Method and application of low-temperature response gene PbbZIP44 in enhancing cold resistance of plants

Abstract

The invention provides a cold-resistant gene PbbZIP44 which is separated and cloned from a pyrus betulaefolia stock and contains a BRZL structural domain, and provides application of the gene in improvement of cold resistance of plants. An over-expression vector and a silent vector of the PbbZIP44 gene are constructed, and are introduced into arabidopsis thaliana, pyrus calluses and pyrus betulaefolia seedlings by using an agrobacterium tumefaciens-mediated genetic transformation method, so that stable expression and transient expression are realized, and a stable over-expression plant and a TRV-mediated silent strain are obtained and are used for low-temperature resistance function analysis. A research result shows that under a low-temperature stress condition, compared with a wild type plant, an overexpression strain shows a stronger growth state, lower malondialdehyde content and relative conductivity, and higher photosynthetic efficiency and oxidation resistance; and the silent strain shows an opposite physiological reaction.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering and specifically relates to a low temperature response gene PbbZIP44 Application in enhancing plant cold resistance. Background Art

[0002] pear( Pyrus spp. ) is one of the three major fruits in my country and has an important position and economic value in the national economy. However, with the dramatic global climate change and frequent extreme weather in recent years, pear trees are facing a variety of biological and abiotic stresses, among which low temperature stress is one of the most serious adversities. Low temperature conditions limit the cultivation areas of many excellent pear varieties, and during the growth of pear trees, frequent cold damage will significantly reduce the yield and fruit quality, thus causing serious economic losses to the pear industry and restricting its further development. In recent years, global climate change has intensified and extreme low temperature events have occurred frequently, bringing greater challenges to fruit tree planting. For example, in 2018 and early April 2020, low temperatures in the Beijing-Tianjin-Hebei region caused large areas of pear trees in the flowering period to be frozen, and the disaster rate in some areas even exceeded 80% (Li Ying, 2021; Han Hongying, 2019). Similarly, in 2013, 2018 and 2020, pear trees in Shanxi Province suffered frost during the flowering period, resulting in more than 70% of pear fruits in the province being damaged (Bai Mudan, 2020). The occurrence of these extreme climate events indicates that low temperature stress has become one of the main factors limiting pear tree growth and fruit yield.

[0003] Faced with this situation, it has become particularly urgent to breed new pear varieties with stronger cold resistance. However, cold-resistant breeding of pears faces multiple challenges. As a perennial woody plant, pears have the characteristics of complex genetic background, self-incompatibility, and long juvenile period. Traditional breeding methods are difficult to be efficiently applied in pear trees, and the breeding cycle is long. In recent years, with the development of plant biotechnology, especially genetic engineering technology, new opportunities have been provided for the improvement of pear germplasm. Through the excavation and functional analysis of important stress-resistant genes, the foundation can be laid for the genetic improvement of pear trees, and it also provides the possibility for breeding new cold-resistant varieties. This can not only improve the adaptability of pear trees to low temperature stress, but also promote the sustainable development of the pear industry. Therefore, in-depth research on the cold-resistant genes of pear trees and their regulatory mechanisms, and exploration of their physiological and molecular response processes under low temperature conditions, has become a key area and development direction of fruit tree stress resistance research.

[0004] Basic leucine zipper (bZIP) transcription factors are the most widely distributed and conserved proteins among eukaryotic transcription factors, and have important regulatory functions in many biotic and abiotic stresses (Liu et al., 2023). The structure of bZIP transcription factors includes a basic region and a leucine zipper domain. The basic region is relatively conserved, consisting of about 20 amino acid residues, containing a fixed nuclear localization signal N-(X)7-R / K, which can specifically bind to DNA cis elements. The leucine zipper region is not conserved, consisting of one or more repeating regions, containing a large number of hydrophobic amino acids such as leucine, isoleucine, and valine, and forms homologous or heterologous dimers through dimerization, thereby achieving activation or inhibition of transcription factors (Guo et al., 2024). The abiotic stress response network mediated by bZIP transcription factors is an important mechanism for plants to cope with various abiotic stresses (such as salinity, drought, waterlogging, and cold damage). Plants inevitably face these adverse environments during their growth and development, and bZIP transcription factors play a key regulatory role under these conditions. Rab16B The ABA response element (ABRE) and coupling element (CE) in the gene together form the ABA response complex (ABRC), which enhances ABA-dependent transcription under stress conditions, thereby improving plant stress resistance (Roychoudhury et al., 2008; Banerjee and Roychoudhury, 2015). In addition, OsbZIP71 Overexpression of OsbZIP71 This makes rice more sensitive to drought, abscisic acid and salt stress (Liu et al., 2014). OsbZIP23 As transcriptional regulators, bZIP transcription factors regulate the expression of multiple stress-related genes through ABA-dependent pathways to respond to abiotic stresses (Xiang et al., 2008). In other plants, bZIP transcription factors also exhibit important functions. For example, DgbZIP2 interacts with DgbZIP3 in chrysanthemum to promote the expression of DgPOD, thereby improving cold tolerance (Bai et al., 2018). bZIP60 in maize enhances resistance under heat stress by regulating the unfolded protein response, while bZIP68 negatively regulates the cold tolerance of maize by regulating the expression of a group of COR genes (Li et al., 2020, 2022). GmbZIP44, GmbZIP62, and GmbZIP78 in soybean regulate the resistance of transgenic Arabidopsis to salt and cold stress through ABA-related pathways (Liao et al., 2008).

[0005] Pyrus betulaeformis is a widely used rootstock in the pear industry. It has strong stress resistance and is an ideal material for studying woody plant resistance and cloning related stress resistance genes. PbbZIP44 Identifying cold-resistant genes and exploring their cold-resistant functions are of great significance for the breeding of cold-resistant varieties. Summary of the invention

[0006] The present invention aims to solve the technical problem and overcome the shortcomings of the prior art to provide a low temperature response gene PbbZIP44 Application in enhancing plant cold resistance, isolation and cloning of transcriptional regulatory factors from leaves of Pyrus betula PbbZIP44 , and its application in genetic improvement of plant cold resistance. After the gene is overexpressed or silenced in the plant, the plant shows enhanced cold resistance or low temperature sensitivity, respectively.

[0007] One of the purposes of the present invention is to provide a pear stress-related gene PbbZIP44 , and its nucleotide sequence is shown in SEQ ID NO.1.

[0008] The technical solution further optimized by the present invention is as follows: Pear stress-related genes PbbZIP44 The encoded protein, the amino acid sequence of which is shown in SEQ ID NO.2.

[0009] The second object of the present invention is to provide the pear stress-related gene PbbZIP44 The amplification method is to perform PCR amplification using the cDNA of Pyrus betulae leaves as a template. The conditions for PCR amplification are: pre-denaturation at 94°C for 3 minutes; denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 90 seconds, for 35 cycles, and then extension at 72°C for 10 minutes.

[0010] The third object of the present invention is to provide a method for amplifying the pear stress-related gene PbbZIP44 A primer pair comprising a forward primer F and a reverse primer R, the nucleotide sequence of the forward primer F is shown in SEQ ID NO.3, and the nucleotide sequence of the reverse primer R is shown in SEQ ID NO.4.

[0011] In the present invention, Pyrus betulaeformis seedlings are treated at a low temperature of 4°C, samples are taken at corresponding time points, and real-time quantitative PCR is used to analyze the relative expression amount of the coding gene provided by the present invention.

[0012] The present invention also provides a method comprising the pear stress-related gene PbbZIP44 The recombinant expression vector of the invention comprises a pCAMBIA1300 vector as its basic vector.

[0013] The present invention further provides a method comprising the pear stress-related gene PbbZIP44 The host bacteria is Agrobacterium tumefaciens.

[0014] The fourth object of the present invention is to provide the pear stress-related gene PbbZIP44 Application in enhancing plant cold resistance.

[0015] In the above application, construct PbbZIP44 Gene overexpression vectors were used to transform the PbbZIP44 The bZIP transcription factor in Pyrus betula was introduced into the plant PbbZIP44 Overexpression in plants can produce transgenic plants with significant cold resistance.

[0016] In the above application, the plants are Arabidopsis seedlings, Pyrus betula callus and Pyrus betula seedlings.

[0017] The invention provides a cold-resistant gene containing a BRZL domain isolated and cloned from pear rootstock PbbZIP44 and provide the application of the gene in improving plant cold resistance. PbbZIP44 The overexpression vector and silencing vector of the gene were developed, and the Agrobacterium-mediated genetic transformation method was used to introduce it into Arabidopsis thaliana, Pyrus oleraceus callus and Pyrus betulae seedlings, achieving stable expression and transient expression, thereby obtaining stable overexpression plants and TRV-mediated silencing strains for functional analysis of low temperature resistance. The results showed that under low temperature stress conditions, the overexpression strains showed stronger growth, lower malondialdehyde content and relative conductivity, as well as higher photosynthetic efficiency and antioxidant capacity compared with wild-type plants; while the silenced strains showed the opposite physiological response. In summary, PbbZIP44 The gene has the ability to significantly improve plant resistance to cold.

[0018] PbbZIP44 The discovery of the gene provides a new genetic resource for molecular breeding of plant cold resistance, provides a scientific basis for cold-resistant breeding of fruit trees and other crops, and helps improve the adaptability and growth performance of plants in cold regions. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 It is a technical flow chart of the present invention.

[0020] Figure 2 For the present invention PbbZIP44 Schematic diagram of low temperature expression pattern analysis and subcellular localization. PbbZIP44 A is a diagram of low-temperature expression pattern analysis, and B is a schematic diagram of subcellular localization.

[0021] Figure 3 For the present invention PbbZIP44The positive identification result after gene transformation of Arabidopsis seedlings. PbbZIP44 Figure 2. The positive DNA identification results after gene transformation into Arabidopsis seedlings. B is PbbZIP44 Figure 2. Positive RNA identification results after gene transformation into Arabidopsis seedlings.

[0022] Figure 4 For the present invention PbbZIP44 Analysis of cold resistance of gene overexpression in Arabidopsis. PbbZIP44 Fluorescence phenotype of Arabidopsis seedling leaves after 14 days of low temperature treatment and 5 days of recovery; B is overexpression PbbZIP44 Fluorescence phenotype of Arabidopsis seedling leaves after 14 days of low temperature treatment and 5 days of recovery; C is the measurement result of conductivity after low temperature treatment, D is the measurement result of malondialdehyde (MDA) after low temperature treatment, and E is the measurement result of plant photosynthetic efficiency after low temperature treatment.

[0023] Figure 5 For the present invention PbbZIP44 Results of reactive oxygen species determination in gene overexpression Arabidopsis. PbbZIP44 DAB staining of Arabidopsis seedling leaves after 14 days of low temperature treatment, B is overexpression PbbZIP44 NBT staining of Arabidopsis seedling leaves after 14 days of low temperature treatment, C is overexpression PbbZIP44 Trypan blue staining of Arabidopsis seedlings after 14 days of low temperature treatment, D is the result of hydrogen peroxide (H2O2) content determination after low temperature treatment, E is the result of anti-superoxide anion (Anti-O2 - ) Activity determination results.

[0024] Figure 6 For the present invention, the conversion PbbZIP44 The positive identification picture of the gene eggplant pear callus. In the picture, A is the transformation PbbZIP44 The results of positive DNA identification of gene eggplant pear callus, B is the transformation PbbZIP44 Figure 2. Genetic eggplant pear callus positive RNA identification results.

[0025] Figure 7 For the overexpression of the present invention PbbZIP44 The results of cold resistance analysis in eggplant pear callus. In the figure, A is the normal situation and the overexpression after 14 days of low temperature treatment. PbbZIP44 Phenotype diagram of callus of eggplant and pear, B is the normal situation and overexpression after low temperature treatment for 14 days PbbZIP44Weight graph in eggplant pear callus, C is the MDA determination result graph under normal conditions and after low temperature treatment for 14 days, D is the Proline determination result graph under normal conditions and after low temperature treatment for 14 days, E is the H2O2 determination result graph under normal conditions and after low temperature treatment for 14 days, F is the Anti-O2 - Measurement result diagram.

[0026] Figure 8 For gene silencing in the present invention PbbZIP44 Schematic diagram of the cold resistance analysis results in pears. In the figure, A is the pear after 14 days of low temperature treatment. PbbZIP44 Phenotype of silent strains, B is the identification diagram of VIGS materials after low temperature treatment, C is the conductivity measurement result diagram after 14 days of low temperature treatment, D is the MDA measurement result diagram after 14 days of low temperature treatment, E is the H2O2 measurement result diagram after 14 days of low temperature treatment, F is the Anti-O2 - Measurement result diagram. DETAILED DESCRIPTION

[0027] The technical solution of the present invention is further described in detail below in conjunction with the embodiments: This embodiment is implemented on the premise of the technical solution of the present invention, and a detailed implementation method and a specific operation process are given, but the protection authority of the present invention is not limited to the following embodiments.

[0028] The invention provides a pear alkaline leucine zipper transcription factor PbbZIP44 The coding gene, whose nucleotide sequence is shown in SEQ ID NO.1.

[0029] The present invention provides a basic leucine zipper transcription factor PbbZIP44 , and its amino acid sequence is shown in SEQ ID NO.2. PbbZIP44 The gene encodes 157 amino acids, the protein size is 17.67KDa, and the isoelectric point is 7.98. PbbZIP44 The transcription factor can improve the ability of plants to remove reactive oxygen species (ROS) and reduce membrane damage at low temperatures, indicating that the gene has cold resistance. PbbZIP44 Gene vector. The method of recombinant expression is not particularly limited, and any recombinant expression method known in the art can be used.

[0030] The present invention provides a primer pair for cloning the coding gene cDNA sequence, the forward primer sequence is shown in SEQ ID NO.3; the reverse primer sequence is shown in SEQ ID NO.4. The source of the primer pair is not particularly limited, and it can be synthesized by a biosynthetic company known in the art. In the embodiment of the present invention, the primer pair was commissioned to be synthesized by Shanghai Biotechnology Co., Ltd.

[0031] The invention provides a basic leucine zipper transcription factor from Pyrus betula PbbZIP44 Application of the coding gene or the coding gene amplified by the primer pair in improving the salt tolerance of plants.

[0032] In the present invention, the application preferably comprises the following steps: basic leucine zipper transcription factor in Pyrus betula PbbZIP44 Overexpression in plants, the resulting overexpression plants have cold resistance, PbbZIP44 The gene was silenced in Pyrus betula through VIGS, and the resulting interfered plants showed weakened salt tolerance.

[0033] In the present invention, the PCR amplification procedure is preferably 94°C pre-denaturation for 3 min; 94°C denaturation for 30 s, 58°C annealing for 90 s, 72°C extension for 90 s, 35 cycles, and 72°C extension for 10 min after the cycle is completed. The coding gene is preferably overexpressed in plants in the form of pCAM1300-GFP-PbbZIP44 recombinant vector and pTRV2 - The PbbZIP44 recombinant vector was silenced in Pyrus betula. - There is no particular limitation on the method for constructing the PbbZIP44 recombinant vector, and any construction method known in the art may be used.

[0034] The method for overexpression and gene silencing of coding genes in plants preferably adopts the method of Agrobacterium-mediated genetic transformation. The present invention has no particular limitation on the method of Agrobacterium-mediated genetic transformation, and conventional methods known in the art can be used. Plants preferably include Arabidopsis thaliana, Pyrus solani and Pyrus betula.

[0035] In the present invention, before testing the cold resistance of overexpression plants and gene silenced plants, it is preferred to also include screening of positive transgenic plants. The screening method of positive transgenic plants is preferably carried out by PCR amplification. During screening, the nucleotide sequence of the forward primer of the PCR amplification primer is shown in SEQ ID NO.3; the nucleotide sequence of the reverse primer of the PCR amplification primer is shown in SEQ ID NO.4 or SEQ ID NO.5; the reaction procedure of PCR amplification is as follows: Table 1 PCR amplification system

[0036] The PCR reaction system for PCR amplification is as follows: Table 2 Gene amplification system

[0037] After PCR amplification, if the tested plant lines can amplify fragments of the expected size, it indicates that they are positive transgenic lines.

[0038] The screening method for overexpression of positive gene plants is preferably carried out by qRT-PCR to test the gene expression amount. During screening, the forward primer sequence used in qRT-PCR is shown in SEQ ID NO.6; the reverse primer sequence of qRT-PCR is shown in SEQ ID NO.7; the screening method for positive gene silenced plants is preferably carried out by qRT-PCR to test the gene expression amount. During screening, the forward primer sequence used in qRT-PCR is shown in SEQ ID NO.10 (agaacacgggggactctagaATGGCTTCTTCAAGCGGAAA); the reverse primer sequence of qRT-PCR is shown in SEQ ID NO.11 (gcccttgctcaccatggatcc ATAGTATTGGTGAAGCATGT); the internal reference primer Tublin sequence is shown in SEQ ID NO.8 and SEQ ID NO.9, and the real-time quantitative PCR reaction procedure is as follows: Table 3 qRT-PCR reaction procedure

[0039] The real-time quantitative PCR reaction system is as follows: Table 4 qRT-PCR reaction system

[0040] After the real-time quantitative PCR amplification is completed, if the expression level of the gene amplified by the plant line to be tested is significantly higher than the expression level of the gene in the wild-type plant, this indicates that they are positive overexpression lines; if the expression level of the gene amplified by the plant line to be tested is significantly lower than the expression level of the gene in the control plant, this indicates that they are positive gene silencing lines.

[0041] In the present invention, the obtained overexpression strains and gene silenced strains are subjected to low temperature treatment, and the phenotypes and related physiological indicators of the overexpression strains and gene silenced strains obtained after treatment are measured to verify their anti-function. The method for measuring active oxygen is preferably to use DAB and NBT histochemical staining to detect hydrogen peroxide (H2O2) and superoxide anions (O2 - ) accumulation was analyzed (according to the depth and degree of staining), observed with the naked eye and photographed. Conductivity measurement, fresh weight, malondialdehyde (MDA), proline (Pro), H2O2 and anti-superoxide anion (Anti-O2 - ) are not particularly limited and may be extracted and determined by methods well known in the art.

[0042] In the present invention, the low temperature stress condition of the plant is preferably not less than 0°C.

[0043] In the present invention, a pCAMBIA1300-35S-EGFP vector is constructed by a homologous recombination method. First, the pCAMBIA1300 vector is linearized by using restriction endonucleases BamHI and SalI. Subsequently, the EGFP gene is amplified by PCR using primers containing BamHI and SalI restriction sites, and an amplified product is obtained. The product is connected with the linearized pCAMBIA1300 vector by using a homologous recombinase. The connected product is transformed into competent Escherichia coli DH5α, and positive clones are obtained by kanamycin screening. Finally, the positive clones are verified by sequencing analysis, and it is confirmed that the construction is successful and the recombinant vector is obtained.

[0044] The following is a description of the Pyrus betulinum provided by the present invention in conjunction with the embodiments. PbbZIP44 The invention and its application in improving the cold resistance of plants are described in detail, but they should not be understood as limiting the scope of protection of the invention. Example 1

[0045] like Figure 1 As shown, low temperature response genes PbbZIP44 The specific process of application in enhancing plant cold resistance is as follows: (1) Pyrus betula PbbZIP44 Gene cloning and vector construction A bZIP transcription factor was previously screened from Pyrus betula using the yeast two-hybrid screening system. PbbZIP44 , and primers (SEQ ID NO.3 and SEQ ID NO.4) were designed based on its gene sequence, and its full-length sequence was amplified from Pyrus betula using the PCR method. After amplification, a single-band PCR product was obtained. After detection by 1% agarose gel electrophoresis, the target band was extracted and recovered using a gel recovery kit (Vazyme, Nanjing, China) according to the instructions. The recovered target gene was reacted with the intermediate vector Peasy at 37°C for 30 minutes, and then a single clone was picked out by plating and cultured with shaking. The positive clone was selected for sequencing. After confirming that the sequence was correct, it was the recombinant vector PbbZIP44-Peasy, and the plasmid was extracted using a plasmid extraction kit (Vazyme, Nanjing, China). After adding XbaI and BamHI restriction sites at both ends of the PbbZIP44 gene, it was cloned and ligated to the linearized pCAMBIA1300-35S:GFP expression vector (preserved in the Horticulture and Plant Protection Laboratory of Yangzhou University). The correctly sequenced PbbZIP44-Peasy plasmid was used as a template, and PCR amplification was performed using expression vector primers containing restriction sites (SEQ ID NO.10 and SEQ ID NO.11). The amplification program was: pre-denaturation at 94°C for 3 minutes; denaturation at 94°C for 30 seconds, annealing at 58°C for 60 seconds, extension at 72°C for 90 seconds, and 35 cycles; finally, extension at 72°C for 10 minutes. In order to achieve the fusion of the gene with GFP, the stop codon TAG was removed from the 3′ end of the gene. After the PCR product was separated by 1% agarose gel electrophoresis, the target band was recovered using a gel recovery kit. The pCAMBIA1300-35S:GFP vector plasmid was digested with XbaI and BamHI restriction endonucleases, and purified and recovered after reacting at 37°C for 4 hours. Subsequently, the digested pCAMBIA1300-35S:GFP vector was mixed with the recovered PbbZIP44 The fragments were connected by recombinant ligase at 37°C for 30 minutes and then transformed into E. coli competent DH5α. Positive clones were identified by PCR and sent to the company for sequencing. The positive clone plasmid with correct sequencing was the recombinant vector PbbZIP44-GFP. Finally, the constructed PbbZIP44-GFP recombinant vector was transformed into the Agrobacterium competent strain GV3101 purchased from Weidi Company for standby use. The double enzyme digestion system of pCAMBIA1300-35S vector is shown in Table 5, and the recombination reaction system is shown in Table 6.

[0046] Table 5 Double enzyme digestion system

[0047] Table 6 Recombination system

[0048] Bioinformatics analysis showed that PbbZIP44 The cDNA sequence of the gene is 471 bp in length, the coding region contains 157 amino acids, the predicted protein molecular weight is 17.67 KDa, and the isoelectric point is 7.98.

[0049] (2) Under low temperature conditions PbbZIP44 qRT-PCR analysis of genes In order to study the PbbZIP44 The response pattern of the gene to low temperature was analyzed by qRT-PCR. Healthy pear seedlings with no significant difference in growth conditions were selected and placed at 4°C. Samples were taken at 0h, 3h, 6h, 9h, 12h and 24h after recovery. Total RNA was extracted using the Novozyme kit and RNA was converted into cDNA using the Novozyme reverse transcription kit. The experimental system and procedures were operated according to the instructions. Subsequently, qRT-PCR was used to analyze the expression pattern of the gene. PbbZIP44The expression of genes was analyzed. The specific system and procedure of qRT-PCR are shown in Tables 3 and 4. Figure 2 As shown in A, it reflects PbbZIP44 Gene expression patterns under low temperature conditions.

[0050] Figure 2 A shows PbbZIP44 Expression of genes under low temperature stress. Samples were taken from Pyrus betulaeformis seedlings (non-transgenic) at different time points after low temperature treatment and analyzed by real-time quantitative PCR. PbbZIP44 The relative expression of genes. Figure 2 As can be seen from A, with the extension of treatment time, the expression level of this gene showed a gradual upward trend in the first 12 hours. This indicates PbbZIP44 The gene is induced by low temperature stress and is a gene with potential low temperature response function. (3) Subcellular localization of the gene encoding PbbZIP44

[0051] Agrobacterium-mediated transient transformation of tobacco: Pick Agrobacterium PbbZIP44-GFP, green fluorescent protein GFP and auxiliary plasmid P19 monoclones respectively and activate them in LB medium, and culture them overnight at 28°C and 220rpm. Take 10μL of overnight culture and transfer it to 5mL LB-MES medium, add 2μL 100mM acetosyringone, and culture it overnight at 28°C and 220rpm for 16h. Collect the bacterial solution, resuspend the target gene bacterial solution (PbbZIP44-GFP and GFP) and P19 with 10mM MgCl2, and mix the target gene bacterial solution and P19 bacterial solution in equal volumes when the OD600 values ​​are 1 and 0.7 respectively. Add acetosyringone to the mixed bacterial solution at a ratio of 1:500 and place it at room temperature away from light for 3h. Select leaves with good growth status and flat leaf surface for injection, keep them away from light for 12h after injection, grow them under normal transformation environment, observe and verify the results after 2-3 days, and ensure water supply during this period.

[0052] Results Figure 2 B. Figure 2 B is the subcellular localization of the PbbZIP44-GFP encoding gene and the control GFP, which includes the imaging of the control GFP gene and the PbbZIP44-GFP encoding gene in the GFP field, DAPI field, bright field, and mixed field. According to the subcellular localization, it can be seen that the PbbZIP44 gene is located in the cell nucleus. (4) Identification of Arabidopsis overexpression lines

[0053] ① Steps of Agrobacterium-mediated genetic transformation of Arabidopsis Agrobacterium culture: The cryopreserved Agrobacterium tumefaciens strain was streaked on an LB medium plate containing 50 mg / L kanamycin and 50 mg / L rifampicin, and cultured in a 28°C incubator for 36-48 hours until bacterial plaques appeared. Then the bacterial plaques were scraped and added to liquid MS medium (2.37 g / L MS+50 g / L sucrose+0.1 mg / L IBA, pH=5.8), and cultured at 28°C with shaking for 30 minutes until the bacterial liquid OD600 reached 0.8-1.0. Add 200 μl / L of surfactant sweet77 for impregnation.

[0054] Dip infection: Select wild-type Arabidopsis plants of about 30 days old, with primary inflorescences pod-forming, secondary inflorescences 2-10 cm long and a small number of flowers, and healthy growth. Cut off the blooming inflorescences before dipping, turn the plants upside down and dip them into the prepared Agrobacterium solution, evacuate to 0.05 MPa and maintain for 5 minutes, and then place them away from light for 24 hours.

[0055] Cultivation: Cultivate the plants until they are fruitful according to conventional methods, and harvest mature T0 generation seeds.

[0056] ② Screening of transgenic positive seedlings After surface disinfection, the harvested T0 generation seeds were evenly sown on MS selective medium containing 50 mg / L hygromycin and 50 mg / L timentin. The medium was cultured at 22°C and 16 hours of light. After about a week, plants with fast growth and long roots were selected and transplanted into sterilized nutrient soil for further cultivation.

[0057] ③Identification of transgenic Arabidopsis a. DNA extraction from transgenic Arabidopsis Use DNA extraction kit from PbbZIP44 DNA was extracted from Arabidopsis thaliana containing the gene, and the operation was carried out according to the instructions. Specific primers were designed and positive plants were identified by PCR amplification.

[0058] b. Detection of positive transgenic plants PCR amplification was performed using gene-specific primers, and the reaction conditions and systems are detailed in Tables 1 and 2. Gene upstream primers and vector downstream primers (SEQ ID NO.10 and SEQ ID NO.11) were used for PCR detection, and samples that amplified the expected fragments were positive transgenic lines.

[0059] c. Detection of overexpression plants qRT-PCR amplification was performed using gene upstream primers and vector downstream primers (SEQ ID NO.6 and SEQ ID NO.7), and the reaction conditions and systems are detailed in Tables 3 and 4. Fluorescence quantitative PCR was used to detect the difference in expression levels between the transgenic strains and the wild type to determine whether they were overexpressing transgenic strains.

[0060] like Figure 3 As shown, DNA testing identified 6 T0 transgenic positive lines (see Figure 3 A), and then these positive strains were tested by qRT-PCR, and finally three overexpression strains with higher expression levels were selected (see Figure 3 B) Continue culturing until stable expression is obtained in the T3 generation PbbZIP44 The transgenic Arabidopsis thaliana was used for subsequent cold resistance experimental analysis. (5) Identification of overexpression strains of Pear callus

[0061] ① Steps of Agrobacterium-mediated genetic transformation of eggplant and pear callus Agrobacterium culture: The cryopreserved Agrobacterium tumefaciens strain was streaked onto a LB medium plate containing 50 mg / L kanamycin and 50 mg / L rifampicin, and cultured in a 28°C incubator for 36-48 hours until bacterial plaques appeared. Then the bacterial plaques were scraped and added to liquid MS medium (2.37 g / L MS+50 g / L sucrose+0.1 mg / L IBA, pH=5.8), and cultured at 28°C with shaking for 30 minutes until the bacterial liquid OD600 reached 0.8-1.0. Add 500 μl / L of the surfactant acetosyringone for impregnation.

[0062] Infection: Select 15-day-old wild-type callus of eggplant and pear, immerse the callus upside down in the prepared Agrobacterium solution, shake evenly at 100 rpm for 15 minutes, absorb the liquid of the callus tissue, and spread it flat on the symbiotic culture medium.

[0063] Screening of transgenic positive calli: After two days of dark culture in the symbiotic medium, the calli are transferred to the screening medium for culture. After about 30 days, the fast-growing calli are selected and transferred to the screening plate for further culture.

[0064] ② Identification of transgenic callus a. DNA extraction from transgenic callus Use DNA extraction kit from PbbZIP44 DNA was extracted from the callus of pear with the gene, and the operation was carried out according to the instructions. Specific primers were designed and positive plants were identified by PCR amplification.

[0065] b. Detection of positive transgenic plants PCR amplification was performed using gene-specific primers, and the reaction conditions and systems are detailed in Tables 1 and 2. PCR detection was performed using gene upstream primers and vector downstream primers (SEQ ID NO.3 and SEQ ID NO.5), and samples that amplified the expected fragments were positive transgenic lines.

[0066] c. Detection of overexpression plants qRT-PCR amplification was performed using gene upstream primers and vector downstream primers (SEQ ID NO.6 and SEQ ID NO.7), and the reaction conditions and systems are detailed in Tables 3 and 4. Fluorescence quantitative PCR was used to detect the difference in expression levels between the transgenic strains and the wild type to determine whether they were overexpressing transgenic strains.

[0067] like Figure 6 As shown, DNA testing identified 6 T0 transgenic positive lines (see Figure 6 A), and then these positive strains were tested by qRT-PCR, and finally three overexpression strains with higher expression levels were selected (see Figure 6 B) and used for subsequent cold resistance experimental analysis. (6) Transient transformation of Pyrus betulaeformis seedlings

[0068] ① Construction of virus-induced gene silencing vector The viral silencing vector was constructed according to the method of step (1). The double restriction sites of the viral silencing vector pTRV2 are XbaI and SacI. The upstream and downstream primers (such as aaggttaccgaattctctaga AGGGGATCTGCATCGTCC as shown in SEQ ID NO.12 and ggcctcgagacgcgtgagctc TGATGTTTATGCTGGTCA as shown in SEQ ID NO.13) were designed according to the primer design principles. PbbZIP44 The gene was amplified and inserted between the two restriction sites on the vector to obtain the recombinant vector pTRV2-PbbZIP44, which was then transformed into Agrobacterium GV3101 competent cells.

[0069] ② Virus-induced gene silencing in Pyrus betulaeformis seedlings a. Agrobacterium culture: Take the Agrobacterium tumefaciens culture liquid stored in the ultra-low temperature refrigerator, and culture it in LB liquid medium supplemented with 50 mg / L kanamycin and 50 mg / L rifampicin at 28°C and 220 rpm for 12 hours. Centrifuge the cultured culture liquid at 6000g for 10 minutes to collect the bacteria, and resuspend the precipitate with infection solution (10mM MgCl2, 10mM MES, 200mM acetosyringone, pH 5.6) to a concentration of OD600 = 0.8-1.0; b. Bacterial solution induction: Place the bacterial solution with adjusted OD value in dark conditions and induce at room temperature at 100 rpm for 4 hours; c. Injection of pear seedlings: pTRV1 and pTRV2 bacterial solutions were mixed in a 1:1 ratio as the control group, and pTRV1 and pTRV2-PbbZIP44 bacterial solutions were mixed in a 1:1 ratio as the experimental group. The two groups were injected into Pyrus betulaeformis seedlings that were 45 days old, had consistent growth conditions and were in good health.

[0070] ③VIGS material identification After the injection, the pear seedlings were placed in the dark at room temperature for 12 h, and then returned to normal culture for 3 days. Each strain was independently sampled, and RNA from the pear seedling samples of the control group and the experimental group was extracted and reverse transcribed to obtain cDNA. Tublin Amplified as an internal control. Tublin The primer nucleotide sequences are: Tublin forward primer: 5'-TGGGCTTTGCTCCTCTTAC-3' (SEQ ID NO.8) Tublin reverse primer: 5'-CCTTCGTGCTCATCTTACC -3' (SEQ ID NO.9) use Tublin The brightness of the amplified bands is consistent, indicating that the concentration of reverse transcribed cDNA is the same. PbbZIP44 qRT-PCR detection was performed using specific primers and pear internal reference primer Tublin to analyze the expression level of the strains to be tested. PbbZIP44 The nucleotide sequences of the specific primers are: Forward primer: 5'-TGTCGAGTCGGAAAACTCGG -3' (SEQ ID NO.6) Reverse primer: 5'-AGTGGCCATGATTGGTTGGT-3' (SEQ ID NO. 7).

[0071] according to PbbZIP44 The expression level of the gene was measured, and three plants with lower expression levels were selected as virus silencing positive strains and named PbbZIP44-VIGS.

[0072] The results of low temperature treatment of gene silenced plants are as follows Figure 8 shown. Figure 8 B is to use gene-specific primers and internal reference primer Tublin to perform qRT-PCR to detect the gene expression level of gene silencing positive plants. PbbZIP44 The gene is effectively silenced.

[0073] (7) PbbZIP44Identification of cold resistance of overexpressing Arabidopsis lines To verify PbbZIP44 The biological function of the gene is similar to that of healthy PbbZIP44 Overexpressed Arabidopsis thaliana was subjected to low temperature treatment. The plants were placed at 0°C for 7 days and then returned to room temperature for 5 days. The test results are as follows Figure 4 As shown, after low temperature treatment, transgenic Arabidopsis showed stronger growth than the wild type (see Figure 4 A), and has a higher photosynthesis rate (see Figure 4 B). Further testing of cold resistance indicators showed that the content of malondialdehyde and electrical conductivity in transgenic Arabidopsis plants was lower than that in wild type (see Figure 4 C and D), indicating that the cell membrane damage was low. In addition, the results of photosynthetic rate measurement showed that the photosynthetic efficiency of plants was almost completely lost after low temperature treatment (see Figure 4 E). At the same time, the reactive oxygen content and cell death rate of Arabidopsis plants after low temperature treatment were detected. DAB and NBT staining results showed that the accumulation of hydrogen peroxide and superoxide anions in transgenic plants was less, and the staining degree was lighter than that of wild type, indicating that PbbZIP44 overexpression significantly reduced the level of reactive oxygen (see Figure 5 Quantitative detection showed that the content of hydrogen peroxide in transgenic plants was reduced, while the content of anti-superoxide anion was increased compared with the wild type (see Figure 5 Trypan blue staining results showed that the staining in transgenic Arabidopsis was lighter, indicating a lower cell death rate (see Figure 5 The above results show that PbbZIP44 Enhancing cold tolerance in Arabidopsis thaliana by reducing the accumulation of reactive oxygen species and decreasing membrane damage.

[0074] (8) PbbZIP44 Identification of cold resistance of overexpression callus of pear Further validation in callus of Pyrus oleraceus PbbZIP44 The transgenic callus and wild-type callus that had been subcultured for 15 days were treated with low temperature. Under normal circumstances, there was no significant difference in growth status and physiological indicators between transgenic callus and wild-type callus (see Figure 7 After 14 days of low temperature treatment at 4°C, the growth state and growth volume of transgenic callus were significantly higher than those of wild type, and the malondialdehyde and hydrogen peroxide contents were lower than those of wild type, while the proline and anti-superoxide anion contents were higher than those of wild type (see Figure 7 B to F). These results show that PbbZIP44 Overexpression of the gene improved the cold resistance of Pyrus oleifera callus.

[0075] (9) PbbZIP44 Identification of cold resistance of gene-silenced Pyrus betulata In Pyrus betulaeformis seedlings PbbZIP44 Gene silencing experiment. The results after low temperature treatment showed that, contrary to the performance of transgenic plants, PbbZIP44 The silenced plants showed higher electrical conductivity, hydrogen peroxide, and malondialdehyde contents, and decreased levels of superoxide anion resistance, indicating PbbZIP44 Silencing reduces the plant's cold resistance.

[0076] therefore, PbbZIP44 The results of overexpression and gene silencing experiments confirmed that this gene plays a positive regulatory role in improving plant cold resistance.

[0077] The above description is only a specific implementation of the present invention, but the protection scope of the present invention is not limited thereto. Any person familiar with the technology can understand and think of any changes or substitutions within the technical scope disclosed by the present invention, which should be included in the scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. A pear stress-related gene PbbZIP44 , characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

1.

2. The pear stress-related gene according to claim 1 PbbZIP44 The encoded protein is characterized in that The amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. The pear stress-related gene according to claim 1 PbbZIP44 The amplification method is characterized in that PCR amplification was performed using cDNA from leaves of Pyrus betulaeformis as a template. The conditions for PCR amplification were as follows: pre-denaturation at 94°C for 3 minutes; denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 90 seconds for 35 cycles, followed by extension at 72°C for 10 minutes.

4. Used to amplify the pear stress-related gene described in claim 1 PbbZIP44 A primer pair, characterized in that It comprises a forward primer F and a reverse primer R, wherein the nucleotide sequence of the forward primer F is shown in SEQ ID NO.3, and the nucleotide sequence of the reverse primer R is shown in SEQ ID NO.

4.

5. Comprising the pear stress-related gene according to claim 1 PbbZIP44 The recombinant expression vector is characterized in that The basic vector is pCAMBIA1300 vector.

6. Containing the pear stress-related gene according to claim 1 PbbZIP44 The host bacteria is characterized in that The host bacteria is Agrobacterium tumefaciens.

7. The pear stress-related gene according to claim 1 PbbZIP44 Application in enhancing plant cold resistance.

8. The use according to claim 7, characterized in that: Build PbbZIP44 Gene overexpression vectors were used to transform the PbbZIP44 The bZIP transcription factor in Pyrus betula was introduced into the plant PbbZIP44 Overexpression in plants can produce transgenic plants with significant cold resistance.

9. The use according to claim 8, characterized in that: The plants are Arabidopsis seedlings, Pyrus communis callus and Pyrus betulaeformis seedlings.

Images