Wheat stripe rust resistance gene Yrym112 and InDel molecular marker and application

Abstract

The invention relates to a wheat stripe rust resistance gene Yrym112, an InDel molecular marker and an application of the wheat stripe rust resistance gene Yrym112 and the InDel molecular marker. The CDS nucleotide sequence of the wheat stripe rust resistance gene Yrym112 is as shown in SEQ ID NO. 1, and the amino acid sequence coded by the wheat stripe rust resistance gene Yrym112 is as shown in SEQ ID NO. 2. The developed functional molecular marker Yrym112-InDel comprises an upstream primer sequence as shown in SEQ ID NO. 3 and a downstream primer sequence as shown in SEQ ID NO. 4. A material containing the Yrym112 gene can be divided into a disease-resistant genotype and a susceptible genotype according to the size of an amplified band. The molecular marker is used for identifying or breeding wheat stripe rust resistant germplasm resources, or wheat gene Yr5 typing and wheat molecular marker assisted breeding are used, and the breeding process of wheat disease resistant varieties is accelerated.

Description

Technical Field

[0001] The invention belongs to the field of wheat molecular genetics, and specifically relates to a wheat stripe rust resistance gene Yrym112, an InDel molecular marker and application thereof. Background Art

[0002] Wheat stripe rust is one of the most serious diseases in my country's wheat production. Historically, wheat yield losses in areas with widespread stripe rust can reach 25%-40%. In the process of wheat breeding, the long-term use of backbone parents has led to a narrowing of the genetic basis of wheat, and the promoted varieties have a single disease resistance locus, with only a few stripe rust resistance genes being used. However, the long-term use of a single disease resistance gene will accelerate the mutation of stripe rust and the emergence of toxic subspecies, which will directly lead to the loss of resistance of the selected and promoted wheat varieties, posing severe challenges to wheat breeding and production.

[0003] In recent years, with the emergence of new stripe rust virulent races CYR32, CYR33 and CYR34, a large number of wheat varieties carrying Yr9, Yr10 and Yr24 / Yr26 / YrCH42 have lost their stripe rust resistance. Studies have found that there are very limited high-resistance stripe rust genes that can be used in my country's wheat production throughout the growth period. Gene Yr5 is highly resistant to stripe rust virulent races CYR32, CYR33 and CYR34, and many units in my country are using it. However, physiological races that can overcome Yr5 resistance have been found in India, Australia and Turkey. For the first time in my country, the pathogenic strain TSA-6 of this gene was also found in Shaanxi.

[0004] In order to broaden and enrich the wheat stripe rust resistance gene resource pool, domestic and foreign scientific and technological workers have continuously discovered stripe rust resistance genes from wheat promotion varieties, local varieties (farmer varieties), wild relatives and distant species. So far, 86 stripe rust resistance genes have been officially named (Yr1-Yr86). In addition to the above-mentioned stripe rust resistance genes that have been officially named, more than 384 Yr QTL loci have been reported. Although many stripe rust resistance genes have been discovered, most of the disease-resistant germplasm resources have lost their resistance to stripe rust before they are transferred to wheat varieties due to the influence of genetic background and linkage drag. Only a few disease-resistant genes or QTLs have been actually used in wheat disease-resistant breeding. Therefore, it is necessary to identify excellent wheat stripe rust resistance gene resources, discover new wheat stripe rust resistance genes, and develop gene-specific functional molecular markers. On the one hand, this will provide new germplasm resources and target genes for wheat stripe rust resistance breeding. On the other hand, the developed specific molecular markers will be used to quickly screen the target genes in hybrid breeding offspring, combined with molecular marker-assisted selection breeding technology, to accelerate the selection and breeding of new wheat stripe rust resistance germplasm and new varieties.

[0005] In view of the above analysis, the technical problems that need to be solved urgently in the prior art are:

[0006] Wheat lacks excellent stripe rust-resistant gene resources, and there is an urgent need to discover new wheat stripe rust-resistant genes to broaden the genetic basis of wheat disease resistance; the allele Yrsp of the wheat stripe rust-resistant gene Yr5 has currently lost resistance, and Yr5 is at risk of losing disease resistance due to overuse, so there is a need to discover new alleles; the current molecular markers for identifying the Yr5 genotype can only distinguish between Yr5 and Yrsp, but cannot identify new alleles, and the stripe rust resistance of the wheat to be tested cannot be clearly determined through this molecular marker, so there is an urgent need to develop specific functional molecular markers based on the new alleles. Summary of the invention

[0007] In order to solve the above technical problems, the present invention provides a wheat stripe rust resistance gene Yrym112, InDel molecular marker and application.

[0008] In a first aspect, the present invention first provides a new gene for wheat stripe rust resistance, wherein the gene is Yrym112 which is a new allele of Yr5, and its nucleotide sequence is shown in SEQ ID NO.1, and its encoded amino acid sequence is shown in SEQ ID NO.2.

[0009] In the second aspect, the present invention provides a functional molecular marker Yrym112-InDel for detecting the wheat stripe rust resistance gene Yrym112. The marker is designed based on the 26 / 29 / 16bp insertion / deletion (Indel) sites present in the second intron region. The marker includes the upstream primer sequence SEQ ID NO.3 and the downstream primer sequence SEQ ID NO.4.

[0010] Preferably, the length of the inserted sequence is 166 / 169 / 156 bp, and the length of the deleted sequence is 140 bp.

[0011] In a third aspect, the present invention provides a specific primer combination for identifying wheat stripe rust resistance, wherein the specific primers include primers with sequences as shown in SEQ ID NO.3 and SEQ ID NO.4.

[0012] In a fourth aspect, the present invention provides the wheat stripe rust resistance gene Yrym112, or the specific primer combination Yrym112-InDel, for use in identifying or assisting in identifying wheat stripe rust resistance and in molecular marker-assisted selection breeding of wheat stripe rust resistance.

[0013] Preferably, the application includes at least one of the following methods:

[0014] (1) Identification of wheat germplasm resources resistant to stripe rust;

[0015] (2) Creation of wheat stripe rust-resistant germplasm resources;

[0016] (3) Breeding and improvement of wheat resistance to stripe rust;

[0017] (4) Wheat stripe rust resistance testing;

[0018] (5) Genotyping of wheat stripe rust resistance gene Yr5.

[0019] In a fifth aspect, the present invention provides a method for detecting the wheat Yrym112 genotype, using the wheat genomic DNA to be tested as a template, using a specific primer combination Yrym112-InDel for PCR amplification, and determining the Yrym112 genotype based on the electrophoresis band pattern.

[0020] Preferably, the determination method comprises:

[0021] If only the 140bp specific band appears, it means that the wheat stripe rust resistance gene Yrym112 exists in the tested wheat.

[0022] If only the specific band pattern of 166 / 169 / 156 bp appears, it means that the wheat stripe rust resistance gene Yrym112 does not exist in the tested wheat, but contains Yr5 or other Yr5 alleles;

[0023] If the 140bp and 166 / 169 / 156bp bands appear at the same time, the sample to be tested is judged to be a heterozygous genotype.

[0024] In a sixth aspect, the present invention provides a method for detecting wheat stripe rust resistance, wherein the genomic DNA of the wheat plant to be tested is amplified using a specific primer combination of the molecular marker Yrym112-InDel, and the stripe rust resistance of the wheat is determined based on the gel electrophoresis band pattern.

[0025] Preferably, the determination method comprises:

[0026] If the amplified product is a 140bp specific band, it carries the Yrym112 disease resistance gene, and the wheat variety to be tested is highly resistant to wheat stripe rust. If the amplified product is a 166 / 169 / 156bp specific band, the gene carried is Yr5 or other alleles of Yr5, and the wheat variety to be tested is not necessarily resistant to wheat stripe rust.

[0027] In combination with the above technical solutions and the technical problems solved, the advantages and positive effects of the technical solutions to be protected by the present invention are as follows:

[0028] (1) The expected benefits and commercial value of the technical solution of the present invention after transformation are:

[0029] The stripe rust resistance gene Yrym112 provided by the present invention positively regulates the resistance to wheat stripe rust, and is a new allele of the stripe rust resistance gene Yr5. The stripe rust single species identification result shows that the wheat material containing the Yrym112 gene is highly resistant to the mainstream toxic species currently in production, and the resistance is better than Yr5. The discovery and utilization of the Yrym112 gene can broaden the disease resistance genetic basis of wheat, reduce the harm caused by the excessive use of the Yr5 gene, and slow down the variation of stripe rust species. It is an excellent disease resistance gene resource for wheat. At present, the wheat yield loss caused by wheat stripe rust can reach 25%-40%. The wheat variety Yunmai 112 containing the stripe rust resistance gene Yrym112 has a unit yield of 170.24 kilograms higher than that of the local variety (highly susceptible to stripe rust) in actual production experiments, an increase of 70.73%, and an increase of more than 400 yuan per mu.

[0030] (2) The technical solution of the present invention fills the technical gap in the industry at home and abroad:

[0031] Yrym112 is a wheat stripe rust resistance gene from common wheat varieties. This gene has no significant effect on other agronomic traits of wheat varieties and has broad-spectrum resistance. It is an excellent resistance gene resource to replace Yr5. Studies have found that the allele Yrsp of the wheat stripe rust resistance gene Yr5 has lost its resistance. Yr5 is overused and is at risk of losing its disease resistance. New alleles need to be discovered. The current molecular markers for identifying the Yr5 genotype can only distinguish between Yr5 and Yrsp, but cannot identify the new allele Yrym112. In addition, the stripe rust resistance of the wheat to be tested cannot be clearly determined by this molecular marker. There is an urgent need to develop specific functional molecular markers based on new alleles. This gene resource is reported for the first time at home and abroad and has not yet been used on a large scale in wheat disease resistance breeding. The developed Yrym112 gene-specific molecular marker can accurately identify the stripe rust resistance of the Yrym112 gene and material, greatly improving the utilization efficiency of Yrym112 in future wheat disease resistance breeding, and filling the industry gaps in the lack of excellent resistance gene resources at home and abroad and the lack of identification of Yr5 new allele Yrym112 molecular markers.

[0032] (3) The technical solution of the present invention overcomes technical prejudice:

[0033] The technical solution of the present invention significantly solves several key problems of the prior art in disease-resistant breeding by developing a gene-specific molecular marker Yrym112-Indel for detecting wheat stripe rust resistance. There is a certain distance between the traditional gene-linked molecular marker and the target gene locus. During the hybridization and breeding process of the disease-resistant locus, the marker and the target gene will be separated due to the occurrence of recombination events. Compared with traditional linkage molecular markers, gene-specific molecular markers exist in the gene and are co-separated with the target gene, and there is no recombination phenomenon. Molecular marker detection is not affected by material type and genetic background, and the detection result has high credibility, which greatly improves the efficiency of gene breeding.

[0034] Technically, the present invention solves the problem of difficulty in determining the stripe rust phenotype in existing breeding. Traditional disease resistance identification methods mostly rely on long-term phenotypic observation and control of environmental conditions, which is time-consuming and labor-intensive, and has significant uncertainty and inefficiency. Through the specific Yrym112-Indel molecular marker, the present invention can accurately distinguish wheat plants carrying disease-resistant genotypes and susceptible genotypes, avoiding the complex phenotypic measurement process that traditional detection relies on. In addition, the marker detection method of the present invention does not rely on environmental conditions and growth period restrictions for breeding materials, and therefore can be widely used in early disease-resistant breeding screening, solving the problems of difficult early judgment and low breeding efficiency in the breeding process.

[0035] In terms of industrial application, the present invention greatly shortens the cycle of disease-resistant breeding, allowing breeding institutions to screen a large amount of materials in a short period of time, quickly lock in disease-resistant genotype plants, and significantly improve the efficiency and success rate of disease-resistant breeding. At the same time, the use of the labeling method of the present invention can provide disease-resistant genotype data at the molecular level, facilitate breeding records and the preservation and utilization of disease-resistant gene resources, and reduce manpower and resource consumption. In the rapid promotion of disease-resistant wheat, this technical solution supports the screening of large-scale germplasm resources and provides a stable and reliable technical guarantee for the industrial production of wheat resistant to stripe rust. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 The results of resistance identification of different stripe rust physiological races of Yunmai 112 at the seedling stage are shown in the figure. The susceptible leaves are the control Mingxian 169, and the resistant leaves are Yunmai 112. The infection type (IT) was measured according to the 0-4 scale, with the resistant type being IT≤2 and the susceptible type being ≥3.

[0037] Figure 2 To detect disease resistance loci in Yunmai 112, Figure 2 A. Figure 2B is the molecular marker detection of stripe rust resistance loci Yr9 and Yr5 (Yrsp) in Yunmai 112, among which the wheat material Avocet S does not contain any stripe rust resistance loci, Avocet*6 / Yr5 only contains the disease resistance gene Yr5, Avocet*6 / Yrsp only contains the disease resistance gene Yrsp, and Avocet*6 / Yr9 only contains the disease resistance gene Yr9; Figure 2 C is the resistance identification result of mixed races in the field at the adult stage; Figure 2 D is the in situ hybridization of the DNA molecule of Yunmai 112. The probe sequences used are oligo-pSc119.2-1, oligo-pAs1-1, 1-4, and 1-6. The green signal is the specific signal of Secale cereale 1RS.1BL.

[0038] Figure 3 This study was conducted to identify the resistance of F1 (Yunmai 112×Fielder) to stripe rust at the seedling stage. The physiological race of stripe rust used for identification was CYR34.

[0039] Figure 4 This is the positioning result of the 55K chip. Figure 4 A is the distribution of polymorphic SNP sites on chromosomes between the resistance and sensitivity pools, Figure 4 B is the distribution of polymorphic SNP sites on chromosome 2B.

[0040] Figure 5 To study the function of Yrym112 gene using BSMV-VIGS; Figure 5 A: Analysis of Yrym112 gene expression 15 days after virus application; BSMV-γ-EV refers to plants smeared with γ empty vector, BSMV-γ-PDS refers to plants smeared with PDS, and BSMV-γ-Yrym112 refers to plants smeared with Yrym112; Figure 5 B: Stripe rust phenotypes of virus plant leaves inoculated with CYR34. Asterisks indicate significant differences analyzed by T test (*P<0.05, **P<0.01).

[0041] Figure 6 Schematic diagram of the Yrym112 gene structure and gene sequence Indel sites. Figure 6 A is a schematic diagram of the gene structure of Yrym112, including two introns and three exons; Figure 6 B is the sequence difference between Yrym112 and homologous genes at the second intron. The sequence of Yrym112 is an artificial clone sequence, and the gene sequences of Yr5 and Yrsp have been cloned and reported. The homologous sequences of 19 sequenced wheats including Chinese Spring were extracted by comparison on the WheatOmics 1.0 website.

[0042] Figure 7Partial detection results of the developed functional molecular marker Yrym112-Indel in wheat materials. DETAILED DESCRIPTION

[0043] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0044] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0045] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0046] All test materials in the following examples were grown in a sterile light culture box with a humidity of 85%-90%, a light of 14h / 22℃, and a dark of 10h / 20℃. When the plants grew to two leaves and one heart, they were inoculated with physiological species CYR34. The identification method is as follows: the susceptible variety Mingxian 169 was planted in a pot in a light culture box, and 0.02% Tween 20 solution was sprayed at the two-leaf stage. Fresh stripe rust species CYR34 was inoculated on the first leaf by smearing method. The plants were placed in a culture box at 10℃ in the dark for 24 hours to grow normally. The photoperiod was 16h light (light intensity was about 10000 lux) / 8h dark. About 15 days after inoculation, when the control Mingxian 169 was fully diseased, the reaction type (IT) of the test material was recorded according to the 0-4 level. Thereafter, the investigation was conducted every 5 days, for a total of 3 times, and the highest IT was used as the disease resistance level of the material.

[0047] like Figure 1-7 As shown in Example 1, identification of stripe rust resistance and detection of resistance sites of Yunmai 112

[0048] (1) Identification of single species of stripe rust

[0049] In order to clarify the resistance spectrum of Yunmai 112, the stripe rust single race identification platform of Northwest Agriculture and Forestry University was used to identify the stripe rust resistance of Yunmai 112 at the seedling stage. The identification results showed that compared with the susceptible variety Mingxian 169, Yunmai 112 was immune to the six physiological races (CYR23, CYR29, CYR31, CYR32, CYR33, and CYR34) identified. Figure 1 ), indicating that Yunmai 112 has broad-spectrum resistance.

[0050] (2) Molecular marker detection of known disease resistance loci

[0051] In order to identify the disease resistance loci in Yunmai 112, the project used 11 reported linked molecular markers of stripe rust resistance loci to conduct molecular marker detection on Yunmai 112. The results showed that Yunmai 112 contained the Yr9 disease resistance locus from rye. Cytological results also proved that Yunmai 112 contained the apical ectopic locus of 1RS.1BL ( Figure 2 In addition, the Yr5 allele YrSP was also detected in Yunmai 112 ( Figure 2 B) and stripe rust resistance identification found that Yr9 and YrSP have lost their stripe rust resistance ( Figure 2 C), it was speculated that Yunmai 112 contained a new disease resistance locus and was temporarily named Yrym112.

[0052] Example 2 Location and cloning of stripe rust resistance gene Yrym112

[0053] (1) Genetic analysis of stripe rust resistance loci in Yunmai 112

[0054] To further identify the disease resistance loci in Yunmai 112, Yunmai 112 was crossed with the susceptible variety Fielder to obtain the hybrid F1 generation. The stripe rust resistance test at the seedling stage showed that all F1 plants were resistant to wheat stripe rust ( Figure 3 ), indicating that the disease resistance locus in Yunmai 112 may be dominant. The genetic analysis of resistance in the F2 population found that its resistance-susceptibility segregation ratio was consistent with 3:1 (χ 2 =0.621, P = 0.431) (Table 2), further indicating that the disease resistance locus Yrym112 in Yunmai 112 conforms to single gene dominant inheritance.

[0055] Table 2 Genetic analysis of resistance of Yunmai 112 to stripe rust CYR34

[0056]

[0057] (2) Location of stripe rust resistance loci in Yunmai 112

[0058] In the F2 population of Yunmai 112 and Fielder, 50 highly resistant and 50 highly susceptible plants were selected to construct a resistance-susceptibility mixed pool for 55K chip sequencing. The wheat 55K chip data combined with the BSA (resistance-susceptibility mixed pool analysis) analysis method were used to screen resistance-linked SNP loci. A total of 10,817 SNP loci screened between the resistance-susceptibility pools were mainly concentrated on chromosome 2B of wheat (1,973 SNPs) ( Figure 4A), it is speculated that the wheat stripe rust resistance locus Yrym112 in Yunmai 112 is located on chromosome 2B. Referring to the genome of Chinese Spring, the SNPs on the chromosome were anchored to the physical position of the chromosome, and it was found that the differential SNP sites on 2B were mainly concentrated in the physical position of 643.310-701.315Mb, totaling about 58Mb (934 SNPs) ( Figure 4 B). It is speculated that the wheat stripe rust resistance locus Yrym112 in Yunmai 112 is located in this physical interval.

[0059] (3) Cloning and sequence alignment of Yrym112 homologous genes

[0060] Further, by comparing the physical location intervals of the reported wheat stripe rust resistance genes, the physical interval of Yr5 / Yrsp / Yr7 is just located in the physical interval of Yrym112. Considering that the resistance of Yrsp and Yr7 has been lost, in order to exclude that the resistance of Yunmai 112 comes from Yr5, the gene cloning primers CL-F: ACACGACTCCAATCCACTGA (SEQ ID NO.5) CL-R: TAGAATGACTCCGCGACGA (SEQ ID NO.6) were designed by homologous cloning method, and Yr5 was homologously cloned in Yunmai 112. The results showed that Yunmai 112 contains the allele of Yr5, but the coding sequence similarity between the two is 98.4%. There are a large number of SNP sites, which is a new allele of Yr5 and belongs to the typical BED-NLR type protein encoding ( Figure 5 A).

[0061] Example 3 VIGS system verifies the function of Yrym112 gene

[0062] To further determine the gene function of Yrym112, this study used barley stripe mosaic virus-induced gene silencing (VIGS) to conduct a preliminary study on the function of Yrym112 gene in resistance to wheat stripe rust. According to the gene coding sequence (SEQ ID NO.1), a 207 bp specific sequence in the BED domain of Yrym112 was selected as the target for silencing. The target sequence was SEQ ID NO.7: ATCAAGGGGCCATGTCGATACACTGAATTGCAGTGTTGGCAAATTACGATCCCCGGTATGGGAACACTTCACGATCACAGAAACAACTATCGACGGGAAGCGTTCAAAAGCCAAATGTAACTACTGTGGAAATGATTTTAATTGCGAAACGAAGACAAACGGGACTTCATCTATGAAAAAACATTTGGAGAAAGAGCATTCCGTGAC. Primers were designed to amplify the target sequence VIGS-F: CTTCCGTTTCTAAGGAAGTTTAAGTCAGCTCTTTCTCC (SEQ ID NO.8) VIGS-R: TTTTAACCACCACCACCGTATCAAGGGGCCATGTCGATA (SEQ ID NO.9), and inserted it into the pCa-γbLIC vector in reverse through homologous recombination, silencing Yrym112 in Yunmai 112, and using the specific expression primers of Yrym112 Q-Yrym112-F:TGGTTTTGACGAATCTTCCGA (SEQ ID NO.10), Q-Yrym112-R:TCGCAGGTGTCACATCTTCA (SEQ ID NO.11) to detect the silencing efficiency. The study found that compared with the negative control BSMV-γ-EV, the expression level of Yrym112 in the three virus-inoculated strains BSMV-Yrym112-1, BSMV-Yrym112-2 and BSMV-Yrym112-3 was significantly decreased ( Figure 6 A). After inoculation with wheat stripe rust fungus CYR34, the stripe rust phenotype of the silenced individual plants showed different degrees of disease symptoms compared with the negative control ( Figure 6 B); This indicates that Yrym112 positively regulates wheat resistance to stripe rust, and that the gene Yrym112 confers stripe rust resistance to Yunmai 112.

[0063] Example 4 Obtaining the functional molecular marker Yrym112-Indel of the wheat stripe rust resistance gene Yrym112

[0064] 1. Development of Yrym112-Indel, a functional molecular marker of Yrym112

[0065] The present invention first locates the wheat stripe rust resistance gene in the wheat variety Yunmai 112 and finds that it overlaps with the location interval of the cloned wheat stripe rust resistance gene Yr5. Homologous cloning proves that the wheat stripe rust resistance gene Yrym112 in Yunmai 112 is a new allele of Yr5, and the disease resistance function of the Yrym112 gene is verified by VIGS experiments. The existing molecular markers for detecting the Yr5 locus can only distinguish between the Yr5 and Yrsp genotypes, and there are no reports on molecular markers for detecting the new allele Yrym112.

[0066] Further comparison of the Yrym112 gene sequence with that of Yr5 showed that in addition to a large number of SNP sites, there was an insertion / deletion of 26 bp in the second intron of the gene ( Figure 5 B). Yrym112 has a 26bp deletion at this site, and Yr5 has a 26bp insertion at this site. Using the WheatOmics 1.0 website, a whole genome comparison of Yrym112 was performed in the wheat crop reference genome database. It was found that in the reference genomes of five wheat varieties, including KN9204, the Yrym112 homologous base had a 26bp insertion in the second intron. In the reference genomes of five wheat varieties, including Chinese Spring, the Yrym112 homologous base had a 29bp insertion in the second intron. In the reference genomes of nine wheat varieties, including Zang 1817, the Yrym112 homologous base had a 16bp insertion in the second intron. Only the Yrym112 gene had a 26bp deletion at this position, which is a rare mutation specific to the Yrym112 gene ( Figure 5 B).

[0067] According to the difference between Yrym112 and homologous gene sequences, the embodiment of the present invention designs an Indel marker Yrym112-Indel at the insertion site using Primer 5.0 software for the missing site in the second intron region.

[0068] The primer sequences of the developed functional molecular markers are:

[0069] The forward primer sequence is: 5'-TGACTTGTACGAAGAAACCTGG-3' (SEQ ID NO.3) The reverse primer sequence is: 5'-TTTCAGTTGCATAGCCGGTG-3' (SEQ ID NO.4)

[0070] 2. Verification of the functional molecular marker Yrym112-Indel of Yrym112

[0071] The CTAB method was used to extract genomic DNA of the samples to be tested, including materials: Yunmai 112, Fielder, (Yunmai 112×Fielder)F1, Avocet*6 / Yr5, Avocet*6 / Yrsp, Chinese Spring, (Yunmai 112×Fielder)F1, (Yunmai 112×Yangmai 33)BC2F1, (Yunmai 112×Yunmai 52)BC2F1, Aikang 58, Zang 1817, and Xumai 9180.

[0072] PCR amplification system: Each 10 μL includes: 50 ng / μL genomic DNA 1.0 μL, 5 μL PCR Master Mix,

[0073] PCR amplification conditions: pre-denaturation at 95°C for 3 minutes; denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 30 seconds, for 32 cycles; extension at 72°C for 5 minutes; storage at 4°C.

[0074] The PCR products were electrophoresed on 8% polyacrylamide gel (Acr:Bis=29:1) to detect the amplification results. After the electrophoresis, the silver staining method was used to develop the amplified bands and the results were counted.

[0075] Mark detection results show ( Figure 7 ), the amplified band size in Yunmai 112 is 140bp, the amplified band size in China Spring, Fielder, Avocet*6 / Yr5, Avocet*6 / Yrsp is 166bp or 169bp (the difference is 3bp and cannot be distinguished by polyacrylamide gel electrophoresis), and the amplified size in modern wheat varieties Aikang 58, Zang 1817, and Xumai 9180 is 156bp, belonging to the third genotype. The band type of marker amplification in (Yunmai 112×Fielder)F1 is a heterozygous band type, including 140bp and 169bp. The specific band type of 140bp of the Yrym112 gene can be specifically detected in the breeding materials (Yunmai 112×Yangmai 33)BC2F1 and (Yunmai 112×Yunmai 52)BC2F1.

[0076] The molecular marker designed in the embodiment of the present invention can specifically track the Yrym112 gene, that is, the primer set is used to PCR amplify and detect plant DNA. If the amplification product contains a 140bp specific band, the material carries the Yrym112 gene. If the amplification product does not have a 140bp specific band, the material does not carry the Yrym112 gene. In the hybrid transformation material of Yunmai 112, the Yrym112 gene can be tracked according to the 140bp specific band, and the stripe rust resistance of the test material can be judged by the 140bp specific band, that is, wheat containing the 140bp specific band is resistant to wheat stripe rust.

[0077] The above description is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Any modifications, equivalent substitutions and improvements made by any technician familiar with the technical field within the technical scope disclosed by the present invention and within the spirit and principle of the present invention should be covered by the protection scope of the present invention.

Claims

1. A wheat stripe rust resistance gene Yrym112, characterized in that: The gene is an allele of wheat stripe rust resistance gene Yr5, located on the long arm of wheat chromosome 2B, with its CDS nucleotide sequence as shown in SEQ ID NO.1, and its encoded amino acid sequence as shown in SEQ ID NO.

2.

2. A functional molecular marker Yrym112-InDel for detecting the wheat stripe rust resistance gene Yrym112 according to claim 1, characterized in that: The marker detects a 26 bp insertion / deletion (Indel) site in the second intron region based on the difference between the sequences of genes Yrym112 and Yr5. The marker includes an upstream primer sequence SEQ ID NO.3 and a downstream primer sequence SEQ ID NO.

4.

3. The molecular marker Yrym112-InDel according to claim 2, characterized in that The lengths of the inserted sequences were 166 / 156 / 169 bp, and the length of the deleted sequences was 140 bp.

4. A specific primer combination for identifying wheat stripe rust resistance, characterized in that: Comprising the primer sequence described in claim 2.

5. Use of the wheat stripe rust resistance gene Yrym112 according to claim 1, or the functional molecular marker Yrym112-InDel according to claim 2, or the specific primer combination according to claim 4 in identifying or assisting in identifying wheat stripe rust resistance and in wheat stripe rust resistance molecular marker-assisted selection breeding; The application includes at least one of the following methods: (1) Identification of wheat germplasm resources resistant to stripe rust; (2) Creation of wheat stripe rust-resistant germplasm resources; (3) Breeding and improvement of wheat resistance to stripe rust; (4) Wheat stripe rust resistance testing; (5) Genotyping of wheat stripe rust resistance gene Yr5.

6. The use according to claim 5, characterized in that The specific primer combination of the molecular marker Yrym112-InDel of the wheat stripe rust resistance gene according to claim 4 is used to amplify the genomic DNA of the wheat plant, the amplified product is subjected to electrophoresis, and the Yrym112 genotype of the wheat is determined according to the gel electrophoresis band pattern.

7. The use according to claim 6, characterized in that; The method for detecting the wheat Yrym112 genotype is: If only the 140bp specific band appears, it means that the wheat stripe rust resistance gene Yrym112 exists in the tested wheat. If only the specific band pattern of 166 / 169 / 156 bp appears, it means that the wheat stripe rust resistance gene Yrym112 does not exist in the tested wheat, but contains Yr5 or other Yr5 alleles; If the 140bp and 166 / 169 / 156bp bands appear at the same time, the sample to be tested is judged to be a heterozygous genotype.

8. The use according to claim 5, characterized in that The specific primer combination of the molecular marker Yrym112-InDel of the wheat stripe rust resistance gene is used to amplify the genome DNA of the wheat plant, and the amplified product is subjected to electrophoresis to judge the stripe rust resistance of the wheat according to the gel electrophoresis band pattern.

9. The use according to claim 8, characterized in that: The method for detecting wheat stripe rust resistance is: if the amplified product is a 140bp specific band, it carries the Yrym112 disease resistance gene, and the wheat variety to be tested is highly resistant to wheat stripe rust; if the amplified product is a 166 / 156 / 169bp specific band, the gene carried is Yr5 or other alleles of Yr5, and the wheat variety to be tested is not necessarily resistant to wheat stripe rust.

Images