Method for efficiently preparing FGF5 homozygous knockout cashmere goat by combining base editor with somatic cell cloning technology

Abstract

The invention provides a method for efficiently preparing FGF5 homozygous knockout cashmere goats by combining a base editor with a somatic cell cloning technology. And an sgRNA site is designed. An sgRNA expression vector is constructed, the sgRNA expression vector and pCMV-AncBE4max are respectively transferred into fibroblasts of a down producing goat fetus, and the editing efficiency is analyzed. And optimizing an electrotransfection condition, and simultaneously transfecting the screened sgRNA expression vector and pCMV-AncBE4max into a down producing goat fetal fibroblast to obtain the FGF5 homozygous knockout cell strain. And preparing reconstructed embryos and FGF5 homozygous knockout cashmere goats. The average editing efficiency of the sgRNA site disclosed by the invention can reach 64.3 + / -8.1%. The average probability of FGF5 homozygous knockout cells is 69.0%. Wherein the homozygous probability is 58.6% on average. The lambing rate is 7%. The invention provides a theoretical basis and a research basis for cultivating high-yield and high-quality new varieties.

Description

Technical Field

[0001] The present invention provides a "method for efficiently preparing FGF5 homozygous knockout cashmere goats by using a base editor combined with somatic cell cloning technology", which mainly relates to the fields of genetic engineering and embryo engineering, including the design of sgRNA sites, the construction of sgRNA expression vectors, cell transfection, the screening of sgRNA sites, the optimization of FGF5 knockout efficiency, the screening of FGF5 homozygous knockout cells and the preparation of FGF5 homozygous knockout cashmere goats.

[0002] FGF5 is a member of the FGF4 subfamily and is considered a negative regulator of mammalian hair length. Its mutation is the causative factor for the Angora mouse phenotype, characterized by abnormally long body hair. FGF5 contains a conserved receptor binding domain, whose coding sequence spans all three exons and interacts with its receptor FGFR1. FGF5 is not only the causative factor for the Angora mouse phenotype, but its genetic variation has been shown to be the basis for hair length regulation in several other species, including cats, dogs, rabbits and even alpacas. Mutations in FGF5 are associated with the long-haired phenotype of the species and are often used in the breeding of wool-producing animals such as goats, rabbits and sheep.

[0003] Base editors are another major breakthrough in the field of gene editing based on the CRISPR / Cas9 system. There are two main types of base editors: cytosine base editors (CBEs) and adenine base editors (ABEs). They can directly target base pairs for direct conversion from C to T or G to A, A to G, or T to C without DSB, HDR, or donor DNA templates. Based on this feature, base editors can be used to introduce stop codons in gene sequences in advance, or directly cause base conversion at the start codon ATG, thereby causing nonsense mutations to achieve the purpose of knocking out genes. Base editors can induce specific base changes without DSBs and donor templates, making them a convenient and efficient method for designing nucleotide substitutions at target sites. In recent years, base editors have shown great potential in basic research and applications in animals and plants, including the establishment of various mammalian cell lines, animal disease modeling, agricultural breeding and disease treatment, and regulation of mRNA alternative splicing.

[0004] Although the use of base editors in animal gene modification and functional research is relatively mature, it is difficult to use this technology to obtain homozygous gene-edited animals that can be stably inherited from generation to generation, especially for large mammals. If a method for efficiently preparing FGF5 homozygous knockout cashmere goats can be provided, it will not only be possible to study the mechanism of action of the FGF5 gene on the length of the wool fibers, but also shorten the generational inheritance interval of excellent genetic traits and improve the breeding progress, ultimately providing a theoretical basis and research foundation for breeding new varieties of high-yield and high-quality cashmere goats. Summary of the invention

[0005] The purpose of the present invention is to provide a "method for efficiently preparing FGF5 homozygous knockout cashmere goats using a base editor combined with somatic cell cloning technology".

[0006] The present invention provides a sgRNA specifically targeting the first exon of cashmere goat FGF5. Specifically, the DNA sequence for transcribing the sgRNA is shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3.

[0007] The present invention provides an sgRNA expression vector, by means of which the base editor pCMV-AncBE4max can be guided to target and knock out the FGF5 gene, and more homozygous knockout cells can be prepared in a short time.

[0008] The present invention has found through a large number of preliminary experiments that the knockout efficiency is highest when electrotransfection is carried out under the conditions of 220V / 6ms and 2000ng / μL, so this transfection condition is used for the experiment.

[0009] In the present invention, in order to better reflect the knockout efficiency of FGF5, the Edit R website was used to analyze the Sanger sequencing results of cells after electroporation.

[0010] The present invention provides the use of the sgRNA expression vector and the base editor pCMV-AncBE4max in specific identification and targeted modification of the FGF5 gene of cashmere goats, wherein the targeted modification includes base conversion and gene knockout.

[0011] The present invention provides the application of the sgRNA expression vector and the base editor--pCMV-AncBE4max in efficiently preparing transgenic animals or improving livestock production performance.

[0012] The present invention provides the application of the sgRNA expression vector and the base editor--pCMV-AncBE4max in the efficient breeding of a new variety of gene-edited cashmere goats.

[0013] This invention not only screened out the sgRNA sequence that can specifically target the FGF5 gene sequence and efficiently guide the base editor--pCMV-AncBE4max to modify the target site, but also optimized the various conditions during the electroporation of the sgRNA expression vector and the base editor--pCMV-AncBE4max, ultimately improving the efficiency of FGF5 editing. Under the optimal electroporation conditions, the base editing efficiency is above 60%; and the probability of obtaining FGF5 homozygous knockout cells using the sgRNA is an average of 69.0%. The homozygous probability is an average of 58.6%; in addition, after obtaining FGF5 homozygous knockout cells, a total of 5 lambs were finally produced through somatic cell cloning technology, with a lambing rate of 7%. Therefore, the present invention can be used as an effective method for efficiently preparing homozygous knockout animals, providing a theoretical basis and research foundation for breeding high-yield, high-quality new varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Targeting positions of sgRNAs in the goat FGF5 gene.

[0015] Figure 2 Schematic diagram of the sgRNA expression vector and base editor pCMV-AncBE4max.

[0016] Figure 3 Editing efficiency detection diagram of sgRNA expression vector.

[0017] Figure 4 Analysis of sgRNA-stop1 site sequencing results under different electroporation conditions.

[0018] Figure 5 Cell staining under different electroporation conditions.

[0019] Figure 6 FGF5 homozygous knockout single cell enrichment map and identification electrophoresis map.

[0020] Figure 7 FGF5 homozygous knockout single-cell sequencing diagram.

[0021] Figure 8 FGF5 gene expression detection chart.

[0022] Fig. 9 Somatic cell clone diagram (microinjection diagram).

[0023] Fig.10 Somatic cell cloning diagram (embryo development diagram).

[0024] Fig.11 Image of newborn FGF5 homozygous knockout cashmere goats.

[0025] Fig.12Sequencing identification diagram of FGF5 homozygous knockout cashmere goats. DETAILED DESCRIPTION

[0026] The screening process of the present invention will be described in detail below in conjunction with experiments. The following experiments that need to be explained are only for the purpose of explanation and are not intended to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0027] Unless otherwise specified, the experimental methods used in the experiments are conventional methods. Unless otherwise specified, the materials and reagents used can be obtained from commercial channels.

[0028] Example 1 Construction of sgRNA expression vector Combined with the BE-Hive design website [HTTPS: / / WWW.CRISPRBEHIVE.DESIGN / ], the target site was designed in the first exon of the FGF5 gene. The gene sequence must contain C in the codons (CAG, CAA, and CGA), or G in the codons TGG and the start codon ATG. According to the above design requirements, three sgRNA sites were finally selected.

[0029] sgRNA target site 1 (named sgRNA-stop1): GCTTCCAGTGGAGCCCCTCG; the recognized target sequence is shown in sequence SEQ ID NO.1 in the sequence list.

[0030] sgRNA target site 2 (named sgRNA-stop2): GATCCTCAGCGCCTGGGCTC; the recognized target sequence is shown in sequence SEQ ID NO.2 in the sequence list.

[0031] sgRNA target site 3 (named sgRNA-stop3): CGGCTGGAAGCATGAGCTTG; the recognized target sequence is shown in sequence SEQ ID NO.3 in the sequence list.

[0032] The sgRNA primer oligo was designed according to the following format, synthesized by BGI, and purified by PAGE.

[0033] The linker ACCG was added to the 5' end of the sgRNA upstream primer, and the linker AAAC was added to the 5' end of the sgRNA downstream primer. The specific sequence of the final synthesized sgRNA is shown in Table 1.

[0034] Table 1 sgRNA primer oligo

[0035] Oligo dimer formation: dilute the above primers and perform annealing and hybridization. System: sgRNA oligo up 1μL, sgRNA oligo down 1μL, 10×Ligase Buffer 1μL, T4DNA Ligase 1μL, ddH2O 6μL, total volume 10μL. Program: 37℃ 3min, 95℃ 1min, cool down from 95℃-85℃ at 2℃ / s, cool down from 85℃-25℃ at 0.1℃ / s.

[0036] Linearization of pGL3-U6-sgRNA-PGK-puromycin backbone vector: Use Fast Digest Eco31I to digest the pGL3-U6-sgRNA-PGK-puromycin vector and place it in a water bath at 37°C for 10 minutes. After digestion, use a gel recovery kit to recover the linearized pGL3-U6-sgRNA-PGK-puromycin backbone vector for ligation to the sgRNA site. Enzyme digestion system: Nuclease-free Water 15μL, 10×FastDigest Green Buffer 2μL, backbone vector 2μL (up to 1μg), FastDigest enzyme 1μL.

[0037] The oligo dimer obtained in the previous step was connected to the pGL3-U6-sgRNA-PGK-puromycin backbone vector to construct the sgRNA co-expression vector (named sgRNA-stop1 vector, sgRNA-stop2 vector, and sgRNA-stop3 vector successively). The system is: 1 μL backbone vector, 1 μL oligo dimer obtained in the previous step, 2 μL 10×Ligase Buffer, 1 μL T4DNALigase, 15 μL ddH2O, and a total system of 20 μL. Procedure: 16°C, 12 h.

[0038] Transformation: The sgRNA expression vector constructed in the previous step was transferred into the competent cells Trans1-T1PhageResistant Chemically Competent Cell) using the heat shock method: the sgRNA expression vector was mixed with 50 μL of competent cells and placed in an ice bath for 30 min; after heat shock at 42°C for 30 s, the cells were placed in an ice bath for 2 min; then 500 μL of sterile, non-resistant LB culture medium was added and activated at 37°C and 200 rpm for 60 min; then the cells were spread on LB solid culture medium containing ampicillin resistance and cultured at 37°C for 6-8 hours.

[0039] Pick single clones and sequence: After a single colony grows, pick 5 each of the sgRNA-stop1 vector, sgRNA-stop2 vector, and sgRNA-stop3 vector, shake and propagate at 37°C, preserve the bacteria and send for sequencing. Sequencing primers: Upstream: CGATTAGTGAACGGATCTCGACG; Downstream: ACTGCCATTTGTCTCGAGGT. The strains with correct sequencing are extracted with the PureYieldPlasmid Midiprep System for later use. The schematic diagram of the sgRNA expression vector is shown in the figure. Figure 2 shown.

[0040] Plasmid extraction: (1) Inoculate 10 μL of E. coli containing the sgRNA co-expression vector into 50 ml of LB culture medium containing ampicillin resistance and shake the culture for 16 hours; (2) Centrifuge at 4500 rpm for 20 minutes and collect the precipitate; (3) Resuspend with 2 ml Cell Resuspension Solutin; (4) Add 2 ml Cell lysis solution and gently invert 5 times, and let it stand at room temperature for 5 minutes; (5) Add 3 ml Neutralization solution and gently invert 5 times, let it stand at room temperature for 3 minutes, centrifuge at 4500 rpm for 20 minutes, discard the precipitate, and keep the liquid; (6) Place the blue adsorption column in a new centrifuge tube, then pour the liquid obtained in (5) into the blue adsorption column, incubate for 3 minutes, allow the residual cell debris to float to the top, and then centrifuge at 1500 rpm for 10 minutes, leaving the liquid; (7) Place the white adsorption column in a centrifuge tube, then pour the liquid obtained in (6) into the white adsorption column, centrifuge at 4500 rpm for 2 minutes, and discard the filtrate; (8) Add 5 ml Endotixion Reneral Wash Solution, centrifuge at 1500 rpm for 5 min, discard the filtrate; (9) Add 20 ml Colum Wash, centrifuge at 1500 rpm for 20 min, discard the filtrate, and then centrifuge at 1500 rpm for 15 min; (10) Take out the white adsorption column and place it at room temperature for 8 min to ensure that there is no ethanol residue, then add 500 μL enzyme-free water to the white adsorption column, incubate at room temperature for 5 min, and centrifuge at 4500 rpm for 2 min; (11) After measuring the DNA concentration, store at -20°C.

[0041] Example 2 Screening of sgRNA sites

[0042] (1) Cell preparation Cashmere goat primary fibroblasts were cultured in a 100 mm culture dish. When the confluence of the cells at the bottom of the culture dish was about 70%, the cells were subcultured and used as cells for electro-transfection.

[0043] (2) Cell transfection The cells prepared in the previous step were treated with 3mL of trypsin, centrifuged at 1500rpm for 5min, and the precipitate was collected. The cells were suspended with 1mL of PBS and counted using a blood cell counting plate. After counting, all cells were divided into three groups, and the number of cells in each group was adjusted to approximately 1×106. The cell precipitate was collected by centrifugation again and washed twice with opti-MEM. Then 5μg of plasmid vectors of AncBE4max / sgRNA-stop1, AncBE4max / sgRNA-stop2, and AncBE4max / sgRNA-stop3 were added to each group of cell precipitates, fixed to 25μL with opti-MEM, and transferred to the electroporation cups respectively, and electroporated using the instrument reference condition 200V / 6ms. After the electroporation is completed, the cells in the electroporation cups are resuspended with 500μL of opti-MEM, repeated twice, and then transferred to 6 wells for normal culture. The medium was changed after 12h, and the cell precipitates of each group were collected after 24h, and DNA was extracted.

[0044] (3) sgRNA efficiency detection The DNA of the three groups of cells electroporated with AncBE4max / sgRNA-stop1, AncBE4max / sgRNA-stop2, and AncBE4max / sgRNA-stop3 vectors was used as a PCR template for amplification. The PCR products were sent for sequencing, and the detection primer sequences were designed on the NCBI website. The upstream primer was named FGF5-F: TCCCTCTC TCTCTCTCCCCCT, and the downstream primer was named FGF5-R: CAGACGCACCTCCAACCCAAC. The sequencing results were analyzed by the Edit R website to obtain the editing efficiency of each sgRNA site. The results showed that in FGF5, there were overlapping peaks at the sgRNA-stop1 site and nearby sequences, and a conversion from base C to T occurred, while the target sites of sgRNA-stop2 and sgRNA-stop3 did not change (such as Figure 3 The sequencing results were analyzed using Edit R editing efficiency quantification software, and the editing efficiency of the sgRNA-stop1 site was 27.4±2.4%. Figure 3 The numbers in the table are obtained by Edit R software based on the quality values ​​of the Sanger sequencing peak graph to simulate the accuracy of the four bases A, T, C, and G during sequencing, reflecting the editing efficiency of the target gene site. 100 is the maximum value, and the calculation of the base editing efficiency below is the same. (The electrotransfection conditions are 200V / 6ms, 3000ng / μL, and the experiment of sgRNA efficiency detection is repeated more than three times. The data are expressed as mean ± standard deviation, with one decimal place reserved).

[0045] Example 3 Optimization of FGF5 knockout efficiency The sequencing analysis in the previous step showed that in GFFs, the sgRNA-stop1 site successfully guided AncBE4max to target and change the target site in the FGF5 gene. In order to further improve the knockout efficiency of FGF5, the electroporation conditions need to be further optimized to improve the knockout efficiency of FGF5 while ensuring the survival rate of cells. The optimization of electroporation conditions is mainly aimed at voltage intensity, electric pulse duration, plasmid concentration and other conditions.

[0046] (1) Cell preparation Cell samples: 1) Treatment group: cashmere goat fibroblasts after electrotransfection; 2) Control group (NC): cashmere goat fibroblasts without electrotransfection.

[0047] (2) Optimization of electroporation parameters First, based on the use of opti-MEM as the electroporation buffer, we compared the base editing efficiency and cell survival rate of the FGF5 target site under 7 voltage intensities / electric pulse durations of 150V / 3ms, 200V / 3ms, 200V / 6ms, 220V / 6ms, 225V / 3ms, 225V / 6ms, and 250 / 3ms. Other electroporation conditions used in the experiment, such as pulse interval and pulse number, remained consistent; plasmid concentration was 3000ng / μL; plasmid dosage: 5μg of AncBE4max and sgRNA-stop1 plasmid vectors were mixed in 25μL of opti-MEM buffer.

[0048] (3) Plasmid concentration optimization Then, we continued to test the effects of plasmid concentrations of 2000ng / μL and 3000ng / μL on the editing efficiency of the FGF5 target site and cell survival. Other electroporation conditions used in the experiment, such as pulse interval and pulse number, remained the same; the voltage intensity was 220V, the duration of the electric pulse was 6ms; the electroporation buffer was opti-MEM; plasmid dosage: 5μg of the two plasmid vectors AncBE4max and sgRNA-stop1 were mixed in 25μL of opti-MEM buffer.

[0049] (4) Electrotransfection Before electroporation, cashmere goat fibroblasts cultured in a 100 mm dish were first collected, and the number was adjusted to approximately 1 × 106 using a blood cell counting plate; then divided into a treatment group and a control group (NC), centrifuged at 1500 rpm for 5 min, and the cell pellets of each treatment group or control group were collected again, washed twice with 2 mL of opti-MEM, and 5 μg of AncBE4max / sgRNA-stop1 mixed plasmid vectors of different concentrations were added; finally, the volume was fixed to 25 μL with opti-MEM. During electroporation, the CUY21EDIT II multi-mode gene electroporator was used to set the voltage intensity, duration of electric pulses, etc. After electroporation, the cells were first transferred to a 6-well plate using 500 μL of opti-MEM, and repeated twice; then, the state of the cells was observed after normal culture for 24 h; finally, the cells were collected for sequencing to analyze the efficiency of base editing. Unless otherwise specified, all electroporation steps were performed at room temperature.

[0050] (5) Cell viability determination The specific operation method is: the cells of the control group and the treatment group (NC) after electroporation are plated in a six-well plate. After 24 hours, the old culture medium is aspirated and washed with 1mL of PBS, and then 1mL of fresh culture medium containing 10% FBS is added. For each well, 10μl of Hoechst 33342 live cell staining solution (100×) is added to stain the cell nucleus. After incubation in a cell culture incubator for 10 minutes, the old culture medium is removed and washed twice with new culture medium, and then the staining is observed under a fluorescence microscope. The number of stained cell nuclei under each electroporation condition is calculated using ImageJ software, and the survival rate of each group of cells can be preliminarily determined. Cell survival rate (%) = (number of cells in the treatment group / number of cells in the control group) × 0.01.

[0051] (6) Base editing efficiency detection 24 hours after GFFs cell transfection, the precipitate was collected, DNA was extracted for PCR amplification, and the PCR product was sent to the company for sequencing. The sequencing results were analyzed using Edit R software to analyze the efficiency of base editing, and then the efficiency of causing nonsense mutations in FGF5 was analyzed. The detection primer sequence was designed on the NCBI website, and the upstream and downstream primers were FGF5-F and FGF5-R.

[0052] The results are as follows Figure 4 , Figure 5As shown: Under the seven voltage intensities / electric pulse durations of 150V / 3ms, 200V / 3ms, 200V / 6ms, 220V / 6ms, 225V / 3ms, 225V / 6ms, and 250 / 3ms, the editing efficiency under the 220V / 6ms electroporation condition was the best, with an average of 44.3±8.5%; the cell survival rate under the 150V / 3ms electroporation condition was the best, but its average editing efficiency was the lowest. Under the 220V / 6ms electroporation condition, we continued to test the effects of plasmid concentrations of 2000ng / μL and 3000ng / μL on the editing efficiency and cell survival rate of the FGF5 target site. The editing efficiency was the best at a concentration of 2000ng / μL, with an average of 64.3±8.1%, while the cell survival rate was not significantly different from that at a concentration of 3000ng / μL. In summary, under a series of optimized electroporation conditions, the base editing efficiency was best when the voltage intensity and electric pulse time were 220V / 6ms and the concentration was 2000ng / μL, with an average of 64.3±8.1%. (The data values ​​of base editing efficiency and cell survival rate were analyzed by one-way analysis of variance, and P values ​​less than 0.05 were considered statistically significant. The data were expressed as mean ± standard deviation, with one decimal place retained, and the experiment was repeated more than three times).

[0053] Example 4 Screening of FGF5 homozygous knockout cell lines.

[0054] (1) Cell preparation Select primary cashmere goat fibroblasts isolated and identified in the laboratory, culture them in a 100 mm culture dish, and change the medium after 24 hours. Primary cells should be subcultured once before transfection, and the cells are collected after subculture and used for cell transfection.

[0055] (2) Cell electrofection A total of 5 μg of the two plasmid vectors AncBE4max and sgRNA-stop1 were transfected into the cells simultaneously. The electroporation conditions were 220V / 6ms, 2000ng / μL. After transfection, the cells were carefully transferred to a 6-well plate for normal culture.

[0056] (3) Cell sorting preparation On the second day after electroporation, observe the cell status and collect the cell pellet, first wash it twice with 1 mL of PBS, and finally resuspend the cell pellet with 500 μL of PBS.

[0057] (4) Flow cytometry sorting After electroporation, single cells were inoculated into 96-well plates using a flow cytometer, and 130 μl of culture medium containing 20% ​​FBS was added to each well; on the 7th day of culture, monoclonal cells with a confluence of more than 50% in the 96-well plate were subcultured into 24-well plates; when the confluence of cells in the 24-well plate reached about 70%, half of the cells were used to extract genomic DNA for identification, and the other half of the cells were cultured normally, frozen after growing, and used for the next step of experimental operation. The final screened FGF5 homozygous knockout cells and PCR product electrophoresis results are shown in Figure 6 .

[0058] (5) Identification of monoclonal cell lines The genomic DNA of monoclonal cells was used as a template for PCR identification. The PCR product was first identified correctly by 1% agarose gel electrophoresis and then sent to BGI for sequencing. The upstream and downstream primers for PCR and sequencing were FGF5-F and FGF5-R, respectively. Monoclonal cell DNA was extracted for PCR amplification. The size of the amplified PCR product was between 600bp and 700bp. It was first identified by agarose gel electrophoresis and sent for sequencing after successful identification. The results showed that 49 monoclonal cells were screened in the first round, and 23 cells had FGF5 gene knockout, with a knockout probability of 46.9%. Among them, 17 cells were homozygous knockout, with a homozygous probability of 34.7%; 6 cells were heterozygous knockout, with a heterozygous probability of 12.2%. A total of 29 cells were screened in the second round, and 20 cells had FGF5 gene knockout, with a knockout probability of 69.0%. Among them, 17 cell lines were homozygous knockout, with a homozygous probability of 58.6%; 3 cell lines were heterozygous knockout, with a heterozygous probability of 10.3%. Figure 7 shown.

[0059] (6) Detection of FGF5 gene expression The successful FGF5 homozygous knockout monoclonal cell line was identified, and total RNA and protein were extracted respectively. Then, Real-time PCR and Western blot experiments were used to detect the changes in FGF5 gene expression at the transcription and translation levels, respectively. In addition, in addition to the blank control group (WT) and the experimental treatment group (FG F5KO), the negative control (NC) treated with transfection of empty plasmid was added to the experimental group to exclude the influence of cell transfection and other operations on the expression of related genes. The real-time PCR results showed that there was no significant difference in the expression of FGF5 at the transcription level between the FGF5 homozygous knockout experimental group and the negative control and blank control groups; the Western blot results showed that under the premise that the target bands appeared in the blank control group (WT) and the negative control group (NC), the target bands did not appear in the FGF5 homozygous knockout experimental group. In summary, it is shown that the premature introduction of the stop codon in the FGF5 gene and the resulting nonsense mutation do not affect the expression of the gene at the transcription level, but destroy the normal expression of the protein by preventing translation. Specifically, Figure 8 shown.

[0060] Example 5 Preparation of FGF5 Homozygous Knockout Cashmere Goats The present invention utilizes somatic cell cloning technology to introduce the FGF5 homozygous knockout cell line prepared by the base editor into mature oocytes, and cultures them in vitro to form gene-edited embryos, and ultimately produces FGF5 homozygous knockout cashmere goats.

[0061] (1) Oocyte collection and culture After removing excess fat from fresh ovaries, they are placed in egg collection fluid. Finally, oocytes with complete morphology and structure are selected under a stereoscope and placed in maturation fluid. They are cultured normally in an incubator at 38.5°C and 5% CO2. The maturation process is completed after the first polar body is expelled.

[0062] (2) Preparation and culture of reconstructed embryos First, the identified FGF5 homozygous knockout cell line was thawed and cultured in a 24-well plate as a donor cell. Then, the mature oocyte was fixed using the holder of the micromanipulator, the first polar body and the nucleus were sucked out using the injection needle, and the prepared donor cell was injected into the mature oocyte from the same position. Then, it was placed in the maturation solution and cultured in the incubator for 30 minutes. Finally, it was moved to the fusion solution for 2 minutes, and the fusion was performed using a fusion instrument. After the fusion, it was activated to obtain a reconstructed embryo, and then the reconstructed embryo was cultured in the development solution. The results are shown in Figure 2. Fig. 9 , Fig.10As shown: A total of 1018 oocytes were injected, of which 912 were successful, with a success rate of 90%. After microinjection, the oocytes and donor cells were fused together by electrofusion, and a total of 693 fused, with a success rate of 76%, and 579 reconstructed embryos were formed by cleavage after fusion.

[0063] (3) Embryo transfer Before the embryo transfer operation, each recipient sheep was injected with 0.15 mL of veterinary anesthetic, and the transplantation operation was performed on the estrus ewes after the drug took effect. 264 reconstructed embryos (24 at the 2-cell stage, 108 at the 4-cell stage, and 73 at the 8-16-cell stage) were transplanted into 68 recipient ewes. The transplantation results are shown in Table 2.

[0064] (4) Table 2 Statistics of embryo transfer and lambing

[0065] (5) Identification of newborn sheep After the cloned cashmere goats are born, records are kept and identification is performed when the newborn lambs grow to a certain age. Identification results: A total of 5 lambs were born after pregnancy. Two of them were identified to have introduced the stop codon TAG in the FGF5 target site, which caused nonsense mutations and became FGF5 homozygous knockout cashmere goats (one died at birth and the other survived). In addition, the bases near the target site also changed, but it did not affect the knockout of the FGF5 gene. Fig.11 ; Sequencing results of FGF5 homozygous knockout cashmere goats are shown in Fig.12 .

[0066] In summary, the present invention provides a method for efficiently preparing FGF5 homozygous knockout cashmere goats using a cytosine base editor (pCMV-AncBE4max) combined with somatic cell cloning technology, which is used as an effective method for efficiently preparing homozygous knockout animals, and provides a theoretical basis and research foundation for breeding new high-yield and high-quality cashmere goat varieties.

[0067] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements may be made thereto based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. An sgRNA specifically targeting cashmere goat FGF5, wherein the targeted DNA sequences are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3; characterized in that The targeted cashmere goat FGF5 gene is located on chromosome 6 of the goat; the characteristic is that the vector expressing sgRNA contains the drug screening marker Puro; the characteristic is that the sgRNA or expression vector is used in the specific recognition and targeted modification of cashmere goat FGF5, firstly designing the corresponding sgRNA and constructing an expression vector based on sgRNA; then under the optimal electroporation conditions, the high-efficiency sgRNA expression vector and the base editor are transfected into the cashmere goat fetal fibroblasts to obtain the FGF5 homozygous knockout cell line; finally, the FGF5 homozygous knockout cashmere goat is obtained by using somatic cell cloning technology.

2. The sgRNA or expression vector and base editor of any one of claim 1 are used in the efficient preparation of gene-edited animals or improvement of livestock production performance, and breeding of new varieties of gene-edited cashmere goats. The goats include Arbas cashmere goats, but are not limited to other varieties of goats.

Images