Salt-tolerant xylanase and application

Abstract

The invention discloses salt-tolerant xylanase and application thereof, and relates to the technical field of biology. The amino acid sequence of the salt-tolerant xylanase is as shown in SEQ ID NO: 1. According to the invention, a new xylanase gene xynaes is separated from a metagenome of Xinjiang Aiding Lake, and the xylanase belongs to the GH10 family and has low homology with reported xylanase. The recombinant xylanase has high activity and tolerance at a high temperature, has good performance in an alkaline environment, has high tolerance to various metal ions, quickly loses activity under SDS treatment, and should be prevented from being in contact with SDS in industrial production.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and more particularly to a salt-tolerant xylanase and its application. Background Art

[0002] Lignocellulose is the most abundant renewable biomass on earth, producing 100 billion tons of it every year through photosynthesis. Its main components are cellulose, hemicellulose and lignin, as well as a small amount of pectin (Kumar et al., 2009). Hemicellulose is the second most abundant polysaccharide in nature after cellulose, accounting for about one-third of all renewable organic carbon on earth. Xylan, as the main component of hemicellulose, is widely present in plant cell walls (Uday et al., 2016). It is a heterogeneous polysaccharide composed of xylose monomers connected by β-1,4-glycosidic bonds, with complex structure and slow natural degradation. Xylanase (xylanase) decomposes hemicellulose by completely hydrolyzing the linear polysaccharide β-1,4-xylan into simpler compounds mainly composed of xylose (Aglaia et al., 2016). It is a group of complex enzyme systems. It includes β-1,4-endo-xylanase, β-xylosidase, α-L-arabinosidase, α-D-glucuronidase, acetyl-xylanase and phenolic acid esterase, which catalyze the hydrolysis of xylosidic bonds. It can degrade xylan hemicelluloses that exist in large quantities in nature. In this hydrolytic enzyme system, β-1,4-endo-xylanase is the most critical hydrolase, which mainly hydrolyzes xylan into oligosaccharides such as small oligosaccharides and xylobiose, as well as a small amount of xylose and arabinose by hydrolyzing the β-1,4-glycosidic bonds in xylan molecules.

[0003] Many studies have reported that fungi, bacteria, yeast, algae (Mandal, 2015), seeds, crustaceans, snails (Polizeli et al, 2005) produce xylanases, of which fungi and bacteria are the main sources. Different sources of xylanases have different characteristics, which makes them have different potential utilization values.

[0004] Microbial xylanases have attracted wide attention due to their potential in industrial processes such as food, feed, pulp and paper making, and show great potential in improving the production of products such as SCP, enzymes, liquid or gaseous fuels, solvents and syrups in the most economical way, which can be used directly as industrial raw materials or as raw materials for other microbial processes (Kuhad and Singh, 1993). Therefore, the market for xylanases has grown significantly worldwide in the past few years (Aglaia et al., 2016) and is considered to be "one of the more important enzymes in industry" (Dhiman et al, 2008).

[0005] Due to the special application requirements of xylanase, such as high temperature and high pressure, the exploration of xylanase in extreme environments has become a hot topic of research. At present, many extremophilic xylanases have been isolated, especially from thermophilic bacteria, alkaliphilic bacteria and acidophilic bacteria. However, it is difficult to culture microorganisms in extreme environments, and metagenomic technology has solved this problem very well. Metagenomic technology can directly obtain the nucleotide sequences of most genes from environmental DNA, without being restricted by culture technology, so as to analyze the genetic information of microorganisms and screen functional genes (Tansirichaiya et al, 2023). Therefore, metagenomic technology has great advantages in extracting thermophilic xylanases from uncultured extreme environment microorganisms (Montella et al, 2015).

[0006] The present invention uses metagenomics technology to obtain a new GH10 family xylanase gene xynaes from Xinjiang Aidin Lake, introduces the gene sequence into Escherichia coli (DH5α) for cloning and heterologous expression, uses Ni-NTA affinity chromatography to separate and purify the recombinant xylanase (XynAES), and studies its enzymatic properties using xylan as a substrate. The results show that XynAES is a thermophilic, alkaliphilic, and salt-tolerant xylanase, indicating that it may have a wide range of application value in feed processing, food production, pulp and paper making, and prebiotic production. Summary of the invention

[0007] In view of this, the present invention provides a salt-tolerant xylanase and application thereof.

[0008] In order to achieve the above object, the present invention adopts the following technical solution:

[0009] A salt-tolerant xylanase, the amino acid sequence of which is shown in SEQ ID NO: 1.

[0010] A DNA molecule encoding salt-tolerant xylanase, wherein the nucleotide sequence of the DNA molecule is shown as SEQ ID NO:2.

[0011] A recombinant vector comprising the DNA molecule of claim 2 and a regulatory sequence for expression operably linked to the DNA molecule.

[0012] A host cell, comprising the DNA molecule or the recombinant vector according to claim 3.

[0013] Application of salt-tolerant xylanase in cellulose degradation.

[0014] It can be seen from the above technical solution that, compared with the prior art, the beneficial effects of the present invention are:

[0015] The present invention isolates a new xylanase gene xynaes from the Xinjiang Aidin Lake metagenome, and the xylanase belongs to the GH10 family and has a low homology with the reported xylanase. The recombinant xylanase has high activity and tolerance at high temperature and performs well in an alkaline environment. It has high tolerance to various metal ions, but quickly loses activity under SDS treatment, and should avoid contact with SDS in industrial production. The hydrolysis products of XynAES hydrolyzing xylans from various sources are all xylobiose and xylotetrose, which indicates that the enzyme is a strict endo-xylanase and is almost unaffected by xylan branching. The fixed hydrolysis product is beneficial for the production of prebiotics using oligoxylose. In summary, it can be considered that XynAES is a heat-resistant and alkali-resistant xylanase with high catalytic efficiency, and the enzyme may be widely used in industrial utilization of hemicellulose, detergent additives, feed additives and other technologies. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0017] Figure 1 The sequence and structure analysis diagram of the recombinant xylanase XynAES of the present invention; Figure 1 On the left is the phylogenetic tree obtained by maximum likelihood analysis based on amino acid sequences, showing the phylogenetic position of XynAES and related xylanases, with bootstrap values ​​(expressed as percentage of 1000 replicates) given at the nodes; Figure 1 The right is the predicted structure of xylanase XynAES;

[0018] Figure 2 The figure is the SDS-PAGE electrophoresis diagram of the recombinant xylanase XynAES of the present invention; Lane 1, protein molecular weight marker, the left side indicates the mass; Lane 2, total protein of Escherichia coli DH5α / pSHY211-XynAES; Lane 3, purified XynAES;

[0019] Figure 3 Graph showing the effects of temperature and pH on the activity and stability of recombinant XynAES. Figure 3 A is the effect of temperature on the activity of XynAES. Figure 3 B is the effect of pH on the activity of XynAES. Figure 3 C is the effect of temperature on stability. Figure 3 D is the effect of pH on stability;

[0020] Figure 4 This is the effect of NaCl on the activity of recombinant xylanase XynAES; Figure 4 A is the relative activity of XynAES at different NaCl concentrations; Figure 4 B is the residual activity of XynAES after one week of incubation at different salinities;

[0021] Figure 5 The TLC analysis diagram of the hydrolysis product of xylan by the recombinant xylanase XynAES of the present invention. Lane 1, xylo-oligosaccharide (X2, X3 and X4) standard; Lane 2, 1% beech xylan reaction solution without recombinant enzyme XynAES; Lane 3, reaction solution containing recombinant enzyme XynAES and 1% beech xylan; Lane 4, 1% corncob xylan reaction solution without recombinant enzyme XynAES; Lane 5, reaction solution containing recombinant enzyme XynAES and 1% corncob xylan. DETAILED DESCRIPTION

[0022] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0023] Example 1

[0024] 1. Materials and Methods

[0025] 1.1 Sample collection and metagenomic sequencing

[0026] Soil samples were collected from Aidin Lake, Qiatekale Township, Gaochang District, Turpan City, Xinjiang Uygur Autonomous Region, China, with coordinates: latitude 42.6704. N, longitude 89.2564. E. The collected samples were quickly frozen on dry ice for laboratory metagenomic DNA extraction. DNA was isolated using a metagenomic extraction kit (MOBIO dnasy PowerSoil Kit, USA) according to the operating manual. HiSeq 2500GENWI instrument was used for metagenomic sequencing. De novo assembly was performed using the elvet assembler version (Zerbino & Birney, 2008). The IMG website https: / / img.jgi.doe.gov / cgi-bin / mer / main.cgi was used for sequence query and analysis. The potential functions of individual genes and open reading frames (ORFs) were analyzed using the COG (Tatusov, 2001), KEGG (Nakaya et al., 2012), and Pfam (Finn et al., 2007) databases.

[0027] 1.2 Xylanase sequence prediction, gene synthesis and sequence analysis

[0028] Based on functional prediction, a new functional gene sequence with xylanase (named xynaes) was screened from the Aidin Lake metagenomic database. The nucleotide sequence of the xylanase gene (xynaes) has been uploaded to the GenBank accession number. BLASTx and BLASTp programs (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) were used for alignment with the DNA and protein sequence information of xynaes, respectively. SignalP (http: / / www.cbs.dtu.dk / Services / SignalP / ) was used to predict signal peptides. EXPASY (http: / / web.expasy.org / protparam / ) was used to infer and analyze the primary structure of the amino acid sequence. MEGA 11 software was used for phylogenetic analysis of the xylanase gene (xynaes), and the phylogenetic tree was constructed using the maximum likelihood (ML) method with a Poisson regression model.

[0029] Sequence analysis results of XynAES

[0030] A similar search for xylanase in the total sequence revealed a new candidate xylanase gene sequence, named xynaes. Nucleotide sequence analysis of the xynaes gene revealed an ORF length of 1095 bp encoding a xylanase protein of 364 amino acid residues, with no signal peptide sequence found.

[0031] The DNA sequence of the xylanase gene (1095 bp) is shown in SEQ ID NO: 1;

[0032]

[0033] The amino acid sequence of xylanase XynASE (364 residues) is shown in SEQ ID NO: 2;

[0034] MWSGCNQASEAPPEKEEIPVLKEVFKDAFLIGAALNRSQISGEDVHGVELVKRQYNTITPENILKWENVHPEPDRYDFEAADRYVQFGEENGMFIVGHTLVWHNQTPDWVFLDDDGNRLEREGLLERMREHIHTVVGRYKGRIHGWDVVNEALNDDGSLRQTRWLETIGDDYISKAFEFAREA DPDAELYYNDYSLENPEKRNGAVELIQKLQNDGVPVTGVGTQGHFSLDWPSLEEVEATITAFADLGIDVMVTELDIDVLPPVSEGQGADISFNTEPADSLNPYTGGLPDSVQQTLAQRYKDLFGIYNKHHDVIKRITFWGVSDGDSWKNNWPVRGRTNYPLLFDRNHQPKPAFYSVIEIPE-;

[0035] The theoretical molecular size of the recombinant protein XynAES is 41.50 kDa, and the theoretical pI is 4.64. The amino acid sequence of XynAES has 74.45%, 67.94%, 64.07% and 66.67% homology with other xylanases, respectively, which are endo-1,4-beta-xylanase from Balneolaceae bacteriu (NCBI accession NO.:MDX1641403.1); endo-1,4-beta-xylanase from Blastocatellia bacterium (NCBI accession NO.:HST22061.1); 1,4-beta-xylanase from Rhodothermaceae bacteriumRA (NCBI accession NO.:ARA95075.1) and endo-1,4-beta-xylanase from Balneolaceae bacterium ANBcel3 (NCBI accession NO.:MDI6400537.1). Phylogenetic analysis of the protein sequence showed that XynAES clustered with endo-1,4-beta-xylanase from Balneolaceae bacteria. Figure 1 )

[0036] 1.3 Plasmids and expression vectors

[0037] Escherichia coli DH5α was used for cloning and expression of xylanase genes. The plasmid pSHY211 constructed in the laboratory was used. This plasmid is a constitutive expression plasmid constructed by adding a DNA fragment containing the promoter of the GH11 endoxylanase gene (Yin et al., 2023) using pET28a as a template. pSHY211-xynaes was used for heterologous expression of xylanase genes. Escherichia coli was grown in LB medium containing 50 μg / mL kanamycin. DNA isolation and purification kits were purchased from Sangon (China).

[0038] 1.4 Cloning, expression and purification of xynaes genes

[0039] Design primers based on nucleotide sequences:

[0040] xynaes-F: CAAATGGGTCGCGGATCCGAA ATGTGGTCAGGATGCAATCAAG, as shown in SEQ ID NO: 3;

[0041] xynaes-R: GTGCTCGAGTGCGGCCGCAAG TTATTCAGGAATTTCAAT TACAG, as shown in SEQ ID NO: 4;

[0042] The full-length xylanase gene was amplified.

[0043] The underlined sequence represents the homologous recombination fragment of the pSHY211 vector digested with EcoRI and HindIII. PCR was performed by TransStarFastPfu DNA polymerase (TransGenBiotech, China). The PCR program included: 95℃ pre-denaturation for 3min, 98℃ for 20s, 68℃ annealing for 2.5min for a total of 10 cycles; then 98℃ for 20s, 55℃ for 30s, and 72℃ for 2.5min for a total of 29 cycles, and finally extension at 72℃ for another 10min. The PCR product was inserted into pSHY211 using the pEASY-Uni Cloning and Assembly Kit (TransGenBiotech, China) to obtain the expression plasmid pSHY211-xynaes. Overnight cultures of E. coli (DH5α) cells (Thermo Fisher Scientific, Shanghai, China) containing the recombinant plasmid (pSHY211-xynaes) were prepared. The recombinant E. coli DH5α was combined with pSHY211-xynaes and cultured in 200 mL LB broth containing 50 μg / mL kanamycin at 37°C, 180 rpm, with shaking for 8 h, and at 25°C, 180 rpm, with shaking for 12 h. The cells were collected by centrifugation and the cell lysate was collected after ultrasonic disruption. After centrifugation at 12000×g, 4°C, 20 min, the cell-free extract was purified using a Ni-chelating affinity column (Histrap, TransGen Biotech, China) according to the method previously reported by Yin et al (2017) (Yin YR, Meng ZH, Hu QW 2017). The purified protein was detected by 12% SDS-PAGE. The protein concentration was determined using a Bradford protein assay kit (Order NO. C503031, Sangon Biotech, China), with bovine serum albumin as the standard.

[0044] SDS-PAGE gel (SDS polyacrylamide gel) protein analysis results

[0045] Xylanase activity and sequencing results proved that the gene was successfully cloned into pHY211 C-His. As a His-tag fusion protein, XynAES was separated and purified by Ni-NTA affinity chromatography. The purified protein was analyzed by SDS-PAGE electrophoresis zymogram and stained with Coomassie Brilliant Blue. The results are as follows Figure 2 As shown, there is an obvious single band at 44 kDa in the third lane, indicating that the enzyme has been successfully separated and the size is close to the theoretical value. It is preliminarily judged that the band is a recombinant protein product.

[0046] 1.5 Determination of enzymatic properties of xylanase

[0047] Using beechwood xylan (Sigma, USA) as substrate, the activity of recombinant XynAES was measured by a microplate reader at 540 nm (Yin et al., 2016). Reducing sugars were measured by the DNS (3,5-dinitrosalicylic acid) method with xylose as the standard (Miller, 1959). One unit (U) of XynAES activity is the amount of enzyme that releases 1 μmol of reducing sugar per minute under optimal reaction conditions with 1% optimal xylan as substrate.

[0048] 1.5.1 Effects of temperature and pH on xylanase activity

[0049] 1% beechwood xylan was prepared in citric acid-sodium hydrogen phosphate buffer (pH 3.0-8.0) and glycine-sodium hydroxide buffer (pH 8.0-10.0), and the pH value of the recombinant xylanase was determined. The optimal temperature of XynAES was determined by measuring the activity of XynAES at different temperatures (20-80°C) and optimal pH. In order to evaluate the thermal and pH stability of XynAES, the purified XynAES was incubated at different temperatures (60, 65 and 70°C) for different times (0, 20, 40, 60, 80, 100 and 120 min) and different pH (4, 5, 6, 7, 8, 9, 10, 11) for different times (12 and 24 h), and the residual xylanase activity was measured.

[0050] Effects of temperature and pH on XynAES activity

[0051] The optimal reaction temperature for XynAES activity is 65°C, and at 55-70°C, more than 90% relative activity is maintained ( Figure 3 A). The optimum pH for XynAES activity is 8.0, and the relative activity remains above 65% between pH 6-9.0 ( Figure 3 B). Thermal stability analysis showed that Figure 3 As shown in Figure C, XynAES still has 20% activity after heat treatment at 60°C for 2 hours, 55% activity after endurance at 65°C for 2 hours, and about 50% activity after incubation at 70°C for 2 hours. pH stability analysis shows that Figure 3 As shown in Figure 4, after incubation at 4°C for 12 h, it retained more than 60% of the relative activity at pH 5-10 and more than 80% of the relative activity at pH 6-9. After incubation at 4°C for 24 h, it retained more than 60% of the relative activity at pH 6-10 and more than 80% of the relative activity at pH 6-9.

[0052] 1.5.2 Effects of metal ions and chemical reagents on enzymes

[0053] In order to evaluate the effects of metal ions and chemical reagents on the activity of XynAES, 10 mM and 1 mM of various metal ions were added to the reaction system: KCl, MgSO4, FeCl3, CaCl2, NiSO4, CoCl2, BaCl2, MnCl2, AgNO3, Pb(NO3)2, CuSO4, ZnSO4 and AlCl3; 1% of chemical reagents: SDS, Urea, MeOH (methanol) Tween 80, EDTA (ethylenediaminetetraacetic acid), DTT (Deloitte Touche Tohmatsu), PMSF (phenylmethylsulfonyl fluoride), β-Me (β-mercaptoethanol), IPA (isopropyl alcohol). The control was measured using the same process as above, without any additives in the reaction mixture.

[0054] Effects of metal ions and chemical reagents on enzyme activity

[0055] The effects of different metal ions and inhibitors on the enzymatic activity of xylanase XynAES are shown in Table 1. 2+ Activation, at 1mM and 10mM, was activated to 113.99±3.75% and 130.77±1.39%, respectively. 2+ and Co 2+ Except for the obvious inhibition of XynAES activity, the other ions activated it or had no obvious effect on the activity. 2+ , Pb 2+ , Fe 3+ Except for the obvious activation, the others showed different degrees of inhibition. 2+ and Ag + Most of the activity was lost under the action of 10mM Co 2+ and Ni 2+ XynAES completely lost its activity. At a concentration of 0.1%, Meth, Tween 80 and β-ME had no effect on the enzyme activity, while EDTA, IPA, Urea and PMSF activated the enzyme activity. XynAES lost 63.09% and 36.52% of its activity under the action of PMSF and β-ME at a concentration of 1%, and was directly inactivated by SDS.

[0056] Table 1 Effects of metal ions, inhibitors, surfactants and organic solvents on the activity of XynAES.

[0057]

[0058]

[0059] Note: The activity of the control group (no additive) is 100%. Each value represents the mean ± SD. "*" indicates that the experimental group is significantly different from the control group (P < 0.05). "**" indicates that the experimental group is extremely significantly different from the control group (P < 0.01).

[0060] 1.5.3 Effect of NaCl on XynAES activity

[0061] On the one hand, the application of seawater for pretreatment in the lignocellulose processing industry is efficient and economical, so the tolerance of xylanase to NaCl affects its application in industry. On the other hand, XynAES is derived from the salt lake metagenome and has the potential to be highly tolerant to NaCl. Based on the above reasons, the effect of NaCl on the activity of XynAES was determined. 0-5.0 mol / L NaCl was added to the standard reaction system, and the experimental group without NaCl was used as the control to evaluate the effect of NaCl on the activity of XynAES.

[0062] Results of NaCl tolerance test of recombinant xylanase XynAES

[0063] like Figure 4 The XynAES showed a certain salt tolerance. The xylanase activity decreased with the increase of salt concentration, but maintained about 60% activity in 0-3.0M NaCl. XynAES was derived from Aiding Lake in Xinjiang, which is an alkaline and high-salt environment. Figure 4 )

[0064] 1.5.4 Substrate specificity determination

[0065] To determine the substrate specificity of the XynAES enzyme, 1% beech xylan, microcrystalline cellulose, corncob xylan, bagasse xylan, sodium carboxymethyl cellulose and cellobiose were used as substrates and beech xylan was used as a reference to determine the degradation percentage.

[0066] Substrate specificity test results

[0067] As shown in Table 2, the recombinant enzyme XynAES had the highest activity against beechwood xylan (100±4.53 U / mg), followed by bagasse xylan (87.06±4.78 U / mg), and then corncob xylan (68.83±2.07 U / mg), and had no activity against sodium carboxymethyl cellulose (CMC-Na), cellobiose, and Avicel cellulose.

[0068] Table 2 Substrate specificity of XynAES

[0070]

[0071] Note: All substrates were tested at 1% (w / v). The results are expressed as mean±SD, where different letters indicate significant differences at the P≤0.05 significance level, 100%=63.08 U / mg protein.

[0072] 1.5.5 Determination of kinetic constants

[0073] In order to determine the kinetic parameters of xylanase XynAES, different concentrations of beech xylan (0.2 mg / mL, 0.4 mg / mL, 0.6 mg / mL, 0.8 mg / mL, 1 mg / mL, 1.2 mg / mL, 1.4 mg / mL, 1.6 mg / mL, 1.8 mg / mL, 2 mg / mL) were used as substrates for reactions for 5 min and 10 min respectively. The Lineweaver-Burk plot was used to calculate the Vmax and Km of xylanase for beech xylan.

[0074] Determination results of kinetic constants

[0075] From Table 3, we can know that the optimal substrate of XynAES is beechwood xylan, the optimal temperature and pH are 65℃ and pH 8.0, the enzyme activity is 63.08U / mg, Km is 3.23mg / mL, Vmax is high at 72.46μmol / min / mg, the theoretical molecular mass and pI of XynAES are 41.50kDa and 4.64. The catalytic efficiency (Km / Kcat) of XynAES is 15.52mL / s / mg. Table 3 Kinetic parameters of XynAE

[0076]

[0077]

[0078] 1.6 Determination of hydrolysis products by thin layer chromatography

[0079] The reaction mixture consisting of 1% beech xylan and 10 μg purified enzyme was incubated at 65°C for 2 h. The beech xylan hydrolysate was characterized by thin layer chromatography (TLC) using silica gel 60 plates (Merck, Darmstadt, Germany) with 1-butanol / acetic acid / water (2:1:1, v / v / v). Reducing sugar components were detected after spraying with freshly prepared 5% (v / v) H2SO4 ethanol and treating at 120°C for 10 min. The reducing sugar standards were xylobiose (X2), xylotriose (X3), and xylotetrose (X4).

[0080] Hydrolysis product analysis results

[0081] pass Figure 5 It can be seen that the hydrolysis products of the recombinant xylan XynAES for xylans from two different sources are the same, and the final hydrolysis products are only disaccharides and tetrasaccharides.

[0082] 1.7 Statistical analysis

[0083] Microsoft Excel 2010 was used for data entry and processing, SPSS 21.0 was used for statistical analysis, and the data were analyzed using one-way analysis of variance (ANOVA) with Duncan's multiple comparison test (see Table 4).

[0084] Table 4 Biochemical properties of GH10 xylanase

[0085]

[0086]

[0087] In recent years, reports have shown that alkali-resistant xylanases in the GH10 family are less than acid-resistant and neutral xylanases. For example, the optimum pH values ​​of XylR, BaXyn10 and XynD25 are 5.0-6.5, 7 and 7.5, respectively, which are all in the acidic or neutral range. XynAES, however, maintains high activity in an alkaline environment, which provides possibilities for special industrial production and enriches the reserve of enzyme resources. Thermal stability analysis shows that Figure 3 As shown in Figure C, XynAES still maintains 80% activity after heat treatment at 60℃ for 2h, 50% activity after endurance at 65℃ for 2h, and about 20% activity after incubation at 70℃ for 2h. This shows that XynAES not only has high activity at high temperature but also can work for a long time. pH stability analysis shows that Figure 3As shown in D, after incubation at 4°C for 12h, it retained more than 60% of the relative activity at pH 5-10 and more than 80% of the relative activity at pH 6-9. After incubation at 4°C for 24h, it retained more than 60% of the relative activity at pH 6-10 and more than 80% of the relative activity at pH 6-9. The above characteristics provide many possibilities for the industrial application of XynAES. XynAES and the xylem recombinase XynSL3 cloned from the alkaliphilic bacterium Alkalibacterium sp.SL3 isolated from the sediments of Lake Dabusu (Wang et al. 2017) show very similar enzymatic properties. Both have strong tolerance to NaCl and are tolerant to alkaline environments, which may be related to their similar sources. XynAES comes from Aiding Lake in Xinjiang, which is an alkaline and high-salt environment. XynSL3 also comes from a saline-alkali environment. It also shows similar salt tolerance to other salt environments such as marine-derived xylanase XynB (Bing Guo et al 2013.); XynB still maintains 40% activity under 4.0M NaCl tolerance. The above reports indicate that salt lakes may contain abundant salt-tolerant xylanase genes, which also provides ideas for mining xylanases adapted to high-salt industrial production. XynAES activity is activated by Mn2+, and is activated to 113.99±3.75% and 130.77±1.39% at 1mM and 10mM, respectively. This is similar to the activation of other xylanases by Mn2+, such as CrXyn (Linli, 2022) and xylanase from Flavobacteriumjohnsoniae (S.Chen, 2013), which may be due to Mn2+ interacting with key amino acid residues in the enzyme by binding to the active center or as a cofactor (S.Chen, 2013). However, 10mM Co2+ and Ni2+ completely deactivate XynAES. These metal ions may inhibit enzymatic reactions by binding to the active groups of the enzyme, causing oxidative stress and protein damage, or reacting with the enzyme-substrate complex (S. Hemida, 1997 and S. Gu, 2021). Therefore, contact with Co2+ and Ni2+ should be avoided when using XynAES. At a concentration of 0.1%, Meth, Tween 80 and β-ME had no effect on enzyme activity, while EDTA, IPA, Urea and PMSF activated enzyme activity, which is beneficial for industrial production. In addition, like most enzymes, XynAES is highly inhibited by SDS, which is an anionic detergent that can cause strong protein denaturation (Wang et al. 2017). Under the action of PMSF and β-ME at a concentration of 1%, XynAES lost 63.09% and 36.52% of its activity and was directly inactivated by SDS.High concentrations of PMSF, β-ME and SDS should be avoided in the production and use of XynAES. The optimal substrate of XynAES is beechwood xylan, with a specific activity of 63.08U / mg and a Km of 3.23mg / mL, which indicates that XynAES has good substrate affinity, a high Vmax of 72.46μmol / min / mg, and a catalytic efficiency (Kcat / Km) of 15.52ml / s / mg, which is significantly superior to other xylanases in the GH10 family, such as XylR (Pavarina et al, 2021) of 2.23ml / s / mg and XynDZ5 (Zarafeta et al, 2020) of 1.44ml / s / mg. Higher catalytic efficiency provides more possibilities for actual production. The hydrolysis products of recombinant xylan XynAES for xylans from two different sources are the same, and the final hydrolysis products are only disaccharides and tetrasaccharides. This indicates that the enzyme is a strict endo-xylanase and is rarely affected by xylan branches. Fixed hydrolysates facilitate the production of prebiotics using oligoxylose, which is beneficial to the growth of probiotics and the balance of microorganisms in the body. According to the results, the hydrolysis products of various xylans are consistent, which is consistent with the research results that GH10 xylanase is less affected by xylan branches (Mauro, et al, 2023). However, the hydrolysis products of beech xylan are more obvious, which is the same as the higher activity of XynAES on beech xylan. Such xylanases with clear hydrolysis products provide more certain possibilities for their industrial applications.

[0088] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A salt-tolerant xylanase, characterized in that The amino acid sequence of the salt-tolerant xylanase is shown in SEQ ID NO:

1.

2. A DNA molecule encoding the salt-tolerant xylanase according to claim 1, characterized in that: The nucleotide sequence of the DNA molecule is shown in SEQ ID NO:

2.

3. A recombinant vector, characterized in that: The recombinant vector comprises the DNA molecule of claim 2 and a regulatory sequence for expression operably linked to the DNA molecule.

4. A host cell, characterized in that The host cell comprises the DNA molecule according to claim 2 or the recombinant vector according to claim 3.

5. Use of the salt-tolerant xylanase according to claim 1 in degrading cellulose.

Images