free culture medium is OPM-293CD05 culture medium.

[0011] In another preferred embodiment, the adeno-associated virus includes: AAV1, AAV2, AAV3, AAV5, AAV6, AAV7, AAV8 and AAV9 serotypes.

[0012] In another preferred embodiment, the adeno-associated virus is of AAV5 serotype.

[0013] In another preferred embodiment, the adeno-associated virus is a recombinant adeno-associated virus (rAAV).

[0014] The second aspect of the present invention provides a method for constructing a human embryonic kidney monoclonal cell line as described in the first aspect of the present invention, the method comprising the following steps:

[0015] (S1) Cell acclimation: HEK293 cells are acclimated to an animal-derived component-free medium without an anti-agglomerating agent to obtain acclimated HEK293 cells;

[0016] (S2) Monoclonal sorting: After culturing the acclimated HEK293 cells for 2-3 days, the cells are diluted to a suitable density and sorted into a 96-well plate prepared in advance, so that the cell density in each well is 1 cell / well, and the monoclonal cells in the 96-well plate are cultured; wherein V1 volume of cloning medium is added to the 96-well plate in advance;

[0017] (S3) clone expansion culture: after culturing the monoclonal cells in step (S2) for 10-15 days, observe the recovery of clones in each well of the 96-well plate; when the confluence of clones reaches 65%-75%, gradually transfer the clones to 24-well plates and 6-well plates for culture; when the confluence of clones in the 6-well plate reaches 65%-75%, transfer the clones to 50 mL shake tubes for culture; wherein, clone culture uses clone medium;

[0018] (S4) Screening clones with high transfection efficiency: using the clones obtained in the transient transfection step (S3) of the plasmid expressing the reporter gene, detecting the expression of the reporter gene in the clones, screening out clones with high expression of the reporter gene, and performing adeno-associated virus (AAV) packaging experiment screening;

[0019] (S5) AAV packaging experiment screening: AAV packaging was performed using a three-plasmid transient transfection method to detect the AAV virus titer level in the clones, and clones with high AAV virus titer levels, i.e., high-yield clones, were selected according to the AAV virus titer level ranking;

[0020] (S6) performing a second round of AAV packaging experiment screening on the AAV high-yield clone selected in step (S5), detecting the AAV virus titer level in the clone, and selecting the final clone based on the AAV virus titer level and cell growth status, thereby obtaining the human embryonic kidney monoclonal cell line.

[0021] In another preferred embodiment, in the step (S1), "acclimation is completed" means that the cell viability is maintained at more than 95% for three consecutive generations, and the doubling time is stabilized at 20-30 hours.

[0022] In another preferred embodiment, in the step (S1), the live cell density is maintained at 15-40E5 live cells / mL during cell passaging, and the cells are passaged every 2-4 days.

[0023] In another preferred embodiment, in the step (S2), V1 is 80-150 μL, preferably 100 μL.

[0024] In another preferred embodiment, in the steps (S2) and (S3), the cloning culture medium comprises: host cell supernatant, growth factor additives, GlutaMAX additives and animal-free culture medium; wherein,

[0025] The ratio of the host cell supernatant is 0-50% (v / v), preferably, 20-30% (v / v);

[0026] The ratio of the growth factor additive is 0-10% (v / v), preferably 3%-8% (v / v), and most preferably 5% (v / v);

[0027] The concentration of the GlutaMAX additive is 0-8 mM, preferably 2-4 mM, and most preferably 2 mM; calculated based on the total volume of the cloning culture medium.

[0028] In another preferred embodiment, the host cell supernatant is the cell culture supernatant obtained by culturing and acclimating HEK293 cells for 2-3 days, followed by centrifugation and filtration.

[0029] In another preferred embodiment, the growth factor additive is Solentim InstiGRO HEK or StemcellClonaCell-CHO ACF additive.

[0030] In another preferred embodiment, the animal-derived component-free culture medium is OPM-293CD05 culture medium.

[0031] In another preferred embodiment, in the step (S2), the cells are sorted into a 96-well plate into which cloning culture medium is added in advance using a TECAN UNO single cell sorter.

[0032] In another preferred embodiment, in the step (S2), 2 hours, 24 hours and 5 days after sorting, the 96-well plate is photographed and visually inspected using an inverted microscope to record the growth of monoclonal cells.

[0033] In another preferred embodiment, in the steps (S2) and (S3), the culture conditions of the clones in the 96-well plate, 24-well plate and 6-well plate are 37°C, 6% CO 2 cultured in an incubator.

[0034] In another preferred embodiment, in step (S3), the culture conditions of the clones in the 50 mL shake tube are 37°C, 8% CO 2 , 85% humidity, 225 rpm, and an amplitude of 25 mm in a shaker.

[0035] In another preferred embodiment, in the step (S4), the plasmid expressing the reporter gene is a plasmid expressing luciferase (luc).

[0036] In another preferred embodiment, in steps (S5) and (S6), the AAV virus titer level in the clone is detected using a real-time fluorescence quantitative PCR (QPCR) method or a droplet digital PCR (ddPCR) method.

[0037] In another preferred embodiment, in the step (S6), the criteria for selecting the final clone according to the AAV virus titer level and cell growth status are:

[0038] (i) AAV viral titer levels are at least 2-fold higher than those in parental cells; and

[0039] (ii) Rapid growth, with cell doubling time ≤ 24 hours.

[0040] The third aspect of the present invention provides the use of the human embryonic kidney monoclonal cell line and its progeny cells as described in the first aspect of the present invention in packaging adeno-associated virus (AAV).

[0041] In another preferred embodiment, the adeno-associated virus (AAV) is a recombinant adeno-associated virus (rAAV).

[0042] The fourth aspect of the present invention provides a kit for packaging adeno-associated virus (AAV), the kit comprising a packaging cell line, and the packaging cell line is the human embryonic kidney monoclonal cell line and its progeny cells described in the first aspect of the present invention.

[0043] In another preferred embodiment, the kit further comprises a subculture transfection medium, and the subculture transfection medium is OPM-293CD05 medium.

[0044] In another preferred embodiment, the kit further comprises an instruction manual, wherein the instruction manual describes a method for packaging adeno-associated virus (AAV) using the packaging cell line.

[0045] In another preferred embodiment, the adeno-associated virus (AAV) is a recombinant adeno-associated virus (rAAV).

[0046] The fifth aspect of the present invention provides a cell preparation, which comprises the human embryonic kidney monoclonal cell line and its progeny cells as described in the first aspect of the present invention, and a pharmaceutically acceptable carrier.

[0047] In another preferred embodiment, the pharmaceutically acceptable carrier contains a liquid, preferably saline or a buffer solution.

[0048] In another preferred embodiment, the pharmaceutically acceptable carrier further contains auxiliary substances, preferably fillers, lubricants, glidants, wetting agents or emulsifiers, pH buffer substances, etc.

[0049] In another preferred embodiment, the cell preparation is used to package adeno-associated virus (AAV).

[0050] In another preferred embodiment, the adeno-associated virus (AAV) is a recombinant adeno-associated virus (rAAV).

[0051] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 The process of constructing a high-yielding HEK293 monoclonal cell line is shown.

[0053] Figure 2 The relative fold increase of luciferase activity of different clones (compared with the parental cells) is shown.

[0054] Figure 3 A map of the plasmid expressing luciferase is shown.

[0055] Figure 4 The QPCR titer results of AAV5-GFP virus packaging of candidate clones in a shake tube system are shown, where the orange dotted line represents the virus titer level of the mother cell.

[0056] Figure 5 The QPCR titer results of AAV5-transgene virus packaging of candidate clones in a shake tube system are shown, where the orange dotted line represents the virus titer level of the mother cell.

[0057] Figure 6 The ddPCR titer results of the Top 8 clones packaging AAV5-GFP virus in a shake flask system are shown.

[0058] Figure 7 The ddPCR titer results of the Top 8 clones packaging AAV5-transgene virus in a shake flask system are shown.

[0059] Figure 8 The plasmid maps for packaging AAV5-GFP are shown: (A) Helper plasmid map; (B) Rep-Cap plasmid map; (C) target gene GFP expression plasmid map.

[0060] Fig. 9 The target gene plasmid map for packaging AAV5-transgene is shown (the Helper plasmid and Rep-cap plasmid maps are the same Figure 8 ).

[0061] Fig.10 The effect of ATA addition on colony growth is shown. DETAILED DESCRIPTION

[0062] After extensive and in-depth research and a large amount of screening, the inventors unexpectedly obtained a human embryonic kidney monoclonal cell strain that is particularly suitable for packaging adeno-associated viruses, especially the human embryonic kidney cell HEK293-ORB1H8 with a preservation number of CCTCC NO: C2024174. The human embryonic kidney monoclonal cell strain of the present invention is domesticated with a medium without animal-derived components and adapted to large-scale suspension culture. It not only grows rapidly and has a low agglomeration rate, but also has an extremely high level of producing adeno-associated viruses, which is 3-9 times the toxin production level of its parent cells (HEK293 cells). At the same time, its growth rate, infection efficiency, toxin production level and other performances are also ahead of the adeno-associated virus packaging cell products on the market. On this basis, the present invention has been completed.

[0063] Before describing the present invention, it should be understood that the present invention is not limited to the specific methods and experimental conditions described, because such methods and conditions can be changed. It should also be understood that the terminology used herein is intended only to describe specific embodiments, and is not intended to be restrictive, and the scope of the present invention will be limited only by the appended claims.

[0064] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention belongs. As used herein, the term "about" when used in reference to a specific recited value means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values ​​therebetween (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0065] Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described.

[0066] Cell line collection

[0067] The "human embryonic kidney cell HEK293-ORB1H8" cell line of the present invention has been deposited in the China Center for Type Culture Collection (CCTCC, Wuhan University, Wuhan, China) on June 4, 2024, with the deposit number CCTCCNO: C2024174.

[0068] Method of the present invention

[0069] The present invention provides a method for constructing (producing) a human embryonic kidney cell monoclonal cell line. The overall process of the method is as follows: Figure 1 Specifically, the method is as follows:

[0070] (1) Cell domestication:

[0071] The HEK293 cells that grow normally after recovery are acclimated to domestic animal-free medium without anti-agglomerating agents. The cell viability is maintained above 95% for three consecutive generations, and the doubling time is stable at 20-30 hours, which can be regarded as the completion of acclimation. After acclimation, the viable cell density is maintained at 15-40E5 viable cells / mL during passaging, and passaging is performed every 2-4 days.

[0072] (2) Monoclonal isolation and culture:

[0073] In advance, 100 μL of cloning medium was spread into each well of a 96-well plate. HEK293 cells cultured for 2-3 days were diluted to an appropriate density, and the cells were sorted into a 96-well plate prepared in advance using a TECAN UNO single cell sorter, so that the cell density of each well was 1 cell / well. Finally, the 96-well plate was placed in a 37°C, 6% CO2 incubator for culture. At 2 hours, 24 hours, and 5 days after plating, the 96-well plate was photographed and visually inspected using an inverted microscope to record the growth of monoclonal cells.

[0074] In certain embodiments, the cloning medium is composed of host cell supernatant, growth factor additive, GlutaMAX additive and fresh medium. The ratio of host cell supernatant is 0-50% (v / v), preferably, the ratio of host cell supernatant is 20-30% (v / v); the ratio of growth factor additive (Solentim InstiGRO HEK or Stemcell ClonaCell-CHOACF additive) is 0-10% (v / v), preferably, the ratio of growth factor additive is 5% (v / v); the concentration of GlutaMAX additive is 0-8mM, preferably, the concentration of GlutaMAX additive is 2-4mM, and most preferably, the concentration of GlutaMAX additive is 2mM; all are calculated according to the total volume of the cloning medium.

[0075] The host cell supernatant is prepared by the following method: centrifuging a 2-3 day domesticated HEK293 cell suspension at 190 g at room temperature for 3 min, then taking the supernatant and centrifuging it at 3000 g at room temperature for 10 min, collecting the supernatant and filtering it with a 0.22 μm filter to obtain the host cell supernatant.

[0076] Preferably, the addition of 0.1 mM small molecule antioxidant chelator aurintricarboxylic acid (ATA) to the HEK293 subculture medium and cloning medium one day before can significantly promote the formation of monoclonal cell clones.

[0077] After about 2 weeks of culture, observe the recovery of the clones. When the confluence of the clones is about 70%, the clones are gradually transferred from the 96-well plate to the 24-well plate and the 6-well plate for culture (37°C, 6% CO2). When the confluence of the clones in the 6-well plate is about 70%, they are transferred to a 50 mL shaking tube for culture (37°C, 8% CO2, 85% humidity, 225 rpm, amplitude 25 mm).

[0078] (3) Screening of clones with high transfection efficiency:

[0079] To select clones with high transfection efficiency, count the clones cultured in the shake tube and inoculate them into a 24-well plate at a density of 5E5 viable cells / mL. Add the plasmid expressing transient luciferase (luc) (pLV3-CMV-MCS-fLuc-EF1a-CopGFP-Puro) and the transfection reagent to an appropriate volume of transfection medium and mix well. Let it stand at room temperature for 10-15 minutes. Preferably, let it stand for 10 minutes before adding it to the 24-well plate and mixing it with the cells. After culturing for 24 hours, use Bio-Lumi TM One II Firefly Luciferase Reporter Gene Assay Kit (Biyuntian) was used to detect luc expression. The clones with higher luc expression (i.e., clones with higher transfection efficiency) were screened out for AAV virus packaging experiments.

[0080] (4) AAV virus packaging experiment for high-yield monoclonal screening:

[0081] AAV virus packaging was performed using a three-plasmid transient transfection method, and high-yield clones were screened according to the AAV expression titer levels of different clones. Specifically, the clone was diluted to about 2E6 viable cells / mL the day before transfection, and the cell density was adjusted to 4E6 viable cells / mL after 24 hours of culture. The target gene expression plasmid (GOI plasmid), Rep-Cap plasmid, Helper plasmid, and transfection reagent were added to an appropriate volume of transfection medium and mixed evenly, and then allowed to stand at room temperature for 10-15 minutes. Preferably, the cells were added to the cell suspension after standing for 10 minutes. After culturing for 3 days, the cell culture was fully lysed and centrifuged at 4200rpm for 30 minutes at room temperature to obtain the supernatant. The AAV virus titer was detected by real-time fluorescence quantitative PCR (QPCR) or droplet digital PCR (ddPCR), and high-yield monoclonal cell lines were selected according to the ranking of the results. The top 8 candidate clones were subjected to a second round of virus packaging screening and verification, and the final clone was selected based on the AAV virus packaging titer, namely the human embryonic kidney cell HEK293-ORB1H8 cell line with the deposit number CCTCCNO: C2024174.

[0082] The human embryonic kidney cell HEK293-ORB1H8 cell line of the present invention grows rapidly, with an average doubling time of about 24 hours. In certain embodiments, when the monoclonal strain is used to package AAV5 serotype virus, its titer is 3-9 times that of the parent cell, and its highest titer is 1.2E14 VG / L.

[0083] Application of the present invention

[0084] The present invention also provides the application of human embryonic kidney monoclonal cell strain and its progeny cell as described in the first aspect of the present invention. The human embryonic kidney monoclonal cell strain of the present invention (especially the human embryonic kidney cell HEK293-ORB1H8 with the accession number of CCTCCNO: C2024174) can be used for packaging adeno-associated virus, improving the production capacity of recombinant AAV, and reducing production costs. Therefore, the human embryonic kidney monoclonal cell strain of the present invention can be further prepared into a cell preparation or a kit product for the production of recombinant AAV.

[0085] The beneficial effects of the present invention include:

[0086] (a) The present invention constructs a high-yield human embryonic kidney monoclonal cell line, which is suitable for suspension culture in a medium without animal origin and defined chemical composition, grows rapidly, and has a high level of virus production ability, and is very suitable for large-scale packaging and production of recombinant adeno-associated viruses;

[0087] (b) The present invention optimizes the method for constructing a high-yield human embryonic kidney monoclonal cell line. Before AAV packaging is performed to verify the high-yield monoclonal, a step of using transient reporter genes to screen clones with high transfection efficiency is added, thereby being able to more accurately screen the target high-yield monoclonal clone. In addition, in a preferred embodiment of the present invention, a cloning culture medium supplemented with 0.1 mM small molecule antioxidant chelator aurintricarboxylic acid (ATA) is used during the monoclonal sorting and culture stage, which can significantly promote the formation of monoclonal cell clones and help improve the subsequent screening efficiency.

[0088] The present invention will be further described in detail below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where detailed conditions are not specified are usually carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight. The experimental materials and reagents used in the following examples can be obtained from commercial channels unless otherwise specified.

[0089] Example 1 Preliminary screening of high-yield monoclones

[0090] 1.1 Monoclonal isolation

[0091] After resuscitation, HEK293 cells (purchased from Kangtianshenghe) were acclimated to a chemically defined animal-free medium (OPM-293CD05). The cell viability was maintained above 95% for three consecutive generations, and the doubling time was stabilized at 20-30 hours, which was considered to be complete. The viable cell density was maintained at 15-40E5 viable cells / mL during passaging, and the cells were passaged every 2-4 days.

[0092] 1.1.1 Preparation of host cell supernatant: Centrifuge the acclimated HEK293 cell suspension cultured for 2-3 days at 190g for 3 min at room temperature, then take the supernatant and centrifuge it at 3000g for 10 min at room temperature. Collect the supernatant, filter it with a 0.22μm filter, and place it at 2-8℃ for use.

[0093] 1.1.2 Cell plating: Prepare cloning medium in advance: 30% host cell supernatant (see 1.1.1 for preparation method), 5% growth factor additive (Solentim InstiGRO HEK or Stemcell ClonaCell-CHOACF additive), 1% 200mM GlutaMAX additive (Gibco) and 64% fresh medium (animal-free medium (OPM-293CD05)). Add 100 μL plating medium to each well of a 96-well plate. Dilute the acclimated HEK293 cells that have been cultured for 3 days with fresh medium to a density of 1.5E5 viable cells / mL, for a total of 20 mL. Use the TECAN UNO single cell liquid sorter to sort the cells into the prepared 96-well plate so that the cell density in each well is 1 cell / well. Place the 96-well plate at 37°C and 6% CO 2 Culture in an incubator. 2 hours, 24 hours and 5 days after plating, take photos of the 96-well plate using an imaging system such as an inverted microscope to record the growth of monoclonal cells.

[0094] 1.1.3 After 2 weeks of culture, observe the recovery of clones. When the confluence of clones is about 70%, gradually transfer the clones from the 96-well plate to 24-well plate and 6-well plate for culture (37°C, 6% CO 2 When the confluence of clones in the 6-well plate reached about 70%, they were transferred to 50 mL shaking tubes for culture (37°C, 8% CO 2 , 85% humidity, 225rpm (amplitude 25mm)).

[0095] 1.2 Screening of luciferase expression plasmid transient transfection experiment

[0096] 1.2.1 After the cells are recovered and cultured in a 50 mL shake tube, the luciferase expression plasmid transient transfection experiment is performed after the cell viability is higher than 90%. Specifically, after counting the clones, inoculate them into a 24-well plate at a density of 5E5 viable cells / mL, and add 1 mL of cell suspension to each well. Take 100 μL of fresh culture medium into a sterile ep tube and add 1 μg of luc plasmid (see the map) Figure 3 ) and 2 μL PEI solution (1 mg / mL) were added and mixed, and then added to the 24-well plate and mixed with the cells after standing at room temperature for 10 min. The 24-well plate was then placed at 37°C and 6% CO 2 Culture in an incubator.

[0097] 1.2.2 After 24 hours of culture, use Bio-Lumi TM One II Firefly Luciferase Reporter Gene Assay Kit (Biyuntian) was used to detect luc expression.

[0098] Results Figure 2 , 35 clones had higher luc activity than the mother cells, and the best clone had luc activity 9.4 times that of the mother cells. The 35 clones (Top 35 clones) with higher transfection efficiency than the mother cells were screened out for the next AAV virus packaging experiment.

[0099] 1.3 Top 35 clones packaging AAV virus

[0100] 1.3.1 One day before transfection, dilute the subcultured clone culture to 2E6 viable cells / mL with fresh culture medium. Count the clone suspension after 24 hours of culture, adjust the viable cell density to 4E6 viable cells / mL according to the cell density, and culture in a 50mL shake tube with a volume of 10mL.

[0101] 1.3.2 Take 1 mL of fresh culture medium into a 50 mL centrifuge tube and add 12.92 ug of Helper plasmid (see Figure 8 A), 12.97ug Rep-Cap plasmid (see the map) Figure 8 B) and 14.11ug GOI plasmid (see Figure 8 Middle C or Fig. 9 ), mix well and let stand for use. Then add 80 μL of PEI solution (1 mg / mL) to the same centrifuge tube, vortex mix immediately for 10 seconds, and then let stand at room temperature for 10 minutes. After standing, add the PEI and plasmid mixture to the cloned cells, mix manually and place in a shaker for 72 hours. The culture conditions are 37°C, 8% CO 2 , 85% humidity, 225rpm (amplitude 25mm).

[0102] 1.3.3 72 hours after transfection, add 20% lysis solution (for 10mL cell suspension, add 2mL lysis solution, 2mL lysis solution formula: 1mL 1M Tris-HCl solution, 0.04mL 1M MgCl 2 Solution, 0.15 mL Tween 20, 0.81 mL ultrapure water and 0.31 μL nuclease (final concentration 30-40 U / mL) were added, and the cells were incubated for 2 hours in a shaker to allow the cells to be fully lysed. The cells were then centrifuged at 4200 rpm and 4°C for 30 min, and the supernatant was taken to detect the AAV virus titer using the QPCR method.

[0103] 1.4 QPCR detection of virus titer

[0104] 1.4.1 The samples were digested with nuclease (equivalent dilution 20 times) and then diluted 100 times for QPCR detection (equivalent dilution 2000 times).

[0105] 1.4.2 Primers and probes for QPCR reaction were designed on the ITR sequence (primer and probe sequences are shown in SEQ ID NO: 1-3). The QPCR reaction program was: 60°C for 5 min, preheating at 95°C for 2 min, denaturation at 95°C for 10 s, extension at 60°C for 30 s, repeated for 40 cycles.

[0106] SEQ ID NO:1:GGAACCCCTAGTGATGGAGTT(ITR-F)

[0107] SEQ ID NO:2: CGGCCTCAGTGAGCGA(ITR-R)

[0108] SEQ ID NO:3:HEX-CACTCCCTCTCTGCGCGCTCG-BHQ1(ITR-P)

[0109] 1.4.3 Generate a standard curve using a linear AAV standard and calculate the AAV titer in the sample based on the fluorescence value.

[0110] The titer results of different clones of AAV5-GFP and AAV5-transgene are as follows Figure 4 and Figure 5 As shown. A total of 23 clones had AA5-GFP virus titers higher than the mother cells, with the best increase of 17 times; a total of 28 clones had AAV5-transgene virus titers higher than the mother cells, with the best increase of 23 times. Based on the screening results of the two viruses, the top 8 clones (Top 8 clones) were selected for virus packaging confirmation.

[0111] Example 2 Screening of Top 8 candidate clones

[0112] The Top 8 clones screened in Example 1 were verified for virus packaging in a shake flask system. The method was basically the same as 1.3, except that a shake flask was used for cell culture, and the cell volume during transfection was 30 mL; the plasmid dosage during transfection was: Helper plasmid 38.76 ug, Rep-Cap plasmid 38.92 ug and GOI plasmid 42.32 μg, and the PEI solution dosage was 240 μL.

[0113] The virus titer was detected by ddPCR method as follows: 1) The sample was digested with nuclease (equivalent dilution 20 times), and then diluted 1000 times for ddPCR detection (equivalent dilution 20000 times). The primers and probes for the PCR reaction were designed on the ITR sequence (primer and probe sequences are shown in SEQ ID NO: 1-3). The reaction procedure was: 60℃5min, 95℃ preheating for 2min; 95℃ denaturation for 10s, 60℃ extension for 30s, repeated 40 cycles.

[0114] The AAV virus titer was obtained by multiplying the ddPCR copy number by the dilution factor.

[0115] The titer of AAV5-GFP packaged was as follows Figure 6 As shown in Table 1, the titer of AAV5-GFP in the mother cell was 4.19E10 VG / mL. Among the top 8 clones, 7 clones had higher virus titers than the mother cell, and the highest clone virus titer was 1.20E11 VG / mL, which was about 2.9 times the titer of the mother cell. Figure 7 As shown in Table 2, the titer of AAV5-transgene in the mother cell was 1.29E10 VG / mL. Among the Top8 clones, 7 clones had higher virus titers than the mother cell, and the highest clone virus titer was 1.20E11VG / mL, which was about 9.3 times the titer of the parent mother cell. Among them, the AAV5-transgene packaging titer of clone 1H8 remained relatively stable after 60 PDLs, i.e., 20 generations: the titer of PDL0 cells was 1.40E11 VG / mL, and the titer of PDL60 cells was 9.30E10 VG / mL.

[0116] In summary, the AAV5-GFP and AAV5-transgene production of clone IH8 (i.e., human embryonic kidney cell HEK293-ORB1H8 with a preservation number of CCTCC NO: C2024174) is absolutely superior among the Top 8 clones, which is 3-9 times that of the parental cells; and the packaging stability is good after long-term passaging.

[0117] Table 1 AAV5-GFP virus titer of top 8 clones packaged in shake flask system

[0118]

[0119] Table 2 AAV5-transgene virus titers of top 8 clones packaged in shake flask system

[0120]

[0121]

[0122] Example 3 Optimization of the process for constructing a high-yield monoclonal cell line

[0123] Furthermore, the inventors have further optimized the process of constructing a high-yield monoclonal cell line. The method and steps are the same as those in Example 1, with the only difference being that 0.1 mM of a small molecule antioxidant chelator aurintricarboxylic acid (ATA) is additionally added to the subculture medium and the cloning medium before HEK293 monoclonal sorting (i.e., when preparing the domesticated cells for monoclonal sorting in Example 1.1.2).

[0124] Compared with the control method (i.e., the method used in Example 1), the HEK293 clone formation rate was significantly improved after adding ATA (see Fig.10 ). It can be seen that the use of ATA can effectively help monoclonal cells survive and grow, and can improve the efficiency of monoclonal screening.

[0125] Comparative Example 1

[0126] The present application also compares the performance of the high-yield monoclonal cell line constructed in the present application with the performance of the same type of suspension monoclonal cell line on the market (referred to as C1 cell line for short).

[0127] The results showed that when packaging AAV5 viruses with different GOIs, the yield of human embryonic kidney cells HEK293-ORB1H8 was higher than that of the C1 cell line, with the yield increased by about 20%-80%.

[0128] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A human embryonic kidney monoclonal cell line and its progeny cells, characterized in that: (1) The cell line is acclimated with an animal-free medium and adapted to suspension culture; (2) the doubling time of the cell line during culture is ≤24 hours; (3) the cell line is suitable for packaging adeno-associated virus (AAV), and its virus expression titer is at least twice that of the parent cell.

2. The human embryonic kidney monoclonal cell line according to claim 1, characterized in that The human embryonic kidney monoclonal cell line is human embryonic kidney cell HEK293-ORB1H8 with a preservation number of CCTCC NO: C2024174.

3. The human embryonic kidney monoclonal cell line according to claim 1, characterized in that The adeno-associated viruses include: AAV1, AAV2, AAV3, AAV5, AAV6, AAV7, AAV8 and AAV9 serotypes.

4. A method for constructing a human embryonic kidney monoclonal cell line according to any one of claims 1 to 3, characterized in that: The method comprises the following steps: (S1) Cell acclimation: HEK293 cells are acclimated to an animal-derived component-free medium without an anti-agglomerating agent to obtain acclimated HEK293 cells; (S2) Monoclonal sorting: After culturing the acclimated HEK293 cells for 2-3 days, the cells are diluted to a suitable density and sorted into a 96-well plate prepared in advance, so that the cell density in each well is 1 cell / well, and the monoclonal cells in the 96-well plate are cultured; wherein V1 volume of cloning medium is added to the 96-well plate in advance; (S3) clone expansion culture: after culturing the monoclonal cells in step (S2) for 10-15 days, observe the recovery of clones in each well of the 96-well plate; when the confluence of clones reaches 65%-75%, gradually transfer the clones to 24-well plates and 6-well plates for culture; when the confluence of clones in the 6-well plate reaches 65%-75%, transfer the clones to 50 mL shake tubes for culture; wherein, clone culture uses clone medium; (S4) Screening clones with high transfection efficiency: using the clones obtained in the transient transfection step (S3) of the plasmid expressing the reporter gene, detecting the expression of the reporter gene in the clones, screening out clones with high expression of the reporter gene, and performing adeno-associated virus (AAV) packaging experiment screening; (S5) AAV packaging experiment screening: AAV packaging was performed using a three-plasmid transient transfection method to detect the AAV virus titer level in the clones, and clones with high AAV virus titer levels, i.e., high-yield clones, were selected according to the AAV virus titer level ranking; (S6) performing a second round of AAV packaging experiment screening on the AAV high-yield clone selected in step (S5), detecting the AAV virus titer level in the clone, and selecting the final clone based on the AAV virus titer level and cell growth status, thereby obtaining the human embryonic kidney monoclonal cell line.

5. The method according to claim 4, characterized in that In the steps (S2) and (S3), the cloning culture medium comprises: host cell supernatant, growth factor additives, GlutaMAX additives and animal-free culture medium; wherein, The ratio of the host cell supernatant is 20-30% (v / v); The ratio of the growth factor additive is 3%-8% (v / v); The concentration of the GlutaMAX additive is 2-4 mM; calculated based on the total volume of the cloning culture medium; The host cell supernatant is the cell culture supernatant obtained by culturing and acclimating HEK293 cells for 2-3 days and then centrifuging and filtering.

6. The method according to claim 4 or 5, characterized in that The animal-derived component-free culture medium is OPM-293CD05 culture medium.

7. Use of the human embryonic kidney monoclonal cell line and its progeny cells according to any one of claims 1 to 3 in packaging adeno-associated virus (AAV).

8. A kit for packaging adeno-associated virus (AAV), characterized in that: The kit comprises a packaging cell line, and the packaging cell line is the human embryonic kidney monoclonal cell line and its progeny cells according to any one of claims 1 to 3.

9. The kit according to claim 8, characterized in that The kit also contains a subculture transfection medium, which is OPM-293CD05 medium.

10. A cell preparation, characterized in that: The cell preparation comprises the human embryonic kidney monoclonal cell line and its progeny cells according to any one of claims 1 to 3, and a pharmaceutically acceptable carrier.

Images