Composition and kit for detecting pathogenic microorganisms and application of composition and kit

Abstract

The invention relates to the technical field of molecular biological detection, and discloses a composition for detecting pathogenic microorganisms, a kit and application of the composition and the kit. The composition provided by the invention can simultaneously comprise specific primers aiming at a plurality of different pathogenic microorganisms and has excellent specificity and detection sensitivity to the specific pathogenic microorganisms, and different primers do not generate dimerization, so that the different pathogenic microorganisms can be simultaneously, rapidly and accurately detected.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology detection, and in particular to a composition and a kit for detecting pathogenic microorganisms and applications thereof. Background Art

[0002] Plasmodium Falciparum (Pf), Leishmania spp., Echinococcus granulosus and Mycobacterium tuberculosis are pathogenic microorganisms that pose a major threat to human health and can cause serious illness or even death in infected people. Currently, the detection methods for these pathogenic microorganisms have the following problems: the processing process is cumbersome and time-consuming; the operation is complex and professional, and the requirements for operators are high; the detection accuracy and sensitivity are insufficient, and it is easy to miss the detection.

[0003] With the development of molecular biology technology, PCR has become one of the most commonly used detection technologies in clinical diagnosis and medical testing. However, PCR often shows large differences in detection accuracy, sensitivity and specificity due to differences in target sequence selection and primer sequence design. Moreover, conventional PCR detection can usually only detect one pathogenic microorganism at a time. When it is necessary to detect multiple different pathogenic microorganisms in a sample, there are often problems such as cumbersome operation, easy errors and low detection efficiency.

[0004] Therefore, there is an urgent need to provide methods and related products that can simultaneously detect different pathogenic microorganisms and have high detection sensitivity, specificity and accuracy. Summary of the invention

[0005] The purpose of the present invention is to overcome the above problems existing in the prior art and provide a composition, a kit and their applications for detecting pathogenic microorganisms. The composition provided by the present invention can simultaneously include primers for multiple different pathogenic microorganisms, so that different target sequences can be accurately amplified at the same time when used to achieve simultaneous, rapid and accurate detection of different pathogenic microorganisms.

[0006] In order to achieve the above object, the first aspect of the present invention provides a composition, which comprises at least one of the following primer pairs:

[0007] Primer pair A: comprising an upstream primer and a downstream primer for a target sequence in the Plasmodium falciparum genome, wherein the target sequence in the Plasmodium falciparum genome comprises the nucleotide sequence shown in SEQ ID NO: 1;

[0008] Primer pair B: comprising an upstream primer and a downstream primer for a target sequence in the Leishmania genome, wherein the target sequence in the Leishmania genome comprises the nucleotide sequence shown in SEQ ID NO: 4;

[0009] Primer pair C: comprising an upstream primer and a downstream primer for a target sequence in the Mycobacterium tuberculosis genome, wherein the target sequence in the Mycobacterium tuberculosis genome comprises the nucleotide sequence shown in SEQ ID NO: 7;

[0010] Primer pair D: comprises an upstream primer and a downstream primer for a target sequence in the genome of Echinococcus granulosus, wherein the target sequence in the genome of Echinococcus granulosus comprises the nucleotide sequence shown in SEQ ID NO:10.

[0011] The second aspect of the present invention provides a kit, which comprises the composition described in the first aspect.

[0012] The third aspect of the present invention provides the use of the composition described in the first aspect, or the kit described in the second aspect in the joint detection of pathogenic microorganisms, wherein the pathogenic microorganisms are selected from a combination of at least two of Plasmodium falciparum, Leishmania, Mycobacterium tuberculosis and Echinococcus granulosus.

[0013] The fourth aspect of the present invention provides a method for jointly detecting pathogenic microorganisms in a sample, the method comprising using the composition described in the first aspect or the kit described in the second aspect to perform nucleic acid amplification on the sample to be tested, wherein the pathogenic microorganisms are selected from a combination of at least two of Plasmodium falciparum, Leishmania, Mycobacterium tuberculosis and Echinococcus granulosus.

[0014] Through the above technical solution, the present invention can at least achieve the following beneficial effects:

[0015] (1) The composition and kit provided by the present invention can simultaneously detect two or more different pathogenic microorganisms, and the detection process is performed only through one PCR, which greatly improves the detection efficiency and reduces the detection cost.

[0016] (2) In a preferred embodiment, by combining with a specific probe modified with a reporter group, the composition and kit provided by the present invention can more intuitively detect different pathogenic microorganisms in a sample by methods such as qPCR, and can achieve rapid quantitative detection.

[0017] (3) The primer pairs (and probes) contained in the composition provided by the present invention will not polymerize with each other, and have good specificity, high detection sensitivity, easy operation, and are suitable for large-scale promotion and application. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a diagram showing the results of fluorescent quantitative PCR detection of simulated test samples using the kit of Example 1 in Example 2.

[0019] Figure 2 This is a graph showing the detection results of the specificity test of the kit of Example 1 in Example 2.

[0020] Figure 3 This is a result diagram of ten repeated tests of a strong positive simulation sample (R1) and a weak positive simulation sample (R2) of Plasmodium falciparum using the kit of Example 1 in Example 2.

[0021] Figure 4 This is a result diagram of ten repeated tests of a strong positive simulation sample (R1) and a weak positive simulation sample (R2) of Leishmania using the kit of Example 1 in Example 2.

[0022] Figure 5 This is a result diagram of ten repeated tests of a strong positive simulation sample (R1) and a weak positive simulation sample (R2) of Mycobacterium tuberculosis using the kit of Example 1 in Example 2.

[0023] Figure 6 This is a graph showing the results of ten repeated tests of a strong positive simulation sample (R1) and a weak positive simulation sample (R2) of Echinococcus granulosus using the kit of Example 1 in Example 2.

[0024] Figure 7 This is a graph showing the test results of a simulated sample simultaneously infected with Leishmania and Echinococcus granulosus using the kit of Example 1 in Example 2.

[0025] Figure 8 This is a graph showing the test results of a simulated sample simultaneously infected with Plasmodium falciparum and Echinococcus granulosus using the kit of Example 1 in Example 2.

[0026] Fig. 9 This is a graph showing the test results of a simulated sample simultaneously infected with Mycobacterium tuberculosis and Echinococcus granulosus using the kit of Example 1 in Example 2.

[0027] Fig.10 This is a result diagram of fluorescent quantitative PCR detection of the simulated test sample of Example 2 using the kit of Comparative Example 1. DETAILED DESCRIPTION

[0028] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0029] The inventors of the present invention cleverly designed a series of PCR primers based on specific target sequences in Plasmodium falciparum, Leishmania, Mycobacterium tuberculosis and Echinococcus granulosus in their research. These primers will not produce non-specific binding or dimer formation, can exist in the reaction system at the same time, and simultaneously perform PCR amplification on multiple target sequences, thereby achieving simultaneous multiple detection of different pathogenic microorganisms. At the same time, the inventors further designed a series of nucleic acid probes for the above target sequences. After modifying the reporter groups such as fluorescent groups on these nucleic acid probes, they can use technologies such as qPCR to more quickly and conveniently achieve simultaneous and accurate quantitative detection of the above pathogenic microorganisms.

[0030] Based on this, the first aspect of the present invention provides a composition, which comprises at least one of the following primer pairs:

[0031] Primer pair A: comprising an upstream primer and a downstream primer for a target sequence in the Plasmodium falciparum genome, wherein the target sequence in the Plasmodium falciparum genome comprises the nucleotide sequence shown in SEQ ID NO: 1;

[0032] Primer pair B: comprising an upstream primer and a downstream primer for a target sequence in the Leishmania genome, wherein the target sequence in the Leishmania genome comprises the nucleotide sequence shown in SEQ ID NO: 4;

[0033] Primer pair C: comprising an upstream primer and a downstream primer for a target sequence in the Mycobacterium tuberculosis genome, wherein the target sequence in the Mycobacterium tuberculosis genome comprises the nucleotide sequence shown in SEQ ID NO: 7;

[0034] Primer pair D: comprises an upstream primer and a downstream primer for a target sequence in the genome of Echinococcus granulosus, wherein the target sequence in the genome of Echinococcus granulosus comprises the nucleotide sequence shown in SEQ ID NO:10.

[0035] Preferably, the primer sequences included in the primer pair A, primer pair B, primer pair C and primer pair D will not dimerize with each other.

[0036] In the present invention, the target sequence targeted by each primer pair can be the above-listed sequences themselves, or a sequence in which several bases are deleted, added or replaced based on the above-listed sequences and can still be specifically recognized and amplified by the above-listed primer pairs.

[0037] According to a preferred embodiment of the present invention, the primer pair A is an upstream primer and a downstream primer for a target sequence such as a nucleotide sequence shown in SEQ ID NO:1.

[0038] GTGTTCATAACAGACGGGTAGTCATGATTGAGTTCATTGTGTTTGAATACTACAGCATGGAATA

[0039] ACAAATATGAATAAGCTAATTATTTTTTTTTCATAATTTTTTTTGATATTCTTATTAGCTTAGTT ACGATTAATAGGAGTAGCTTTGGGGGCATTCGTATTCAGATGT(SEQ ID NO:1)

[0040] Preferably, primer pair A comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO:2 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO:3.

[0041] GTGTTCATAACAGACGGGTAGTCA(SEQ ID NO:2)

[0042] TACGAATGCCCCCAAAGCTA(SEQ ID NO:3)

[0043] According to a preferred embodiment of the present invention, the primer pair B is an upstream primer and a downstream primer for a target sequence such as a nucleotide sequence as shown in SEQ ID NO:4.

[0044] GTAGGCCTTTCCCACATACACAGCAAAGTTTTGTACTCAAAATTTGCAGTAAAAAAAAGGCCG

[0045] ATCGACGTTATAACGCACCGCCTATACAAAAGCAAAAATGTCCGTTTACAAAAAATATACG

[0046] GCGTTTCGGTTTTTGGCGGGGTGGGTGCGTGTGTGGATAACGGCTCACATAACGTGTCGCGATG

[0047] GATGACTTGGCTTCCTATTTCGTTGAAGAACGCAGTAAAGTGCGATAAGTGGTATCAATTGCAG

[0048] AATATTCAATTACCGAATCTTTGAACGCAAACGGCGCATGGGAGAAGCTCTATTGTGTCATCC

[0049] CCGTGCATGCCATATTCTCAGTGTCGAACAAAAAACAACACGCCGCCTCCTCTCTTCTGCACATATATATATTATACCATACACAGTATATAT(SEQ ID NO:4)

[0050] Preferably, primer pair B includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO:5 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO:6.

[0051] TAGGCCTTTCCCACATACACAG(SEQ ID NO:5)

[0052] ACTGTGTATGGTATAATAT(SEQ ID NO:6)

[0053] According to a preferred embodiment of the present invention, the primer pair C is an upstream primer and a downstream primer for a target sequence such as a nucleotide sequence as shown in SEQ ID NO:7.

[0054] GAGGGCATCGAGGTGGCCAGATGCACCGTCGAACGGCTGATGACCAAAACTCGGCCTGTCCGGG

[0055] ACCACCCGCGGCAAAGCCCGCAGGACCACGATCGCTGATCCGGCCACAGCCCGTCCCGCCGAT

[0056] CTCGTCCAGCGCCGCTTCGGACCACCAGCACCTAACCGGCTGTGGGTAGCAGACCTCACCTATG

[0057] TGTCGACCTGGGCAGGGTTCGCCTACGTGGCCTTTGTCACCGACGCCTACGCTCGCAGGATCCT

[0058] GGGCTGGCGGGTCGCTTCCACGATGGCCACCTCCATGGTCCTCGACGCGATCGAGCAAGCCATC

[0059] TGGACCCGCCAACAAGAAGGCGTACTCGACCTGAAAGACGTTATCCACCATACGGATAGGGGATCTCAGTACACATCGAT(SEQ ID NO:7)

[0060] Preferably, primer pair C includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO:8 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO:9.

[0061] ATCGAGGTGGCCAGATGCACC(SEQ ID NO:8)

[0062] TCAGGTCGAGTACGCCTTCTTG(SEQ ID NO:9)

[0063] According to a preferred embodiment of the present invention, the primer pair D is an upstream primer and a downstream primer for a target sequence such as a nucleotide sequence as shown in SEQ ID NO:10.

[0064] TGTGTTGATTTTGCCTGGATTTGGTATAATTAGTCATATTTGTTTGAGTATTAGTGCTAATTTTG

[0065] ATGCGTTGGGTTCTATGGGTTGTTGTTTGCTATGTTTTCTATAGTGTGTTTGGGTAGCAGGGTT

[0066] TGGGGTCATCATATGTTTACTGTTGGGTTGGATGTGAAGACGGCTGTTTTTTTTAGCTCTGTTAC

[0067] TATGATTATAGGGGTTTCCTACTGGTATAAAGGTGTTTACTTGGTTATATATGTTGTTGAATTCGA

[0068] GTGTTAATGTTAGTGATCCGGTTTTGTGATGGGTTGTTTCTTTTATAGTGTTGTTTACGTTTGGG

[0069] GGAGTTACGGGTATAGTTTTGTCTGCTTGTGTGTTAGATAATATTTTGCATGATACTTGGTTTGTG (SEQ ID NO: 10)

[0070] Preferably, primer pair D comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO:11 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO:12.

[0071] GTTGATTTTGCCTGGATTTGG(SEQ ID NO:11)

[0072] TATTATCTAACACACAAGCA(SEQ ID NO:12)

[0073] The primer sequences provided by the present invention will not produce non-specific binding, and will not form dimers during use, so that different primer pairs can be mixed together for use, thereby achieving simultaneous PCR detection of different pathogenic microorganisms, improving detection efficiency, and saving detection reagents.

[0074] According to a preferred embodiment of the present invention, the composition comprises a combination of at least two pairs of primer pairs AD.

[0075] The present invention has no particular restrictions on the combination of primer pairs used in the specific composition, and can be selected according to actual detection needs (such as target detection items, detection costs, etc.). The composition can contain two pairs of primer pairs, three pairs of primer pairs, or four pairs of primer pairs at the same time.

[0076] For example, the composition can include primer pair A and B; primer pair A and C; primer pair A and D; primer pair B and C; primer pair B and D; or, primer pair C and D.

[0077] For example, the composition can include primer pairs A, B, and C; primer pairs A, B, and D; or, primer pairs B, C, and D.

[0078] For example, the composition may further include primer pairs A, B, C, and D.

[0079] According to a preferred embodiment of the present invention, the composition further comprises a nucleic acid probe, and the nucleic acid probe comprises at least one of the following:

[0080] Nucleic acid probe A: comprising a probe targeting a target sequence (i.e., SEQ ID NO: 1) in the Plasmodium falciparum genome;

[0081] Nucleic acid probe B: comprising a probe against a target sequence in the Leishmania genome (i.e., SEQ ID NO: 4);

[0082] Nucleic acid probe C: comprising a probe for a target sequence (i.e., SEQ ID NO: 7) in the genome of Mycobacterium tuberculosis;

[0083] Nucleic acid probe D: comprises a probe against a target sequence (ie, SEQ ID NO: 10) in the genome of Echinococcus granulosus.

[0084] The specific nucleotide sequence of the target sequence in the above nucleic acid probe AD is as described above and will not be repeated here.

[0085] Preferably, nucleic acid probe A comprises an oligonucleotide having a nucleotide sequence as shown in SEQ ID NO:13.

[0086] TTATTGTGTTTGAATACTACA(SEQ ID NO:13)

[0087] Preferably, nucleic acid probe B comprises an oligonucleotide having a nucleotide sequence as shown in SEQ ID NO:14.

[0088] CAGAATCATTCAATTACCGAAT(SEQ ID NO:14)

[0089] Preferably, nucleic acid probe C comprises an oligonucleotide having a nucleotide sequence as shown in SEQ ID NO:15.

[0090] AGGACCACGATCGCTGATCC(SEQ ID NO:15)

[0091] Preferably, nucleic acid probe D comprises an oligonucleotide having a nucleotide sequence as shown in SEQ ID NO:16.

[0092] TTATAGGGGTTTCCTACTGGT(SEQ ID NO:16)

[0093] According to a preferred embodiment of the present invention, the nucleic acid probe further comprises a reporter group modified on the oligonucleotide sequence, preferably a fluorescent reporter group.

[0094] Preferably, different fluorescent marker groups are modified on the probes (5' end) for different target sequences. Preferably, the different fluorescent marker groups can be detected simultaneously through different channels.

[0095] According to some preferred embodiments of the present invention, the fluorescent labeling group can be selected from at least one of ATTO 425, HEX, FAM, ROX, CY5 and Quasar705.

[0096] Preferably, the probe (3' end) is further modified with a fluorescence quenching group. Preferably, the fluorescence quenching group is selected from BHQ1 and / or BHQ2.

[0097] In the above composition provided by the present invention, each primer (pair) and probe can be packaged independently or mixed. Since non-specific binding does not occur between each primer (pair) and probe in the above composition provided by the present invention, preferably, in order to save packaging materials and reduce production and use costs, the primer pairs and probes in the composition can exist in the form of mixed packaging.

[0098] According to some preferred embodiments of the present invention, the composition may further include primers and probes for detecting internal standards.

[0099] The present invention has no particular limitation on the specific selection of the internal standard for detection, and the internal standard for detection can be selected in accordance with conventional methods in the art. Preferably, the internal standard for detection can be at least one of human housekeeping genes.

[0100] The second aspect of the present invention provides a kit, which comprises the composition described in the first aspect.

[0101] According to a preferred embodiment of the present invention, the kit further comprises at least one of a buffer, an enzyme and deoxynucleotide triphosphates (dNTPs).

[0102] Preferably, the buffer comprises Tris-HCl buffer.

[0103] Preferably, the enzyme comprises at least one of a UNG enzyme and a DNA polymerase.

[0104] More preferably, the kit further comprises a positive control reagent and a negative control reagent.

[0105] The present invention has no particular restrictions on the specific selection of reagents used as positive controls and negative controls in the kit, and they can be selected according to conventional techniques in the art. For example, reagents such as physiological saline and buffer that do not contain target sequences can be used as negative controls, and internal standard gene pseudoviruses can also be used as negative controls. For another example, mixed plasmids containing corresponding specific gene target sequences, DNA or RNA of target gene fragments, pseudoviruses, etc. can be used as positive controls.

[0106] The third aspect of the present invention provides the use of the composition described in the first aspect, or the kit described in the second aspect in the joint detection of pathogenic microorganisms, wherein the pathogenic microorganisms are selected from a combination of at least two of Plasmodium falciparum, Leishmania, Mycobacterium tuberculosis and Echinococcus granulosus.

[0107] The composition and kit provided by the present invention can simultaneously detect two pathogenic microorganisms, three pathogenic microorganisms or four pathogenic microorganisms. When the composition or kit provided by the present invention is used to simultaneously detect two or more pathogenic microorganisms, only one PCR is required (in the same reaction tube).

[0108] The fourth aspect of the present invention provides a method for jointly detecting pathogenic microorganisms in a sample, the method comprising using the composition described in the first aspect or the kit described in the second aspect to perform nucleic acid amplification on the sample to be tested, wherein the pathogenic microorganisms are selected from a combination of at least two of Plasmodium falciparum, Leishmania, Mycobacterium tuberculosis and Echinococcus granulosus.

[0109] Preferably, the method further comprises analyzing the amplification result. In a preferred embodiment, since the probe is modified with a marker such as a fluorescent marker group, the target pathogenic microorganism can be qualitatively or quantitatively detected by detecting the marker such as fluorescence detection.

[0110] The present invention will be described in detail below by way of examples. It should be understood that the following examples are only used to further explain and illustrate the content of the present invention by way of example, and are not intended to limit the present invention.

[0111] In the following examples, unless otherwise specified, the reagents and materials used were all commercial products purchased from regular chemical or biological reagent / material suppliers, and the reagents were all analytical grade.

[0112] Example 1

[0113] This example is used to illustrate the preparation of the kit provided by the present invention.

[0114] 1. Prepare primers and probes

[0115] Primers and probes were synthesized according to the sequences in Table 1.

[0116] Table 1

[0117]

[0118]

[0119] 2. Prepare the unit reaction reagent kit for PCR reaction

[0120] Prepare the corresponding reagents according to the reagent amounts required by the unit reaction reagent set in Table 2 (ie, the reagent set for detecting one sample in one PCR reaction).

[0121] Table 2

[0122]

[0123] *In Table 1, PCR buffer was purchased from Hunan Kangde Biotechnology Co., Ltd. with the product number PCR buffer (S09); the amounts of upstream primers, downstream primers and probes were respectively the amounts for one sequence; the reagents were packaged separately according to the "PCR reaction solution" and "enzyme" in the table, that is, the PCR reaction solution was a mixture of the listed components, and the enzyme was a mixture of Taq enzyme and UDG enzyme.

[0124] 3. Prepare internal standard reagents and control reagents

[0125] Negative control: sterile saline.

[0126] Positive control: target sequence mixed plasmid, which is prepared by inserting each target sequence into pUC57. The plasmids containing each target sequence are mixed in a mass ratio of 1:1:1:1 to obtain the positive control reagent. The concentration of each target sequence is 1×10 5 Copy number / mL, specific target sequences are shown in Table 1.

[0127] 4. Prepare the kit

[0128] According to the target detection volume of a single kit, the reagents prepared in steps 1-3 are combined and packaged.

[0129] Example 2

[0130] This example is used to illustrate the combined detection effect of the kit provided by the present invention on Klebsiella pneumoniae, Enterococcus faecalis and their drug resistance in samples.

[0131] 1. PCR detection

[0132] Take 10 μL of simulated sample (a mixture of all target sequences in Table 1 was prepared using human serum, with the concentration of each target sequence being 1×10 5 10 μL of negative control and 10 μL of positive control were added into PCR reaction tubes respectively, and a unit PCR reaction reagent kit of one sample amount was added into each tube (for specific components, refer to Table 2, and the total amount of each tube is 40 μL). After mixing, the reagents were placed in the Macrostone Fluorescence Quantitative PCR Analyzer, and PCR reaction was performed according to the reaction conditions in Table 3.

[0133] Table 3

[0134]

[0135] Detection standard: Referring to Table 4, if there is an obvious S-shaped amplification curve in the FAM, HEX / VIC, ROX and CY5 channels, and the Ct value is ≤40, it is judged as positive; if there is no amplification curve (No Ct) or the Ct value is greater than 40 in the FAM, HEX, ROX, CY5 and 705 channels, it is judged as negative.

[0136] Table 4

[0137]

[0138] Test results such as Figure 1 As shown, referring to the judgment criteria in Table 4, it is determined that all the tests of the simulated sample to be tested are positive, which is consistent with the composition of the simulated sample to be tested.

[0139] (II) Sensitivity test

[0140] The sensitivity (LOD) of each target was tested as follows:

[0141] Prepare gradient dilution solutions of each target sequence plasmid, with the concentration gradient being 800 copies / mL, 400 copies / mL, and 200 copies / mL. Then, the gradient dilution solutions of each target sequence were tested using the method in Experiment (I) to determine the detection limit of each target sequence. The specific test results (Ct values) are detailed in Table 5.

[0142] Table 5: Results of detection limits determination for different targets

[0143]

[0144] Note: In Table 5, NoCt means not detected within 40 cycles, that is, the Ct value exceeds 40.

[0145] (III) Specificity test

[0146] The method in experiment (I) was used to detect samples of Streptococcus pneumoniae, Escherichia coli, Staphylococcus epidermidis, Acinetobacter baumannii, Klebsiella pneumoniae, Candida tropicalis, Candida krusei, Enterococcus faecalis, Haemophilus influenzae, Staphylococcus aureus, Pseudomonas aeruginosa, Legionella pneumophila, Clostridium botulinum, Haemophilus parainfluenzae, influenza A virus, and influenza B virus (the samples contained a mixture of the above pathogenic microorganisms). The results are as follows Figure 2 As shown in the figure, it can be seen that the kit of the present invention shows obvious negative detection results for these pathogenic microorganism samples.

[0147] (IV) Stability test

[0148] Using the method in experiment (I), the strong positive simulation samples and weak positive simulation samples of each pathogenic microorganism were repeatedly tested, and each sample was tested 10 times.

[0149] Among them, the strong positive simulation sample (denoted as R1) is a 1×10 5 The weak positive simulation sample (denoted as R2) is a 1×10 3 Copies / mL of target sequence solution.

[0150] Figure 3-6 The results of ten tests for Plasmodium falciparum, Leishmania, Mycobacterium tuberculosis and Echinococcus granulosus are shown in the figure. It can be seen from the figure that no matter whether the strong positive simulation sample or the weak positive simulation sample is repeatedly tested, the results show high consistency, indicating that the (primer and probe) composition and kit provided by the present invention have excellent stability.

[0151] (V) Testing of actual samples

[0152] Leishmania + Echinococcus granulosus, Plasmodium falciparum + Echinococcus granulosus, Mycobacterium tuberculosis + Echinococcus granulosus were mixed with human blood to prepare simultaneous infection simulation samples. After total DNA was extracted from the above simultaneous infection simulation samples, they were tested using the method in experiment (I). The test results are as follows: Figure 7-9 As shown in the figure, it can be seen that the detection results of these simultaneously infected samples are consistent with the pathogenic microorganisms contained therein, indicating that the (primer and probe) composition and kit provided by the present invention also have good effects when detecting real samples.

[0153] Comparative Example 1

[0154] The kit was prepared using the method in Example 1, except that the primers and probes were replaced with the sequences in Table 6.

[0155] Table 6

[0156]

[0157] The same simulated sample to be tested was tested using the method of Experiment (I) in Example 2, and the results are as follows: Fig.10 By comparison Figure 1 and Fig.10 It can be seen from the test results that when the kit of this comparative example is used for detection, the fluorescence increment decreases and the Ct value is delayed, indicating that if a more ideal detection effect is to be achieved (being able to more quickly and accurately detect Plasmodium falciparum, Leishmania, Mycobacterium tuberculosis and Echinococcus granulosus in the sample at the same time), the primers and probe sequences selected in the kit provided by the present invention are irreplaceable.

[0158] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, the technical solution of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.

Claims

1. A composition, characterized in that The composition comprises at least one of the following primer pairs: Primer pair A: comprising an upstream primer and a downstream primer for a target sequence in the Plasmodium falciparum genome, wherein the target sequence in the Plasmodium falciparum genome comprises the nucleotide sequence shown in SEQ ID NO: 1; Primer pair B: comprising an upstream primer and a downstream primer for a target sequence in the Leishmania genome, wherein the target sequence in the Leishmania genome comprises the nucleotide sequence shown in SEQ ID NO: 4; Primer pair C: comprising an upstream primer and a downstream primer for a target sequence in the Mycobacterium tuberculosis genome, wherein the target sequence in the Mycobacterium tuberculosis genome comprises the nucleotide sequence shown in SEQ ID NO: 7; Primer pair D: comprises an upstream primer and a downstream primer for a target sequence in the genome of Echinococcus granulosus, wherein the target sequence in the genome of Echinococcus granulosus comprises the nucleotide sequence shown in SEQ ID NO:

10.

2. The primer composition according to claim 1, wherein Primer pair A is an upstream primer and a downstream primer for a target sequence having a nucleotide sequence as shown in SEQ ID NO: 1; Preferably, primer pair A includes a primer having a nucleotide sequence as shown in SEQ ID NO: 2 and a primer having a nucleotide sequence as shown in SEQ ID NO: 3; and / or, primer pair B is an upstream primer and a downstream primer for a target sequence having a nucleotide sequence as shown in SEQ ID NO: 4; Preferably, primer pair B includes a primer having a nucleotide sequence as shown in SEQ ID NO: 5 and a primer having a nucleotide sequence as shown in SEQ ID NO: 6; and / or, primer pair C is an upstream primer and a downstream primer for a target sequence having a nucleotide sequence as shown in SEQ ID NO: 7; Preferably, primer pair C includes a primer having a nucleotide sequence as shown in SEQ ID NO: 8 and a primer having a nucleotide sequence as shown in SEQ ID NO: 9; and / or, the primer pair D is an upstream primer and a downstream primer for a target sequence having a nucleotide sequence as shown in SEQ ID NO: 10; Preferably, primer pair D includes a primer having a nucleotide sequence as shown in SEQ ID NO:11 and a primer having a nucleotide sequence as shown in SEQ ID NO:

12.

3. The composition according to claim 1 or 2, wherein The composition includes a combination of at least two of the primer pairs AD.

4. The composition according to any one of claims 1 to 3, wherein The composition further comprises a nucleic acid probe, wherein the nucleic acid probe comprises at least one of the following: Nucleic acid probe A: comprising a probe for a target sequence in the Plasmodium falciparum genome; Nucleic acid probe B: comprising a probe for a target sequence in the Leishmania genome; Nucleic acid probe C: comprising a probe for a target sequence in the genome of Mycobacterium tuberculosis; Nucleic acid probe D: comprising a probe for a target sequence in the genome of Echinococcus granulosus; Preferably, nucleic acid probe A comprises an oligonucleotide having a nucleotide sequence as shown in SEQ ID NO: 13; Preferably, nucleic acid probe B comprises an oligonucleotide having a nucleotide sequence as shown in SEQ ID NO: 14; Preferably, nucleic acid probe C comprises an oligonucleotide having a nucleotide sequence as shown in SEQ ID NO: 15; Preferably, nucleic acid probe D comprises an oligonucleotide having a nucleotide sequence as shown in SEQ ID NO:

16.

5. The composition according to claim 4, wherein The nucleic acid probe further comprises a reporter group modified on the oligonucleotide sequence, preferably a fluorescent reporter group; Preferably, the nucleic acid probe further comprises a fluorescence quenching group modified on the oligonucleotide sequence.

6. The composition according to claim 4 or 5, wherein When the composition contains two or more nucleic acid probes, the fluorescent reporter groups modified on each nucleic acid probe are different.

7. A kit, characterized in that: The kit comprises the composition of any one of claims 1-6.

8. The kit according to claim 7, wherein The kit further comprises at least one of a buffer, an enzyme and deoxynucleotide triphosphates; Preferably, the buffer comprises Tris hydrochloride buffer; Preferably, the enzyme comprises at least one of a UNG enzyme and a DNA polymerase; More preferably, the kit further comprises a positive control reagent and a negative control reagent.

9. Use of the composition according to any one of claims 1 to 6, or the kit according to claim 7 or 8 in the joint detection of pathogenic microorganisms, wherein: The pathogenic microorganisms are selected from a combination of at least two of Plasmodium falciparum, Leishmania, Mycobacterium tuberculosis and Echinococcus granulosus.

10. A method for joint detection of pathogenic microorganisms in a sample, characterized in that: The method comprises performing nucleic acid amplification on a sample to be tested using the composition described in any one of claims 1 to 6 or the kit described in claim 7 or 8, wherein the pathogenic microorganism is selected from a combination of at least two of Plasmodium falciparum, Leishmania, Mycobacterium tuberculosis and Echinococcus granulosus.

Images