Primer, probe, kit and method for quantitatively detecting human cytomegalovirus nucleic acid

Abstract

The invention belongs to the technical field of nucleic acid detection, and relates to a primer, a probe, a kit and a method for quantitatively detecting human cytomegalovirus nucleic acid. The primer and probe combination is as shown in SEQ ID No. 1-6. According to the kit for quantitatively detecting the human cytomegalovirus nucleic acid, the specific primer and the probe are designed by taking the HCMV and an exogenous internal standard conserved region as target regions, the kit for quantitatively detecting the human cytomegalovirus nucleic acid is high in sensitivity, strong in specificity and wide in linear range, the lowest detection limit of the kit can reach 100 IU / mL (namely 67 copies / mL), the linear range of the kit can reach 5.0 * 10 < 2 > IU / mL to 5.0 * 10 < 9 > IU / mL (namely 3.35 * 10 < 2 > copies / mL to 3.35 * 10 < 9 > copies / mL), and the kit can be used for detecting the human cytomegalovirus nucleic acid. The kit can be used for rapid diagnosis of the human cytomegalovirus and evaluation of the treatment effect of drugs, and provides a better diagnosis method for detection, curative effect and prognosis of clinical cytomegalovirus infection.

Description

Technical Field

[0001] The invention belongs to the technical field of nucleic acid detection, and specifically relates to a primer, a probe, a kit and a method for quantitatively detecting human cytomegalovirus nucleic acid. Background Art

[0002] Human cytomegalovirus (HCMV), also known as human herpesvirus type 5 (HHV-5), is a double-stranded DNA virus of the β genus of the herpes family. HCMV is widely infected in the population, with infection rates ranging from 40% to 90% in different regions, and the infection rate among Chinese adults is 80% to 97%. HCMV is a common pathogen of prenatal and perinatal infection, causing intrauterine infection in pregnant women and transmission of infection between mother and child, leading to serious consequences such as fetal miscarriage, malformation, stillbirth, premature birth, reduced IQ, hearing loss, and neonatal cytomegalovirus hepatitis. Adults are mostly latently infected. When the immune function is low, such as AIDS patients, radiation damage, organ transplantation or hematopoietic stem cell transplantation, multiple blood transfusions and malignant tumors, the latent virus in the body is easily activated, and active HCMV infection occurs, causing serious complications and even death. It is one of the main causes of organ transplant failure and death from complications of infection in AIDS patients. HCMV is mainly transmitted through contact and often lurks in the kidneys, salivary glands, mammary glands and other glands. Infected people can spread the virus long-term or intermittently through multiple channels such as the mouth, reproductive tract, placenta, blood transfusion or organ transplantation, etc., through saliva, milk, blood, urine, semen, uterine secretions and other media.

[0003] The main laboratory detection methods include virus isolation and culture, virus antigenemia detection, serological detection, virus nucleic acid detection, etc. Virus isolation and culture and serological detection are time-consuming, low in sensitivity, high in culture requirements and prone to false negatives. Viral antigenemia detection is only suitable for blood specimens, delayed specimen processing affects the test results, and is not suitable for patients in the early stage after bone marrow transplantation or who use antiviral drugs. HCMV nucleic acid detection can be used for various clinical specimens. The specimens require a small amount and can be stored. It has strong specificity, high sensitivity, is fast and simple, and can be automatically detected.

[0004] In view of this, the present invention proposes a primer, a probe, a kit and a method for quantitatively detecting human cytomegalovirus nucleic acid. Summary of the invention

[0005] The purpose of the present invention is to provide a primer, a probe, a kit and a method for quantitatively detecting human cytomegalovirus nucleic acid. The present invention adopts real-time fluorescence PCR technology, and designs specific primers and probes with the conserved region of HCMV as the target region to achieve quantitative detection of human cytomegalovirus nucleic acid. The present invention sets a specific exogenous internal standard to monitor the entire process of DNA extraction of the sample to be tested and the amplification efficiency of the PCR reaction, so as to avoid false negative results caused by the presence of inhibitors in the sample or operational errors. The kit of the present invention has high sensitivity, strong specificity and a wide linear range, and can be used for rapid diagnosis of human cytomegalovirus and evaluation of the therapeutic effect of drugs, providing a better diagnostic method for the detection, efficacy and prognosis of clinical cytomegalovirus infection.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a primer and probe combination for quantitatively detecting human cytomegalovirus nucleic acid, wherein the primer comprises the following sequence: The primer sequences for amplifying the conserved region of HCMV are shown in SEQ ID No. 1-2, and the specific sequences include: SEQ ID No.1: ATCAGCCATGTATGGATGCCA; SEQ ID No.2: GTTCTGACGAGACGTGAGGTAA; The primer sequences for amplifying the exogenous internal standard are shown in SEQ ID No.3-4, and the specific sequences include: SEQ ID No.3: TGTAGCTACGAGCCTAAGTTG; SEQ ID No.4: CTGAGTATTGTCATTGAGAACGG; The probe comprises the following sequence: The probe sequence for amplifying the conserved region of HCMV is shown in SEQ ID No.5, and the specific sequence includes: SEQ ID No.5: CAATGTTAACATCAGCTGCCGCG; The probe sequence for amplifying the exogenous internal standard is shown in SEQ ID No.6, and the specific sequence includes: SEQ ID No. 6: CAGCGCACATTCTGCGCCACG.

[0007] The primer and probe combination of the present invention is used for quantitative detection of HCMV and exogenous internal standard; wherein, the HCMV conserved region (target region) is the UL18 conserved region. The exogenous internal standard includes one or more of the shrimp Taura syndrome virus, the shrimp infectious myonecrosis virus, and the shrimp yellow head disease virus. In some embodiments, the exogenous internal standard is the shrimp Taura syndrome virus.

[0008] As an embodiment of the present invention, the 5' and 3' ends of the probe carry a fluorescent group and a quenching group respectively, wherein the fluorescent group is selected from any one or more of FAM, HEX, VIC, TET, TAMRA, ROX, CY3.5, and CY5; the quenching group is selected from any one or more of BHQ1, BHQ2, BHQ3, DABCYL, and MGB.

[0009] In a second aspect, the present invention provides a use of the primer and probe combination in preparing a kit for quantitatively detecting human cytomegalovirus nucleic acid.

[0010] In a third aspect, the present invention provides a kit for quantitatively detecting human cytomegalovirus nucleic acid, the kit comprising a human cytomegalovirus reaction solution, a nucleic acid amplification reaction solution, an internal standard control, a negative control, a positive control, a critical positive control, and human cytomegalovirus quantitative reference substances Q1-Q4; wherein the human cytomegalovirus reaction solution comprises the primer and probe combination; wherein the concentration of each primer is 0.1-0.5 μM / L, and the concentration of each probe is 0.05-0.3 μM / L.

[0011] As an embodiment of the present invention, the human cytomegalovirus reaction solution further includes 1:500-1:1200 (V / V) ROX Reference Dye, 10-50 mM Tris-HCl (pH 8.0), 0.01-0.5 mM EDTA, and RNase-free water.

[0012] As an embodiment of the present invention, the nucleic acid amplification reaction solution includes 10-50 mM Tris-HCl (pH 8.0), 50-500 mM KCl, 2-4 mM MgCl 2 , 0.05-0.5 mM dNTPs (dATP: dTTP: dGTP: dCTP: dUTP = 1:1:1:1:1), 1-2 U Taq DNA polymerase, 0.05-0.1 U UNG enzyme, RNase-free water. UNG enzyme anti-contamination measures were used to avoid false positive results that may be caused by product contamination.

[0013] As an embodiment of the present invention, the internal standard control is an (artificially constructed) internal standard recombinant plasmid.

[0014] As one embodiment of the present invention, the negative control is human negative serum.

[0015] As an embodiment of the present invention, the positive control and critical positive control are both (containing an appropriate amount of) human cytomegalovirus recombinant plasmid, wherein the positive control concentration (traced back to the international reference product) is 1×10 6 ~1×10 7 IU / mL, the critical positive control concentration (traceable to international reference materials) is 1×10 3 ~1×10 4 IU / mL.

[0016] As an embodiment of the present invention, the human cytomegalovirus quantitative reference substances Q1-Q4 are (fixed value) human cytomegalovirus recombinant plasmids, and their concentrations (traced back to international reference substances) are 2 to 8×10 8 IU / mL, 2~8×10 7 IU / mL, 2~8×10 6 IU / mL, 2~8×10 5 IU / mL.

[0017] In a fourth aspect, the present invention provides a method for quantitatively detecting human cytomegalovirus nucleic acid using the kit for non-diagnostic purposes, comprising the following steps: S1. Prepare PCR reaction solution: mix the nucleic acid amplification reaction solution and the human cytomegalovirus reaction solution, and dispense them into PCR reaction tubes; S2. Nucleic acid extraction: add internal standard control to the sample to be tested, negative control, positive control, critical positive control and human cytomegalovirus quantitative reference substances Q1-Q4, respectively, and perform nucleic acid extraction; S3, adding samples: adding the nucleic acids extracted in step S2 to the PCR reaction tubes in step S1; S4, fluorescent PCR amplification: placing the PCR reaction tube obtained in step S3 into a fluorescent quantitative PCR instrument to perform fluorescent PCR amplification; S5. Interpretation of results.

[0018] As an embodiment of the present invention, in step S1, the amount of the nucleic acid amplification reaction solution added is 25 μL / person, and the amount of the human cytomegalovirus reaction solution added is 5 μL / person. The mixture is dispensed into PCR reaction tubes at 30 μL / tube.

[0019] In step S2 of the present invention, the sample nucleic acid is extracted using the nucleic acid extraction or purification kit of Jiangsu Shuoshi Biotechnology Co., Ltd. (registration number: Sutai Equipment Preparation No. 20140001, Sutai Equipment Preparation No. 20150256), and 200 μL of the sample to be tested, the negative control, the positive control, the critical positive control and the quantitative reference are taken for nucleic acid extraction simultaneously. When extracting nucleic acid, 10 μL of internal standard control is added first, and the extracted nucleic acid solution is stored for standby. Sample nucleic acid extraction also includes the use of Qiagen's QIAamp® DNA Mini Kit (Cat. No.: 51304) and Roche's High Pure Viral Nucleic Acid Kit Extraction Kit (Cat. No.: 11858874001), and the operation method is carried out according to the product instructions.

[0020] As an embodiment of the present invention, in step S3, the amount of nucleic acid added to each PCR reaction tube is 20 μL, and the final volume is 50 μL / tube. After adding the sample, the tube cap is tightly closed and centrifuged instantly.

[0021] In step S4 of the present invention, the PCR reaction tube is placed in a fluorescent quantitative PCR instrument, and a negative control, a positive control, a critical positive control, quantitative reference substances Q1 to Q4 and a sample to be tested are set in a corresponding order, and the sample name and the quantitative reference substance concentration are set.

[0022] As an embodiment of the present invention, in step S4, the fluorescence quantitative PCR instrument includes any one of ABI 7500 fluorescence quantitative PCR instrument, Roche LightCycler® 480 II fluorescence quantitative PCR instrument, and Shanghai Hongshi SLAN-96P / S fluorescence quantitative PCR instrument; wherein the reference fluorescence (Passive Reference) of the ABI 7500 fluorescence quantitative PCR instrument is set to ROX, and the quenching group is selected as None. The above-mentioned fluorescence quantitative PCR instrument automatically saves the results after the reaction is completed, and after automatically or manually setting the fluorescence baseline and threshold, the results of the sample are analyzed.

[0023] As an embodiment of the present invention, in step S4, fluorescent PCR amplification is performed according to the following program: 37°C for 5 min; 95°C for 10 min; 95°C for 10 s, 58°C for 40 s, for a total of 45 cycles.

[0024] As an embodiment of the present invention, in step S5, the result interpretation includes: Quality control: The FAM channel of the negative control had no obvious S-shaped amplification curve or Undet, and the Ct value of the VIC channel was ≤36.0; the FAM channel of the positive control and critical positive control was positive, showed an obvious S-shaped amplification curve, and the detection concentration was within the above-mentioned allowable range, and the Ct value of the VIC channel was ≤36.0; the detection results of human cytomegalovirus quantitative reference substances Q1~Q4 were all positive, showed an obvious S-shaped amplification curve, and the standard curve correlation coefficient |r|≥0.980, and the Ct value of the VIC channel was ≤36.0.

[0025] The negative control, positive control, critical positive control and human cytomegalovirus quantitative reference materials Q1~Q4 must meet the above quality control requirements at the same time before the sample test results can be interpreted.

[0026] Qualitative result interpretation: If the Ct value of the FAM channel detection result is greater than 42.0 or no value is found, and the internal standard control Ct value is ≤36.0, it means that the sample is HCMV DNA negative or the sample is below the minimum detection limit of the kit; if the Ct value of the FAM channel detection result is ≤42.0, it means that the sample is HCMV DNA positive.

[0027] Interpretation of quantitative results: The HCMV DNA detection value of the FAM channel is 5×10 2 ~5×10 9 IU / mL, and the internal standard Ct value of the VIC channel is ≤36.0, indicating the quantitative value of HCMV DNA in the tested sample, and the reported HCMV DNA = detection value IU / mL; the HCMV DNA detection value of the FAM channel is >5×10 9 IU / mL, and there is no requirement for the internal standard Ct value of the VIC channel, indicating that the quantitative value of HCMV DNA in the tested sample is greater than 5×10 9 IU / mL, report indicates >5×10 9 IU / mL, reported HCMV DNA>5×10 9 IU / mL. If precise quantification is required, the sample can be diluted to the linear range of the kit according to the result and re-measured. The result is corrected by the dilution multiple. The HCMV DNA detection value of the FAM channel is less than 5×10 2 IU / mL, and the internal standard Ct value of the VIC channel is ≤36.0, indicating that the concentration of HCMV DNA in the tested sample is lower than the quantitative linear range of the kit. The quantitative value is for reference only. The reported HCMV DNA is <5×10 2 IU / mL; the HCMV DNA detection value of the FAM channel is null, and the internal standard Ct value of the VIC channel is ≤36.0, indicating that there is no HCMV DNA in the tested sample or the concentration is lower than the minimum detection limit of the kit, and the HCMV DNA is reported as null or the Ct value is Undet.

[0028] Compared with the prior art, the present invention has the following beneficial effects: 1. The present invention adopts real-time fluorescence PCR technology, designs primers and probes with the conserved regions of HCMV and internal standard as target regions, and realizes quantitative detection of human cytomegalovirus nucleic acid through probes labeled with FAM and VIC, respectively. The minimum detection limit is 100 IU / mL (i.e., 67 copies / mL) and the linear range is 5.0×10 2 IU / mL~5.0×10 9 IU / mL (i.e. 3.35×10 2 copies / mL~3.35×10 9 copies / mL).

[0029] 2. The present invention sets an exogenous internal standard to effectively avoid human contamination caused by the endogenous internal standard and competitive inhibition of the target viral gene, and can effectively identify false negatives caused by PCR inhibition. UNG enzyme anti-contamination measures are adopted to avoid false positive results that may be caused by product contamination. ROX Reference Dye is used to reduce the difference between quantitative PCR tubes and increase the accuracy of HCMV load detection results.

[0030] 3. The present invention can be equipped with a fully automatic nucleic acid extractor, and it only takes 2 hours to detect 96 samples (starting from sample processing). In addition, the present invention uses the international unit IU / mL as the quantitative unit, which can be traced back to the HCMV international standard of the National Institute for Biological Products Control of the United Kingdom (NIBSC code: 09 / 162), and the conversion relationship between IU / mL and copies / mL is obtained, realizing the standardization and unification of HCMV quantification.

[0031] 4. The present invention has the advantages of high sensitivity, wide linear range, high accuracy, good specificity and repeatability, simple operation, short detection time, effective anti-pollution system and unique internal standard monitoring, and can be widely promoted for clinical use. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings: Figure 1 Schematic diagram of amplification curves of human cytomegalovirus negative control, positive control, and critical positive control in Example 4; Figure 2 Schematic diagram of the FAM channel amplification curve of human cytomegalovirus quantitative reference substances Q1 to Q4 in Example 4; Figure 3 This is a schematic diagram of the FAM channel standard curve of human cytomegalovirus quantitative reference substances Q1 to Q4 in Example 4; Figure 4 is the amplification curve diagram of the specific sample in Example 5; Figure 5 Schematic diagram of the FAM channel amplification curve in the linear range of quantitative detection in Example 7; Figure 6 Schematic diagram of the FAM channel standard curve for the linear range of quantitative detection in Example 7. DETAILED DESCRIPTION The present invention is described in detail below in conjunction with the accompanying drawings and specific embodiments. The following examples are implemented on the premise of the technical solution of the present invention, provide detailed implementation methods and specific operation processes, and will help those skilled in the art to further understand the present invention. It should be pointed out that the protection scope of the present invention is not limited to the following embodiments, and several adjustments and improvements made under the premise of the concept of the present invention all belong to the protection scope of the present invention.

[0033] Example 1 Design of specific primers and probes The target gene and exogenous internal standard of HCMV were downloaded by searching NCBI, and the target genome was compared by using BioEdit version 7.2.0 software, and the conservative segments were selected as candidate target regions. The specific amplification primers and probes of HCMV and exogenous internal standard were designed by using Beacon Designer or Primer Express Software v3.0 software (the HCMV target gene selected in this example was UL18, and the exogenous internal standard was the shrimp Taura syndrome virus), respectively, and synthesized by Shanghai Shuoying Biotechnology Co., Ltd. The primers and probes used for detection are shown in Table 1: Table 1 Primer and probe sequence information

[0034] Example 2 Sample nucleic acid extraction (1) Clinical sample collection, storage and transportation: Applicable to urine and serum sample types. Urine sample: Take 1 mL of morning urine in a 1.5 mL sterile centrifuge tube, centrifuge at 12,000 rpm for 5 minutes, discard 800 μL of supernatant, mix the remaining 200 μL of urine with the precipitate, and centrifuge instantly to obtain the specimen. Serum sample: Use a sterile syringe / blood collection tube to extract 3-5 mL of venous blood from the subject, inject it into a sterile collection tube, wait for the sample to precipitate serum by itself or directly centrifuge at room temperature at 1600 rpm for 5 minutes to separate serum, and transfer it to a 1.5 mL sterile centrifuge tube for use. Samples should be tested promptly after collection, and should not be stored for more than 3 days at 2-8°C; should not be stored for more than 6 months at -20±5°C, and can be stored for 12 months at -70°C or below; avoid repeated freezing and thawing of samples, and the number of freezing and thawing should not exceed 5 times.

[0035] (2) Nucleic acid extraction: Sample nucleic acid extraction was performed using the nucleic acid extraction or purification kit produced by Jiangsu ShuoShi Biotechnology Co., Ltd. (registration number: SuTaiXieBei 20140001, SuTaiXieBei 20150256), and nucleic acid extraction was performed according to the instructions. 200 μL of each of the sample to be tested, the negative control, the positive control, the critical positive control, and the quantitative reference were simultaneously extracted with nucleic acid, and 10 μL of the internal standard control was added during nucleic acid extraction. Among them, the sample to be tested was sourced from clinical institutions such as the Taizhou Center for Disease Control and Prevention, Jiangsu Province; the negative control was negative serum sourced from the Taizhou Center for Disease Control and Prevention, Jiangsu Province; the positive control, the critical positive control, and the quantitative reference were serum containing an appropriate amount or a fixed value of human cytomegalovirus recombinant plasmid; the internal standard control was the internal standard recombinant plasmid, and the human cytomegalovirus recombinant plasmid and the internal standard control were constructed by General Biosystems (Anhui) Co., Ltd.

[0036] Example 3 Detection of the extracted sample nucleic acid Prepare the amplification reaction system according to Table 2: Table 2 Amplification reaction system preparation table

[0037] Fluorescence PCR amplification was performed according to the following program: 37°C for 5 min; 95°C for 10 min; 95°C for 10 s, 58°C for 40 s, for a total of 45 cycles; The reference fluorescence (Passive Reference) of ABI 7500 fluorescence PCR instrument was set to ROX, and the quenching group was selected as None.

[0038] Example 4 Result Analysis The test results of negative control, positive control, critical positive control, and human cytomegalovirus quantitative reference Q1 to Q4 must meet the following requirements at the same time: the FAM channel of the negative control has no obvious S-shaped amplification curve or Undet, and the FAM channel test results of the positive control and critical positive control are all positive and show an obvious S-shaped amplification curve ( Figure 1 ), the FAM channel detection results of human cytomegalovirus quantitative reference substances Q1 to Q4 were all positive and showed an obvious S-shaped amplification curve ( Figure 2 ), and the standard curve correlation coefficient |r|≥0.980 ( Figure 3 ). According to the amplification of FAM channel and VIC channel, determine whether human cytomegalovirus exists in the sample; according to the standard curve constructed by human cytomegalovirus quantitative reference materials Q1~Q4 ( Figure 3 ) to determine the load of human cytomegalovirus in the sample.

[0039] For the qualitative interpretation of the results, if the Ct value of the FAM channel detection result is greater than 42.0 or no value is found, and the Ct value of the internal standard control is ≤36.0, it means that the sample is HCMV DNA negative or the sample is below the minimum detection limit of the kit; if the Ct value of the FAM channel detection result is ≤42.0, it means that the sample is HCMV DNA positive.

[0040] The quantitative results are shown in Table 3: Table 3 Interpretation of quantitative results

[0041] Example 5 Specificity Analysis When the method of the present invention is used to perform fluorescence quantitative PCR amplification on Streptococcus pneumoniae, Staphylococcus aureus, Klebsiella pneumoniae, Haemophilus influenzae, Candida albicans, herpes simplex virus type 1, herpes simplex virus type 2, human herpes virus type 6, human herpes virus type 7, human herpes virus type 8, varicella-zoster virus, rubella virus, influenza A virus, influenza B virus, respiratory syncytial virus, adenovirus, coronavirus, parainfluenza virus, Zika virus, high-risk human papillomavirus, Epstein-Barr virus, hepatitis A virus, hepatitis B virus, hepatitis C virus, human immunodeficiency virus and Treponema pallidum, there is no obvious S-shaped amplification curve in the FAM channel, and the detection results are all negative ( Figure 4 ), no cross-reaction.

[0042] Example 6 Analysis of minimum detection limit and quantification limit 1. Determination of minimum detection limit and quantification limit The HCMV international standard (NIBSC code: 09 / 162) of the National Institute for Biological Products Control of the United Kingdom was diluted with HCMV-negative serum and HCMV-negative urine to form a series of samples of 500, 400, 200, 100, and 50 IU / mL. Two replicate dilution series were prepared for each dilution matrix, and each concentration was tested 20 times (the dilution series of HCMV-negative serum and negative urine are shown in Tables 4-5, respectively). The positive detection rate of each concentration level in a total of 40 replicate tests was analyzed, and the concentration level with a positive detection rate of 95% was taken as the minimum detection limit, and the concentration level with an absolute deviation of the quantitative determination result not exceeding 0.5 logarithmic order of magnitude was taken as the quantitative limit.

[0043] Table 4. Dilution series of HCMV negative sera

[0044] Table 5. Dilution series of HCMV-negative urine

[0045] The results are shown in Table 6. The minimum detection limit of the human cytomegalovirus international standard was 100 IU / mL and the limit of quantification was 500 IU / mL when the human cytomegalovirus international standard was diluted with HCMV negative serum; the minimum detection limit of the human cytomegalovirus international standard was 100 IU / mL and the limit of quantification was 500 IU / mL when the human cytomegalovirus international standard was diluted with HCMV negative urine. Therefore, the minimum detection limit of the human cytomegalovirus nucleic acid detection kit (fluorescence PCR method) was preliminarily determined to be 100 IU / mL and the limit of quantification was 500 IU / mL, and the determined concentration was further verified.

[0046] Table 6. Minimum limits of detection and quantification obtained using the international reference material for human cytomegalovirus

[0047] 2. Verification of minimum detection limit and quantification limit The human cytomegalovirus international standard (NIBSC code: 09 / 162) was diluted with HCMV-negative serum and HCMV-negative urine to form a series of samples of 500, 400, 200, 100, and 50 IU / mL. Three batches of human cytomegalovirus nucleic acid detection kits (fluorescence PCR method) were used to verify the minimum detection limit and quantification limit, and each batch of reagents and each concentration were tested 25 times. The minimum detection limit determined by verification has a positive detection rate of at least 95%, and the absolute deviation of the determination results at the quantitative limit concentration level does not exceed 0.5 logarithmic order of magnitude.

[0048] The results are shown in Table 7. The international reference material for human cytomegalovirus was graded diluted with HCMV-negative serum and HCMV-negative urine to form a series of samples of 500, 200, 100, and 50 IU / mL. The minimum detection limit of the three batches of detection reagents was 100 IU / mL, and the limit of quantification was 500 IU / mL.

[0049] In summary, the minimum detection limit of the human cytomegalovirus nucleic acid detection kit (fluorescence PCR method) is 100 IU / mL, and the quantitative limit is 500 IU / mL. The quantitative value unit conversion relationship of this product is 1 IU / mL = 0.67 copies / mL.

[0050] Table 7. Minimum detection limit and quantification limit verification results

[0051] Example 7 Analysis of the linear range of quantitative detection According to the guidance of the EP6A document of the National Committee for Clinical Laboratory Standards (NCCLS), the linear range of the kit was evaluated by serially diluting high-concentration HCMV-positive samples or corporate reference products calibrated with international standards, and the linear range of this product was determined to be 5.0×10 2 IU / mL~5.0×10 9 IU / mL Figure 5 ), linear correlation coefficient |r|≥0.980 ( Figure 6 ).

[0052] Example 8 Accuracy Analysis When testing HCMV international standards or corporate positive references and negative references, the positive and negative compliance rates are both 100%, and the absolute deviation of the quantitative test results from the standard value does not exceed 0.5 logarithmic orders of magnitude.

[0053] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A primer and probe combination for quantitative detection of human cytomegalovirus nucleic acid, characterized in that: The primers include the following sequences: The primer sequences for amplifying the conserved region of HCMV are shown in SEQ ID No. 1-2; The primer sequences for amplifying the exogenous internal standard are shown in SEQ ID No. 3-4; The probe comprises the following sequence: The probe sequence for amplifying the conserved region of HCMV is shown in SEQ ID No. 5; The probe sequence for amplifying the exogenous internal standard is shown in SEQ ID No.

6.

2. The primer and probe combination according to claim 1, characterized in that: The HCMV conservative region is the UL18 conservative region; the exogenous internal standard includes one or more of the shrimp taura syndrome virus, shrimp infectious myonecrosis virus, and shrimp yellow head disease virus.

3. The primer and probe combination according to claim 1, characterized in that: The 5' and 3' ends of the probe carry a fluorescent group and a quenching group, respectively, wherein the fluorescent group is selected from any one or more of FAM, HEX, VIC, TET, TAMRA, ROX, CY3.5, and CY5; the quenching group is selected from any one or more of BHQ1, BHQ2, BHQ3, DABCYL, and MGB.

4. Use of the primer and probe combination according to any one of claims 1 to 3 in preparing a kit for quantitatively detecting human cytomegalovirus nucleic acid.

5. A kit for quantitatively detecting human cytomegalovirus nucleic acid, characterized in that: The kit comprises a human cytomegalovirus reaction solution, a nucleic acid amplification reaction solution, an internal standard control, a negative control, a positive control, a critical positive control, and human cytomegalovirus quantitative reference substances Q1-Q4; wherein the human cytomegalovirus reaction solution comprises a primer and probe combination as described in any one of claims 1-3; wherein the concentration of each primer is 0.1-0.5 μM / L, and the concentration of each probe is 0.05-0.3 μM / L.

6. The kit according to claim 5, characterized in that The human cytomegalovirus reaction solution also includes 1:500-1:1200 V / V ROX Reference Dye, 10-50 mM Tris-HCl, 0.01-0.5 mM EDTA, and RNase-free water.

7. The kit according to claim 5, characterized in that The nucleic acid amplification reaction solution comprises 10-50 mM Tris-HCl, 50-500 mM KCl, 2-4 mM MgCl2, 0.05-0.5 mM dNTPs, 1-2 U Taq DNA polymerase, 0.05-0.1 U UNG enzyme, and RNase-free water.

8. The kit according to claim 5, characterized in that The internal standard control is an internal standard recombinant plasmid; the negative control is human negative serum; the positive control and critical positive control are both human cytomegalovirus recombinant plasmids, and the positive control concentration is 1×10 6 ~1×10 7 IU / mL, the critical positive control concentration is 1×10 3 ~1×10 4 IU / mL; the human cytomegalovirus quantitative reference substances Q1-Q4 are human cytomegalovirus recombinant plasmids, and their concentrations are 2 to 8×10 8 IU / mL, 2~8×10 7 IU / mL, 2~8×10 6 IU / mL, 2~8×10 5 IU / mL.

9. A method for quantitatively detecting human cytomegalovirus nucleic acid using the kit according to any one of claims 5 to 8 for non-diagnostic purposes, comprising the following steps: S1. Prepare PCR reaction solution: mix the nucleic acid amplification reaction solution and the human cytomegalovirus reaction solution, and dispense them into PCR reaction tubes; S2. Nucleic acid extraction: add internal standard control to the sample to be tested, negative control, positive control, critical positive control and human cytomegalovirus quantitative reference substances Q1-Q4, respectively, and perform nucleic acid extraction; S3, adding samples: adding the nucleic acids extracted in step S2 to the PCR reaction tubes in step S1; S4, fluorescent PCR amplification: placing the PCR reaction tube obtained in step S3 into a fluorescent quantitative PCR instrument to perform fluorescent PCR amplification; S5. Interpretation of results.

10. The method according to claim 9, characterized in that In step S4, fluorescent PCR amplification was performed according to the following program: 37°C for 5 min; 95°C for 10 min; 95°C for 10 s, 58°C for 40 s, for a total of 45 cycles.

Images