New application of TCP transcription factor in tobacco

Abstract

The invention belongs to the technical field of agricultural biology, and discloses a tobacco TCP transcription factor and application of a gene silencing expression vector of the tobacco TCP transcription factor. The serial numbers of the tobacco TCP transcription factor genes NbTCP4-1, NbTCP4-2 and NbTCP4-3 are respectively Niben101Scf03278g04009.1, Niben101Scf05396g03003.1 and Niben101Scf03932g05003.1, and the tobacco TCP transcription factor genes NbTCP4-1, NbTCP4-2 and NbTCP4-3 can be used for regulating and controlling the outer roll of the edge of a tobacco leaf. According to the transgenic material which is silent by the three genes NbTCP4-1, NbTCP4-2 and NbTCP4-3 at the same time and is obtained through a gene silencing means, the edges of young leaves and mature leaves of the transgenic material are obviously curled downwards (curled outwards), the phenotype is stable, and the transgenic material does not change along with increase of the leaf age.

Description

Technical Field

[0001] The invention belongs to the field of agricultural biotechnology and relates to a new application of a TCP transcription factor in tobacco. Background Art

[0002] The TCP gene family is a plant-specific transcription factor family that is mainly expressed in fast-growing tissues or organs and is closely related to the differentiation and development of plant cells. The TCP family is divided into two subfamilies, Class I and Class II. Class I TCP is involved in the development of plants at different growth stages, such as seed dormancy, hypocotyl development, flower development, and gametophyte development. The Class II TCP transcription factor subfamily is divided into two subclasses: CIN TCP and CYC / TB1 TCP (Liu et al., 2022). The TB1 branch mainly regulates lateral branch formation and flower development. CIN TCP plays an important role in leaf development, especially in the window period of leaf cell proliferation and differentiation and leaf maturity. There are 8 CIN members in Arabidopsis, of which 5 (TCP2, TCP3, TCP4, TCP10, and TCP24) and their homologous genes in different species are regulated by the conserved miR319. High levels of miR319 simultaneously reduce the expression of the five TCPs it targets, causing Arabidopsis leaves to become wrinkled and clumped, the entire leaf surface to be uneven, the leaf edges to be serrated, and the morphology to be significantly changed compared to the wild type (Palatnik et al., 2003; Koyama et al., 2007; Efroni et al., 2008). NbTCP4 involved in the present invention is a direct homologous gene of the CIN gene that plays an important role in Arabidopsis. In Arabidopsis, TCP4 can activate the YUCCA gene, which is essential for the auxin synthesis pathway, thereby increasing the auxin response in the early stages of development. In addition, TCP4 can interact with the leaf cup genes CUC2 and CUC3 to inhibit the formation of CUC-dependent serrations in young leaves (Rubio-Somoza et al., 2014).

[0003] Tobacco is an important economic crop, and leaf shape is one of the most important agronomic traits. Flat leaves can effectively capture light energy and improve the quality of tobacco leaves. Curling of tobacco leaf edges is usually due to environmental stress. In addition, due to the uniqueness of cigar production, wrapper tobacco leaves as outer wrapper materials require higher levels of leaf surface trait parameters, requiring flat leaf surfaces and smooth leaf edges. At present, there are few studies on leaf flatness in tobacco, and the effect of TCP transcription factors on tobacco leaf development has not been reported. Most of the other species use the method of constructing a knockout mutant of stable transformation to study the function of TCP genes. The present invention uses gene silencing transient transformation technology to study the effect of tobacco TCP genes on leaf flatness in Nicotiana benthamiana, which can efficiently and in less time verify the function of TCP genes, which helps to provide a certain theoretical basis for future tobacco molecular breeding. Summary of the invention

[0004] The purpose of the present invention is to provide a new application of TCP transcription factor in tobacco in view of the above-mentioned deficiencies in the prior art.

[0005] The purpose of the present invention can be achieved through the following technical solutions:

[0006] The application of tobacco TCP transcription factors NbTCP4-1, NbTCP4-2 and NbTCP4-3 in regulating tobacco leaf morphology, the nucleotide sequence of tobacco TCP transcription factor NbTCP4-1 is shown in SEQ ID NO.1, the nucleotide sequence of tobacco TCP transcription factor NbTCP4-2 is shown in SEQ ID NO.2, and the nucleotide sequence of tobacco TCP transcription factor NbTCP4-3 is shown in SEQID NO.3.

[0007] As a preferred embodiment of the present invention, the three tobacco TCP transcription factors are used in improving the flatness of tobacco leaves.

[0008] As a preferred embodiment of the present invention, by silencing the three tobacco TCP transcription factors NbTCP4-1, NbTCP4-2, and NbTCP4-3 at the same time, the leaves of transgenic tobacco can show only obvious downward curling (outward curling) at the edges, while there is no obvious phenotype inside the leaves; this is different from the phenotype of the five Arabidopsis TCP mutants (TCP2 / 3 / 4 / 10 / 24) in the literature (the entire leaf surface is uneven and the leaf edges are serrated).

[0009] The expression vector for silencing the three NbTCP4 genes at the same time uses pTRV2 as the starting vector, and inserts the common sequence (target sequence) of NbTCP4-1, NbTCP4-2, and NbTCP4-3 between the restriction endonuclease sites EcoRI and BamHI, and the target sequence is shown in SEQ ID NO.4 (GGAGGGAAAGATAG GCACAGCAAAGTGTGGACTTCAAAAGGACTTCGAGATCGGAGAGTTAGGCTGTCTGTTAACACAGCTATACAGTTCTACGATTTGCAAGATCGACTTGGTTATGATCAACCAAGCAAAGCTGTTGAATGGTTGTTAAAAGCAGCAGCTCCTTCAATCTCGGAGCTTCCTTCTCTCAATGCTTTTCAAGACACACAACAGATCAGTGAGGATAAAAGGTCTAGTGCT).

[0010] The gene silencing expression vector of the present invention is used in constructing tobacco with leaf edges curled downward (outward).

[0011] Beneficial effects:

[0012] The present invention identified a target sequence that can simultaneously target three TCP4 transcription factors from Nicotiana benthamiana (tobacco), and constructed a plant in which three NbTCP4 genes were simultaneously silenced using VIGS technology. Only the edges of its leaves showed obvious downward curling (outward curling), which can be used to improve the flatness of tobacco leaves. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 pTRV2 vector map and restriction sites

[0014] Figure 2 qPCR analysis was used to analyze the expression levels of NbTCP4-1, NbTCP4-2, and NbTCP4-3 in the leaves of the control and treatment groups; compared with the control group (WT, pTRV2:PDS, pTRV2:GFP), the expression levels of the three NbTCP genes in the treatment group (pTRV2:NbTCP4-1 / 2 / 3) were significantly decreased.

[0015] Figure 3 Morphological changes of leaves after the three NbTCP4 genes were effectively silenced; compared with the control groups (WT, pTRV2:PDS, pTRV2:GFP), the leaf edges of the treated groups (pTRV2:NbTCP4-1 / 2 / 3) were obviously curled downward (outward). DETAILED DESCRIPTION

[0016] Example 1 Plant planting and cultivation

[0017] The study used Nicotiana benthamiana as the research object and planted it in the artificial climate chamber of the Genetic Breeding Center of the Tobacco Research Institute of the Chinese Academy of Agricultural Sciences. In the greenhouse (16h:8h, light:dark, 25℃), sufficient water and fertilizer were applied and the seedlings were cultivated to the four-leaf one-heart stage for VIGS experiment.

[0018] Example 2 Sequence information of the three genes NbTCP4-1, NbTCP4-2, and NbTCP4-3 and design information using the common sequence of the three as the target sequence.

[0019] The coding sequences of NbTCP4-1, NbTCP4-2 and NbTCP4-3 of the present invention are 1221 bp, 1374 bp and 1278 bp respectively. The commonalities of the three coding sequences and the specificities with other TCP gene coding sequences of Nicotiana benthamiana were analyzed, and a 240 bp sequence was selected as the target sequence capable of silencing the three genes simultaneously.

[0020] Example 3 Construction of tobacco NbTCP4-1 / 2 / 3 three-gene simultaneous silencing vector

[0021] Take the leaves of Nicotiana benthamiana in a 2ml centrifuge tube, freeze them quickly with liquid nitrogen, and sample and extract total RNA according to the steps of Nobel ultra-fast RNA extraction kit. According to the instructions of Acori reverse transcription reagent, 1ug ​​of RNA was reverse transcribed into 20ul system cDNA and stored in a -20℃ refrigerator. A pair of gene amplification primers (Table 1) were designed according to the target sequence and restriction site on the software Primer5, and amplification was performed with cDNA as a template. The PCR reaction program was: 95℃ pre-denaturation for 5 minutes; 95℃ denaturation for 15 seconds, 55℃ renaturation for 30 seconds, 72℃ extension for 1 minute, and 72℃ for 10 minutes after 25 cycles. After the amplification reaction, agarose gel electrophoresis was performed, and the target band was cut and recovered and sequenced to obtain a sequence with homology arms that can simultaneously target the three genes NbTCP4-1, NbTCP4-2, and NbTCP4-3 (SEQ ID NO.4), which was used for subsequent vector construction. Tobacco rattle virus (TOBAC) is a widely used viral vector with good efficiency and durability. It can mediate gene silencing without causing virus-induced symptoms. Virus-induced gene silencing (VIGS) experiments were conducted in Nicotiana benthamiana using pTRV1 and pTRV2 vectors. pTRV1 is an auxiliary viral vector of the VIGS system, which assists the expression of the pTRV2 vector. 1ug pTRV2 vector plasmid was digested, and 1ul of restriction enzymes EcoRI and BamHI, 5ul buffer and sterile water were added to 50ul. Incubate at 37℃ in a PCR instrument for 90min, heat inactivate at 65℃ for 20min, and finally recover the linearized plasmid by gel. The linearized plasmid and the target sequence with homology arms were constructed into pTRV2:NbTCP4-1 / 2 / 3 vector by single-fragment seamless homologous recombination. 10ul of the recombinant product was transformed into 100ul of Escherichia coli competent DH5α, 700ul of LB liquid medium without resistance was added to the tube, and it was placed in a 37°C shaker for incubation for 2h and then centrifuged at 5000rpm for 5min. 50ul of the supernatant was retained, and evenly coated on the LB solid medium containing kanamycin antibiotics after resuspending. After the liquid was dried, it was placed in a 37°C incubator for inversion culture for 16h. Pick a monoclonal colony and streak it, and use the gene-specific primers shown in Table 1 for colony PCR amplification and sequencing. The sequencing sequence is correct, which means that the vector is successfully constructed. Pick the Escherichia coli with correct sequencing, add it to the LB liquid medium containing kanamycin antibiotics, and extract the recombinant plasmid after incubation at 37°C for 24h, and transform it into Agrobacterium competent GV3101, and finally obtain Agrobacterium containing pTRV2:NbTCP4-1 / 2 / 3.

[0022] Table 1 Primers used for amplification

[0023]

[0024] Example 4 Functional Identification of NbTCP4-1, NbTCP4-2, and NbTCP4-3 Genes

[0025] To clarify the role of NbTCP4-1, NbTCP4-2, and NbTCP4-3 in regulating tobacco leaf shape, we used virus-induced gene silencing (VIGS) experiments to analyze the functions of the three. Take out the TRV1 and pTRV2:PDS, pTRV2:GFP, and pTRV2:NbTCP4-1 / 2 / 3 Agrobacterium stored in the -80℃ refrigerator, and pipette 400ul of bacterial solution into 20ml LB culture medium containing kanamycin and rifampicin antibiotics, respectively, and culture at 28℃ and 220rpm for 24 hours. 600 The pH was about 1.0, and the cells were collected by centrifugation at 5000rpm for 5min. The supernatant LB was discarded, and 10mL of equal volume of resuspension solution was added to each tube to resuspend the cells at the bottom of the tube. 100ml of resuspension solution contains 400ul 50mmol / L acetosyringone, 1ml 1mol / L magnesium chloride and 0.213g 2-(N-morpholine)ethanesulfonic acid. The Agrobacterium resuspension containing pTRV1 and pTRV2 vectors was mixed in a 1:1 ratio and allowed to stand in the dark at room temperature for 2h. The back of the two largest leaves of 45-day-old Nicotiana benthamiana was selected for injection. pTRV2:PDS is a positive control to indicate the efficiency and time of viral silencing; pTRV2:GFP is a negative control, indicating the phenotype caused only by viral infection, which is used to distinguish the phenotype caused by the target gene, and the addition of GFP green fluorescent protein tag can prevent plant death due to excessive viral toxicity. When tobacco plants were injected with pTRV2:PDS and showed an albino phenotype two weeks later, qPCR was used to detect the silencing efficiency of NbTCP4-1, NbTCP4-2, and NbTCP4-3 in the control and treatment groups. The primers are shown in Table 2. The results showed that the expression levels of the three NbTCP4 genes in the treatment group (pTRV2:NbTCP4-1 / 2 / 3) were significantly reduced (see Table 2). Figure 2 As shown in the figure, the expression levels of the three genes in the control group plants (WT, pTRV2:PDS, pTRV2:GFP) did not change significantly. At the same time, the new leaves of the treated group plants showed a significant downward curling (outward curling) phenotype, and the phenotype in mature leaves remained stable, with significant phenotypic differences compared with the control group plants. Therefore, we believe that the three TCP transcription factor genes NbTCP4-1, NbTCP4-2, and NbTCP4-3 found in the present invention have the function of regulating the outward curling of leaf edges in tobacco leaf development.

[0026] Table 2 qPCR specific primers for NbTCP4 gene

[0027]

Claims

1. Application of tobacco TCP transcription factors NbTCP4-1, NbTCP4-2 and NbTCP4-3 in regulating tobacco leaf morphology, characterized in that: The nucleotide sequence of tobacco TCP transcription factor NbTCP4-1 is shown in SEQ ID NO.1, the nucleotide sequence of tobacco TCP transcription factor NbTCP4-2 is shown in SEQ ID NO.2, and the nucleotide sequence of tobacco TCP transcription factor NbTCP4-3 is shown in SEQ ID NO.

3.

2. The use according to claim 1, characterized in that: The tobacco TCP transcription factors NbTCP4-1, NbTCP4-2 and NbTCP4-3 are used in improving the flatness of tobacco leaves.

3. The use according to claim 1, characterized in that: Simultaneously silencing the tobacco TCP transcription factors NbTCP4-1, NbTCP4-2, and NbTCP4-3 described in claim 1 can cause the leaf edges of transgenic tobacco to curl downward significantly.

4. An expression vector for simultaneously silencing the three genes NbTCP4-1, NbTCP4-2, and NbTCP4-3, characterized in that pTRV2 is used as the starting vector, and the sequence shown in SEQ ID NO.4 that can simultaneously target NbTCP4-1, NbTCP4-2, and NbTCP4-3 is inserted between the restriction endonuclease sites EcoRI and BamHI.

5. Use of the three-gene simultaneous silencing expression vector according to claim 4 in constructing tobacco leaves with curled edges downward.

Images