Double-stranded RNA composition for regulating expression of angiotensinogen AGT and application of double-stranded RNA composition

Abstract

The invention relates to siRNA (small interfering Ribonucleic Acid) for regulating expression of angiotensinogen AGT, a conjugate and a pharmaceutical composition of the siRNA and application of the siRNA. The siRNA comprises a positive-sense strand and an antisense strand, each nucleotide in the siRNA is independently modified or unmodified nucleotide, the positive-sense strand contains a nucleotide sequence I, the antisense strand contains a nucleotide sequence II, and the nucleotide sequence I and the nucleotide sequence II are at least partially reversely complementary to form a double-strand region. The siRNA, the conjugate thereof and the pharmaceutical composition provided by the invention can effectively regulate the expression of angiotensinogen AGT.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a siRNA for regulating the expression of angiotensinogen AGT, a conjugate and a pharmaceutical composition thereof, and uses thereof. Background Art

[0002] Hypertension is one of the most important risk factors for cardiovascular and cerebrovascular diseases. Long-term hypertension will cause multiple target organ damage diseases in the human body, such as coronary heart disease, heart failure, stroke, peripheral vascular disease and kidney damage, which are more harmful than hypertension itself. Therefore, effective control of blood pressure is the key to preventing and treating hypertension and target organ damage. Recent studies have shown that in the past 30 years, the number of adults with hypertension aged 30-79 has increased from 650 million to 1.28 billion. Nearly half of them do not know that they have hypertension. According to the "China Cardiovascular Health and Disease Report 2019" released by the National Center for Cardiovascular Diseases, there are 245 million adult hypertensive patients in my country, of which more than half have dyslipidemia. The coexistence of the two can accelerate the process of atherosclerosis and significantly increase the risk of cardiovascular disease. Therefore, the research on antihypertensive drugs has huge market potential and development prospects.

[0003] The renin-angiotensin-aldosterone system (RAAS) is a hormone cascade that plays a role in blood pressure regulation, and its inhibition has a recognized antihypertensive effect. Angiotensinogen (AGT) is the most upstream precursor protein in the RAAS pathway and is a protein specifically expressed in the liver. Many studies have revealed that great progress has been made in the molecular mechanism and clinical relevance of AGT with hypertension and atherosclerosis, making it a target for the treatment of cardiovascular diseases.

[0004] RNA interference (RNAi) is a method of sequence-specific degradation of RNA and post-transcriptional regulation of gene expression levels. In naturally occurring RNAi, double-stranded RNA (dsRNA) is cleaved into small interfering RNA (siRNA) by the Dicer enzyme. The siRNA is unzipped into sense and antisense strands by the action of RNA helicases in cells. Subsequently, the antisense siRNA binds to some enzymes in the body (including endonucleases, exonucleases, helicases, etc.) to form an RNA-induced silencing complex (RISC). RISC specifically binds to the homologous region of the mRNA expressed by exogenous genes. RISC has the function of a nuclease and cuts the mRNA at the binding site. The broken mRNA is then degraded, thereby inducing a degradation reaction of the host cell against these mRNAs. siRNA was first discovered by David Baulcombe's team in the UK and is part of the post-transcriptional gene silencing (PTGS) phenomenon in plants. In 2001, Thomas Tuschl's team discovered that synthetic siRNA can induce RNAi in mammals.

[0005] At present, there are four main types of drugs for the treatment of hypertension: 1). Diuretics: Thiazides are the most commonly used, and hydrochlorothiazide is commonly used. The main adverse reactions are hypokalemia and the effects on blood lipids, blood sugar, and blood uric acid metabolism. Others include fatigue, increased urine volume, etc., and gout patients are prohibited from using them. 2). β-receptor antagonists: Suitable for patients with different degrees of hypertension, especially middle-aged and young patients with faster heart rates or those with angina pectoris and chronic heart failure. The efficacy for elderly hypertension is relatively poor. 3). Calcium channel blockers: They have a good antihypertensive effect on elderly patients and also have a significant antihypertensive effect on alcoholics. They can be used for patients with diabetes, coronary heart disease or peripheral vascular disease; long-term treatment also has an anti-atherosclerotic effect. 4). Angiotensin converting enzyme inhibitors and angiotensin II receptor antagonists: Especially suitable for hypertensive patients with heart failure, myocardial infarction, atrial fibrillation, proteinuria, impaired glucose tolerance or diabetic nephropathy.

[0006] Treatment of hypertension requires long-term maintenance treatment, and treatment cannot be stopped at will or the treatment plan cannot be changed frequently. After stopping antihypertensive drugs, most patients return to their original blood pressure levels within half a year. Due to the long-term nature of antihypertensive treatment, patient compliance is very important. At present, the marketed drugs for hypertension-related diseases are mainly small molecule drugs. There are two nucleic acid drugs targeting AGT in clinical phase II trials, namely Alnylam's siRNA drug and Ionis' antisense oligonucleotide drug (ASO drug). Currently, the marketed drugs need to be taken daily, the duration of efficacy is short, and patient compliance is poor; and most drugs are accompanied by varying degrees of side effects; some patients still cannot control blood pressure well after taking them in combination. The two nucleic acid drugs currently undergoing clinical trials have high dosages and there is still room for improvement in efficacy. Obviously, these drugs cannot meet the existing clinical needs, so new drugs for the treatment of such diseases are becoming more and more urgent. At present, RNAi, as a highly efficient and sequence-specific gene silencing technology, is developing rapidly in multiple disease treatment fields (see references 1-2). Summary of the invention

[0007] In view of this, the present invention provides a method and compound for regulating the expression of angiotensinogen AGT mRNA and protein, by binding to AGT mRNA through a specific double-stranded RNA composition, inhibiting the translation of mRNA, thereby inhibiting the expression of AGT protein. The siRNA composition can maintain a longer half-life under a specific delivery vector, thereby prolonging the drug effect time, which will bring safer and longer-lasting treatment methods for diseases related to hypertension.

[0008] Based on the above purpose, the present invention provides an siRNA, comprising a sense strand and an antisense strand, wherein each nucleotide in the siRNA is independently a modified or unmodified nucleotide, wherein the sense strand contains a nucleotide sequence I, and the antisense strand contains a nucleotide sequence II, and the nucleotide sequence I and the nucleotide sequence II are at least partially reverse-complemented to form a double-stranded region, wherein the nucleotide sequence I and the nucleotide sequence II are selected from the following sequences:

[0009] (1) The nucleotide sequence I comprises the nucleotide sequence shown in SEQ ID NO: 1, and the nucleotide sequence II comprises the nucleotide sequence shown in SEQ ID NO: 33:

[0010] 5'-UCAACUGGAUGAAGAAACA-3'(SEQ ID NO:1)

[0011] 5'-UGUUUCUUCCAGUUGA-3' (SEQ ID NO: 33).

[0012] In one embodiment, the nucleotide sequence I and the nucleotide sequence II are substantially reverse complementary, essentially reverse complementary or completely reverse complementary; the substantially reverse complementary means that there are no more than 3 base mismatches between the two nucleotide sequences; the substantially reverse complementary means that there are no more than 1 base mismatch between the two nucleotide sequences; the completely reverse complementary means that there is no mismatch between the two nucleotide sequences.

[0013] In one embodiment, the sense strand further contains a nucleotide sequence III, and the antisense strand further contains a nucleotide sequence IV, and the lengths of the nucleotide sequence III and the nucleotide sequence IV are each independently 0 to 4 nucleotides, wherein the nucleotide sequence III is connected to the 5' end of the nucleotide sequence I, and the nucleotide sequence IV is connected to the 3' end of the nucleotide sequence II, and the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary; the substantially reverse complementary means that there is no more than 1 base mismatch between the two nucleotide sequences; the completely reverse complementary means that there is no mismatch between the two nucleotide sequences; and / or, the nucleotide sequence III is connected to the 3' end of the nucleotide sequence I, and the nucleotide sequence IV is connected to the 5' end of the nucleotide sequence II, and the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary; the substantially reverse complementary means that there is no more than 1 base mismatch between the two nucleotide sequences; the completely reverse complementary means that there is no mismatch between the two nucleotide sequences.

[0014] In one embodiment, the sense strand further contains a nucleotide sequence V and / or the antisense strand further contains a nucleotide sequence VI, the length of the nucleotide sequences V and VI is 0 to 4 nucleotides, the nucleotide sequence V is connected to the 3' end of the sense strand to form the 3' overhang of the sense strand and / or the nucleotide sequence VI is connected to the 3' end of the antisense strand to form the 3' overhang of the antisense strand. In a preferred embodiment, the length of the nucleotide sequence V or VI is 2 nucleotides. In a preferred embodiment, the base of the nucleotide sequence V or VI is two consecutive guanines or two consecutive uracils. In a preferred embodiment, the nucleotide sequence V or VI is mismatched or complementary to the nucleotides at the corresponding positions of the target mRNA.

[0015] In one embodiment, at least one nucleotide in the sense strand or the antisense strand is a modified nucleotide, and / or at least one phosphate group is a phosphate group with a modified group; preferably, the phosphate group with a modified group is a thiophosphate group formed by replacing at least one oxygen atom in the phosphodiester bond in the phosphate group with a sulfur atom.

[0016] In one embodiment, the 5' terminal nucleotide of the sense strand is linked to a 5' phosphate group or a 5' phosphate-derivative group, and / or the 5' terminal nucleotide of the antisense strand is linked to a 5' phosphate group or a 5' phosphate-derivative group.

[0017] In one embodiment, the modified nucleotides are selected from 2'-fluoro-modified nucleotides, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, nucleotide analogs or a combination of any two or more thereof.

[0018] In one embodiment, the modified nucleotide is selected from 2'-fluoro modified nucleotides, 2'-methoxy modified nucleotides, 2'-O-CH 2 -CH 2 -O-CH 3 Modified nucleotides, 2'-O-CH 2 -CH=CH 2 Modified nucleotides, 2'-CH 2 -CH 2 -CH=CH 2 Modified nucleotides, 2'-deoxynucleotides, nucleotide analogs or a combination of any two or more thereof.

[0019] In one embodiment, each nucleotide in the sense strand and the antisense strand is independently a 2'-fluoro-modified nucleotide or a non-fluoro-modified nucleotide. In a preferred embodiment, from 5' to 3', the 2'-fluoro-modified nucleotides are located at positions 7, 8 and 9 of the sense strand, and the remaining positions are non-fluoro-modified nucleotides; from 5' to 3', the 2'-fluoro-modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are non-fluoro-modified nucleotides.

[0020] In some embodiments, at least one of the following linkages between nucleotides in the siRNA is a phosphorothioate linkage:

[0021] The connection between the first nucleotide and the second nucleotide at the 5' end of the sense strand;

[0022] The connection between the second nucleotide and the third nucleotide at the 5' end of the sense strand;

[0023] The connection between the first nucleotide and the second nucleotide at the 3' end of the sense strand;

[0024] The connection between the second nucleotide and the third nucleotide at the 3' end of the sense strand;

[0025] The connection between the first nucleotide and the second nucleotide at the 5' end of the antisense strand;

[0026] The connection between the second nucleotide and the third nucleotide at the 5' end of the antisense strand;

[0027] The connection between the first nucleotide and the second nucleotide at the 3' end of the antisense strand;

[0028] The connection between the second nucleotide and the third nucleotide at the 3' end of the antisense strand.

[0029] In some embodiments, the sense strand comprises phosphorothioate groups at the positions shown below in the 5' to 3' direction:

[0030] Between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand;

[0031] Between the second nucleotide and the third nucleotide starting from the 5' end of the sense strand;

[0032] Between the first nucleotide and the second nucleotide starting from the 3' end of the sense strand;

[0033] Between the second nucleotide and the third nucleotide starting from the 3' end of the sense strand;

[0034] or,

[0035] The sense strand contains phosphorothioate groups located at the positions shown below:

[0036] Between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand;

[0037] The positive strand is located between the second nucleotide and the third nucleotide starting from the 5' end.

[0038] In some embodiments, the antisense strand comprises phosphorothioate groups at the positions shown below in the 5' to 3' direction:

[0039] Between the first nucleotide and the second nucleotide starting from the 5' end of the antisense strand;

[0040] Between the second nucleotide and the third nucleotide starting from the 5' end of the antisense strand;

[0041] Between the first nucleotide and the second nucleotide starting from the 3' end of the antisense strand;

[0042] The antisense strand is located between the second nucleotide and the third nucleotide starting from the 3' end.

[0043] In one embodiment, each non-fluorinated modified nucleotide is independently selected from a nucleotide or nucleotide analogue formed by replacing the hydroxyl group at the 2' position of the ribose group of the nucleotide with a non-fluorinated group, and the nucleotide analogue is selected from one of isonucleotides, LNA, ENA, cET BNA, UNA, GNA and SAFE-01.

[0044] In one embodiment, each nucleotide in the sense strand and the antisense strand is independently a 2'-fluoro-modified nucleotide, a 2'-methoxy-modified nucleotide, a SAFE-01-modified nucleotide, or a combination of any two or more thereof. In a preferred embodiment, from 5' to 3', the 2'-fluoro-modified nucleotides are located at positions 7, 8, and 9 of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides; from 5' to 3', the 2'-fluoro-modified nucleotides may be located at positions 2, 6, 14, and 16 of the antisense strand, SAFE-01 may be located at positions 6 or 7 of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides.

[0045] In a specific embodiment, the siRNA of the present invention is selected from the siRNA in Table 1 and Table 2.

[0046] The present invention also provides a siRNA conjugate, which contains the siRNA of the present invention and a conjugation group conjugated to the siRNA.

[0047] In one embodiment, the conjugate group comprises a pharmaceutically acceptable targeting group and a linker, and the siRNA, the linker and the targeting group are sequentially covalently or non-covalently linked.

[0048] In one embodiment, the siRNA conjugate has the following structure:

[0049]

[0050] in, represents a duplex formed by the siRNA of the present disclosure;

[0051] X is O or S.

[0052] The present invention also provides a pharmaceutical composition, which comprises the siRNA of the present invention, or the siRNA conjugate of the present invention, and a pharmaceutically acceptable carrier.

[0053] The present invention also provides a kit comprising the siRNA of the present invention, or the siRNA conjugate of the present invention, or the pharmaceutical composition of the present invention.

[0054] The present invention also provides use of the siRNA of the present invention, or the siRNA conjugate of the present invention, or the pharmaceutical composition of the present invention for preparing a medicament for regulating the expression of angiotensinogen AGT.

[0055] The present invention also provides use of the siRNA of the present invention, or the siRNA conjugate of the present invention, or the pharmaceutical composition of the present invention for preparing a medicament for treating and / or preventing diseases associated with angiotensinogen AGT expression.

[0056] In a specific embodiment, the diseases associated with the expression of angiotensinogen AGT include critical hypertension, essential hypertension, secondary hypertension, isolated systolic or diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt's hypertension, hypertension associated with low plasma renin activity or plasma renin concentration, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension; hypertensive heart disease, hypertensive Kidney disease, atherosclerosis, arteriosclerosis, vascular disease, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, nocturnal hypertension, glomerulosclerosis, aortic coarctation, aortic aneurysm, ventricular fibrosis, heart failure, myocardial infarction, angina pectoris, stroke, kidney disease, renal failure, systemic sclerosis, intrauterine growth retardation (IUGR), fetal growth restriction, obesity, hepatic steatosis / fatty liver, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD); glucose intolerance, type 2 diabetes and metabolic syndrome.

[0057] The present invention also provides a method for regulating the expression of angiotensinogen AGT, comprising contacting a therapeutically effective amount of the siRNA of the present invention, or the siRNA conjugate of the present invention, or the pharmaceutical composition of the present invention with cells expressing angiotensinogen AGT or administering it to a subject in need thereof.

[0058] The present invention also provides a method for treating and / or preventing diseases associated with angiotensinogen AGT expression, comprising administering a therapeutically effective amount of the siRNA of the present invention, or the siRNA conjugate of the present invention, or the pharmaceutical composition of the present invention to a subject in need thereof.

[0059] The beneficial effects of the present invention are:

[0060] The siRNA, siRNA conjugate and pharmaceutical composition provided by the present invention show excellent angiotensinogen AGT expression inhibition activity in cell experiments and animal experiments, and have good potential for treating diseases associated with angiotensinogen AGT expression. The siRNA, siRNA conjugate and pharmaceutical composition of the present invention have good tissue specificity and high safety; long duration of efficacy and high medication compliance; compared with existing drugs of the same type, both efficacy and safety are greatly improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 This is the remaining expression level of mouse serum SEAP-AGT after using the test conjugate of the present invention in Example 4. DETAILED DESCRIPTION

[0062] It should be noted that, unless otherwise defined, the technical terms or scientific terms used in this application should have the common meanings understood by technicians in the relevant field.

[0063] The experimental methods in the following examples are conventional methods unless otherwise specified. The medicinal materials, reagents, etc. used in the following examples are commercially available products unless otherwise specified.

[0064] definition

[0065] In the above and below, unless otherwise specified, capital letters C, G, U, and A represent the base composition of nucleotides; lowercase letter m represents that the nucleotide adjacent to the left of letter m is a 2'-methoxy-modified nucleotide; lowercase letter f represents that the nucleotide adjacent to the left of letter f is a 2'-fluoro-modified nucleotide; lowercase letter s represents that the two nucleotides adjacent to the left and right of letter s are connected by thiophosphate groups; L96 represents N-[tri(GalNAc-alkyl)-amidedecanoyl]]-4-hydroxyprolinol-(GalNAc-alkyl).

[0066] In the above and below, the "2'-fluoro modified nucleotide" refers to a nucleotide in which the hydroxyl group at the 2' position of the ribose group of the nucleotide is replaced by fluorine, and the "non-fluorinated modified nucleotide" refers to a nucleotide or nucleotide analog in which the hydroxyl group at the 2' position of the ribose group of the nucleotide is replaced by a non-fluorinated group. In some embodiments, each non-fluorinated modified nucleotide is independently selected from one of the nucleotides or nucleotide analogs in which the hydroxyl group at the 2' position of the ribose group of the nucleotide is replaced by a non-fluorinated group. The nucleotides formed by the hydroxyl group at the 2' position of these ribose groups being replaced by non-fluorinated groups are well known to those skilled in the art, and these nucleotides can be selected from one of 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'-substituted amino modified nucleotides, and 2'-deoxy nucleotides.

[0067] "Alkyl" includes straight chain, branched chain or cyclic saturated alkyl. For example, alkyl includes but is not limited to methyl, ethyl, propyl, cyclopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclobutyl, n-pentyl, cyclohexyl and the like. Exemplary, "C 1-6 The "C" in "alkyl" 1-6 ” refers to a group containing 1, 2, 3, 4, 5 or 6 carbon atoms in a straight chain, branched chain or cyclic form.

[0068] "Alkoxy" refers herein to an alkyl group attached to the remainder of the molecule via an oxygen atom (-O-alkyl), wherein the alkyl group is as defined herein. Non-limiting examples of alkoxy include methoxy, ethoxy, trifluoromethoxy, difluoromethoxy, n-propoxy, isopropoxy, n-butoxy, tert-butoxy, n-pentoxy, and the like.

[0069] "Nucleotide analogs" refer to groups that can replace nucleotides in nucleic acids but have structures different from adenine ribonucleotides, guanine ribonucleotides, cytosine ribonucleotides, uracil ribonucleotides or thymine deoxyribonucleotides, such as isonucleotides, bridged nucleic acids (BNAs) or acyclic nucleotides.

[0070] BNA refers to a constrained or inaccessible nucleotide. BNA may contain a five-membered ring, a six-membered ring, or a seven-membered ring with a "fixed" C3'-endosugar condensed bridge structure. The bridge is usually incorporated into the 2'-, 4'-position of the ribose to provide a 2', 4'-BNA nucleotide, such as LNA, ENA, cET BNA, etc., wherein LNA is shown in formula (1), ENA is shown in formula (2), and cET BNA is shown in formula (3):

[0071]

[0072] Acyclic nucleotides are a type of nucleotides formed by opening the sugar ring of a nucleotide, such as unlocked nucleic acid (UNA) or glycerol nucleic acid (GNA or SAFE-01), wherein UNA is shown in formula (4), GNA is shown in formula (5), and SAFE-01 is shown in formula (6):

[0073]

[0074] In the above formulae (4), (5) and (6), R is selected from H, OH or alkoxy (O-alkyl).

[0075] Isonucleotides refer to compounds formed by a change in the position of the base on the ribose ring of a nucleotide, for example, a compound formed by the base moving from the 1'-position to the 2'-position or the 3'-position of the ribose ring, as shown in formula (7) or (8):

[0076]

[0077] In the compounds of formula (7)-(8) above, Base represents a nucleic acid base, such as A, U, G, C or T; and R is selected from H, OH, F or the non-fluorine group as described above.

[0078] In some embodiments, the nucleotide analog is selected from one of isonucleotides, LNA, ENA, cET, BNA, UNA, GNA and SAFE-01. In some embodiments, each non-fluorinated modified nucleotide is a 2'-methoxy modified nucleotide or a SAFE-01 modified nucleotide. In some preferred embodiments, each non-fluorinated modified nucleotide is a 2'-methoxy modified nucleotide. In the above and below, the 2'-methoxy modified nucleotide refers to a nucleotide formed by replacing the 2'-hydroxyl of the ribose group with a methoxy group.

[0079] In the above and below, the "phosphorothioate group" refers to a phosphorothioate group in which one oxygen atom in the phosphodiester bond in the phosphate group is replaced by a sulfur atom. The "5'-phosphate nucleotide" refers to the structure of the following formula:

[0080]

[0081] In the above and below, the expressions "complementary" or "reverse complementary" are used interchangeably and have the meaning known to those skilled in the art, i.e., in a double-stranded nucleic acid molecule, the bases of one strand are each paired with the bases on the other strand in a complementary manner. In DNA, the purine base adenine (A) is always paired with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) is always paired with the pyrimidine base cytosine (G). Each base pair includes a purine and a pyrimidine. When adenine on one strand is always paired with thymine (or uracil) on the other strand, and guanine is always paired with cytosine, the two strands are considered to be complementary to each other, and the sequence of the strand can be inferred from the sequence of its complementary strand. Correspondingly, "mismatch" means in the art that in a double-stranded nucleic acid, the bases at corresponding positions are not paired in a complementary form.

[0082] In the above and below, unless otherwise specified, "substantially reverse complementary" means that there are no more than 3 base mismatches between the two nucleotide sequences involved; "substantially reverse complementary" means that there are no more than 1 base mismatch between the two nucleotide sequences; and "completely reverse complementary" means that there are no base mismatches between the two nucleotide sequences.

[0083] In the above and below, a "nucleotide difference" exists between a nucleotide sequence and another nucleotide sequence, which means that the base type of the nucleotide at the same position in the former is changed compared with the latter. For example, when a nucleotide base in the latter is A, and the corresponding nucleotide base at the same position in the former is U, C, G or T, it is considered that there is a nucleotide difference at this position between the two nucleotide sequences. In some embodiments, when an abasic nucleotide or its equivalent replaces the nucleotide at the original position, it can also be considered that a nucleotide difference occurs at this position. An abasic nucleotide refers to a monomeric compound formed when the nucleic acid base in the nucleotide is replaced by other groups or hydrogen atoms. The other groups include but are not limited to substituted or unsubstituted aromatic or heteroaromatic groups.

[0084] In the above and below, "overhang" refers to one or more unpaired nucleotides that protrude from the duplex structure of the siRNA when a 3' end of one strand of the siRNA extends beyond the 5' end of the other strand, or vice versa. "Blunt end" or "blunt end" means that there are no unpaired nucleotides at that end of the siRNA, i.e., no nucleotide overhang. A "blunt-ended" siRNA is an siRNA that is double-stranded throughout its length, i.e., has no nucleotide overhangs at either end of the molecule.

[0085] In the above and below, especially when describing the preparation method of siRNA, pharmaceutical composition or siRNA conjugate of the present disclosure, unless otherwise specified, the nucleoside monomer (nucleoside monomer) refers to the modified or unmodified nucleoside phosphoramidite monomer (unmodified or modified RNA phosphoramidites, sometimes RNA phosphoramidites are also referred to as Nucleoside phosphoramidites) used in solid phase phosphoramidite synthesis according to the type and order of nucleotides in the siRNA or siRNA conjugate to be prepared. Solid phase phosphoramidite synthesis is a method used in RNA synthesis known to those skilled in the art. The nucleoside monomers used in the present disclosure are all commercially available.

[0086] In the context of the present disclosure, unless otherwise specified, "conjugation" refers to the connection between two or more chemical moieties, each having a specific function, in a covalently linked manner; accordingly, "conjugate" refers to a compound formed by covalently linking the chemical moieties. Further, "siRNA conjugate" means a compound formed by covalently linking one or more chemical moieties having a specific function to siRNA. siRNA conjugates should be understood as a general term for multiple siRNA conjugates or an siRNA conjugate shown by a certain chemical formula, depending on the context. In the context of the present disclosure, "conjugated molecule" should be understood as a specific compound that can be conjugated to siRNA through a reaction to ultimately form the siRNA conjugate of the present disclosure.

[0087] Various hydroxyl protecting groups can be used in the present disclosure. In general, the protecting group makes the chemical functional group insensitive to specific reaction conditions, and the functional group in the molecule can be added and removed without substantially damaging the rest of the molecule. Representative hydroxyl protecting groups are disclosed in Beaucage et al., Tetrahedron 1992, 48, 2223-2311, and Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2ded, John Wiley & Sons, New York, 1991, and the above-mentioned documents are incorporated herein by reference in their entirety. In some embodiments, the protecting group is stable under alkaline conditions, but can be removed under acidic conditions. In some embodiments, non-exclusive examples of hydroxyl protecting groups that can be used herein include dimethoxytrityl (DMT), monomethoxytrityl, 9-phenyloxanthene-9-yl (Pixyl) and 9-(p-methoxyphenyl)oxanthene-9-yl (Mox). In some embodiments, non-exclusive examples of hydroxy protecting groups that may be used herein include Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4'-dimethoxytrityl), and TMTr (4,4',4"-trimethoxytrityl).

[0088] The term "subject", as used herein, refers to any animal, such as a mammal or marsupial. Subjects of the present disclosure include, but are not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cows, rabbits, sheep, rats, and poultry of any kind.

[0089] As used herein, "treatment" refers to an approach to obtaining beneficial or desired results, including but not limited to a therapeutic benefit. "Therapeutic benefit" means eradication or amelioration of the underlying disorder being treated. In addition, a therapeutic benefit is obtained by eradication or amelioration of one or more physiological symptoms associated with the underlying disorder, such that an improvement is observed in the subject, although the subject may still be afflicted with the underlying disorder.

[0090] As used herein, "prevention" refers to an approach to obtaining beneficial or desired results, including but not limited to a prophylactic benefit. To obtain a "prophylactic benefit," siRNA, pharmaceutical composition, or siRNA conjugate can be administered to a subject at risk for a particular disease, or to a subject reporting one or more physiological symptoms of a disease, even though a diagnosis of the disease may not have been made.

[0091] siRNA

[0092] The present disclosure provides a siRNA for regulating the expression of angiotensinogen AGT. The siRNA of the present disclosure contains a nucleotide group as a basic structural unit, and it is well known to those skilled in the art that the nucleotide group contains a phosphate group, a ribose group and a base.

[0093] The siRNA disclosed herein contains a sense strand and an antisense strand, and the sense strand and antisense strand are of the same or different lengths. The sense strand is 19-23 nucleotides long, and the antisense strand is 19-26 nucleotides long. Thus, the length ratio of the sense strand and the antisense strand of the siRNA provided by the present disclosure can be 19 / 19, 19 / 20, 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 20, 20 / 21, 20 / 22, 20 / 23, 20 / 24, 20 / 25, 20 / 26, 21 / 20, 21 / 21, 21 / 22, 21 / 23, 21 / 24, 21 / 25, 21 / 26, 22 / 20, 22 / 21, 22 / 22, 22 / 23, 22 / 24, 22 / 25, 22 / 26, 23 / 20, 23 / 21, 23 / 22, 23 / 23, 23 / 24, 23 / 25 or 23 / 26. In some embodiments, the length ratio of the sense strand to the antisense strand of the siRNA is 19 / 21, 21 / 21, 21 / 23 or 23 / 25.

[0094] According to the present disclosure, the siRNA contains a sense strand and an antisense strand, wherein each nucleotide in the siRNA is independently a modified or unmodified nucleotide, wherein the sense strand contains a nucleotide sequence I, and the antisense strand contains a nucleotide sequence II, and the nucleotide sequence I and the nucleotide sequence II are at least partially reverse-complementary to form a double-stranded region.

[0095] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are substantially reverse complementary, essentially reverse complementary, or completely reverse complementary; the substantially reverse complementary means that there are no more than 3 base mismatches between the two nucleotide sequences; the substantially reverse complementary means that there are no more than 1 base mismatch between the two nucleotide sequences; the completely reverse complementary means that there is no mismatch between the two nucleotide sequences.

[0096] In some embodiments, the sense strand further contains a nucleotide sequence III, and the antisense strand further contains a nucleotide sequence IV, and the lengths of the nucleotide sequence III and the nucleotide sequence IV are independently 0 to 4 nucleotides, wherein the nucleotide sequence III is connected to the 5' end of the nucleotide sequence I, and the nucleotide sequence IV is connected to the 3' end of the nucleotide sequence II, and the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary; the substantially reverse complementary means that there is no more than 1 base mismatch between the two nucleotide sequences; the completely reverse complementary means that there is no mismatch between the two nucleotide sequences. In some embodiments, the nucleotide sequence III is connected to the 3' end of the nucleotide sequence I, and the nucleotide sequence IV is connected to the 5' end of the nucleotide sequence II, and the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary; the substantially reverse complementary means that there is no more than 1 base mismatch between the two nucleotide sequences; the completely reverse complementary means that there is no mismatch between the two nucleotide sequences.

[0097] In some embodiments, the sense strand further contains a nucleotide sequence V and / or the antisense strand further contains a nucleotide sequence VI, the length of the nucleotide sequences V and VI is 0 to 4 nucleotides, the nucleotide sequence V is connected to the 3' end of the sense strand to form the 3' overhang of the sense strand and / or the nucleotide sequence VI is connected to the 3' end of the antisense strand to form the 3' overhang of the antisense strand. In some embodiments, the length of the nucleotide sequence V or VI is 2 nucleotides. In other embodiments, the base of the nucleotide sequence V or VI is two consecutive guanines (GG) or two consecutive uracils (UU). In other embodiments, the nucleotide sequence V or VI is mismatched or complementary to the nucleotides at the corresponding positions of the target mRNA.

[0098] Studies have found that different modification strategies can have very different effects on siRNA stability, biological activity, cytotoxicity and other indicators. For example, CN102140458B studied various chemical modification strategies for siRNA and confirmed 7 effective modification methods. Compared with unmodified siRNA, one of the modified methods produced siRNA that improved blood stability while maintaining inhibitory activity that was basically equivalent to that of unmodified siRNA.

[0099] As mentioned above, the nucleotides in the siRNA of the present disclosure are each independently a modified or unmodified nucleotide. In some embodiments, each nucleotide in the siRNA of the present disclosure is an unmodified nucleotide; in some embodiments, some or all of the nucleotides in the siRNA of the present disclosure are modified nucleotides, and these modifications on the nucleotide groups do not result in a significant weakening or loss of the function of the siRNA of the present disclosure in regulating the expression of angiotensinogen AGT.

[0100] In some embodiments, the siRNA of the present disclosure contains at least one modified nucleotide. In the context of the present disclosure, the term "modified nucleotide" used refers to a nucleotide or nucleotide analog formed by replacing the 2' hydroxyl group of the ribose group of the nucleotide with other groups, or a nucleotide in which the base on the nucleotide is a modified base. The modified nucleotide will not cause the function of siRNA to inhibit gene expression to be significantly weakened or lost. For example, the modified nucleotide disclosed in JK Watts, GF Deleavey, and MJ Damha, Chemically modified siRNA: tools and applications. Drug Discov Today, 2008, 13 (19-20): 842-55 can be selected.

[0101] In some embodiments, at least one nucleotide in the sense strand or antisense strand of the siRNA provided by the present disclosure is a modified nucleotide, and / or at least one phosphate group is a phosphate group with a modified group; in other words, at least a portion of the phosphate group and / or ribose group in the phosphate-sugar backbone of at least one single strand in the sense strand and the antisense strand is a phosphate group with a modified group and / or a ribose group with a modified group. In some embodiments, the phosphate group with a modified group is a thiophosphate group formed by replacing at least one oxygen atom in the phosphodiester bond in the phosphate group with a sulfur atom.

[0102] In some embodiments, the 5' terminal nucleotide of the sense strand is linked to a 5' phosphate group or a 5' phosphate-derived group. In some embodiments, the 5' terminal nucleotide of the antisense strand is linked to a 5' phosphate group or a 5' phosphate-derived group.

[0103] An exemplary 5' phosphate group has the structure: The structures of the 5' phosphate derivative group include but are not limited to: wait.

[0104] After the 5' terminal nucleotide of the sense strand or antisense strand is connected to a 5' phosphate group or a 5' phosphate derivative group, the following structure is formed:

[0105]

[0106] Wherein, Base represents a base, such as A, U, G, C or T. R' is a hydroxyl group or is substituted by various groups known to those skilled in the art, such as 2'-fluoro (2'-F) modified nucleotides, 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'-substituted amino modified nucleotides, and 2'-deoxy nucleotides.

[0107] Exemplary modified nucleotides have the following structures:

[0108]

[0109] Wherein, Base represents a base, such as A, U, G, C or T. The hydroxyl group at the 2' position of the ribose group is substituted by R. The hydroxyl group at the 2' position of these ribose groups can be substituted by various groups known to those skilled in the art, for example, 2'-fluoro (2'-F) modified nucleotides, 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'-substituted amino modified nucleotides, 2'-deoxy nucleotides.

[0110] In some embodiments, the 2'-alkoxy modified nucleotide is a 2'-methoxy (2'-OMe, 2'-O-CH 3 ) modified nucleotides, etc.

[0111] In some embodiments, the 2'-substituted alkoxy modified nucleotide is 2'-methoxyethoxy (2'-O-CH 2 -CH 2 -O-CH 3 ) modified nucleotides, 2'-O-CH 2 -CH=CH 2 Modified nucleotides, etc.

[0112] In some embodiments, the 2'-substituted alkyl modified nucleotide is 2'-CH 2 -CH 2 -CH=CH 2 Modified nucleotides, etc.

[0113] In some embodiments, all nucleotides in the sense strand and / or the antisense strand are modified nucleotides. In some embodiments, each nucleotide in the sense strand and antisense strand of the siRNA provided by the present disclosure is independently a 2'-fluoro-modified nucleotide or a non-fluoro-modified nucleotide.

[0114] In some embodiments, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 8 and 9 of the sense strand, and the remaining positions are non-fluoro-modified nucleotides; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are non-fluoro-modified nucleotides.

[0115] In some embodiments, at least one of the following linkages between nucleotides in the siRNA is a phosphorothioate linkage:

[0116] The connection between the first nucleotide and the second nucleotide at the 5' end of the sense strand;

[0117] The connection between the second nucleotide and the third nucleotide at the 5' end of the sense strand;

[0118] The connection between the first nucleotide and the second nucleotide at the 3' end of the sense strand;

[0119] The connection between the second nucleotide and the third nucleotide at the 3' end of the sense strand;

[0120] The connection between the first nucleotide and the second nucleotide at the 5' end of the antisense strand;

[0121] The connection between the second nucleotide and the third nucleotide at the 5' end of the antisense strand;

[0122] The connection between the first nucleotide and the second nucleotide at the 3' end of the antisense strand;

[0123] The connection between the second nucleotide and the third nucleotide at the 3' end of the antisense strand.

[0124] In some embodiments, the sense strand comprises phosphorothioate groups at the following positions, in the 5' to 3' direction:

[0125] Between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand;

[0126] Between the second nucleotide and the third nucleotide starting from the 5' end of the sense strand;

[0127] Between the first nucleotide and the second nucleotide starting from the 3' end of the sense strand;

[0128] The positive strand is located between the second nucleotide and the third nucleotide starting from the 3' end.

[0129] In some embodiments, the sense strand comprises phosphorothioate groups at the following positions, in the 5' to 3' direction:

[0130] Between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand;

[0131] The positive strand is located between the second nucleotide and the third nucleotide starting from the 5' end.

[0132] In some embodiments, the antisense strand comprises phosphorothioate groups at the following positions, in the 5' to 3' direction:

[0133] Between the first nucleotide and the second nucleotide starting from the 5' end of the antisense strand;

[0134] Between the second nucleotide and the third nucleotide starting from the 5' end of the antisense strand;

[0135] Between the first nucleotide and the second nucleotide starting from the 3' end of the antisense strand;

[0136] The antisense strand is located between the second nucleotide and the third nucleotide starting from the 3' end.

[0137] In some embodiments, each non-fluorinated modified nucleotide is independently selected from a nucleotide or a nucleotide analogue formed by replacing the hydroxyl group at the 2' position of the ribose group of the nucleotide with a non-fluorinated group, and the nucleotide analogue is selected from one of isonucleotides, LNA, ENA, cET BNA, UNA, GNA and SAFE-01.

[0138] In some embodiments, each nucleotide in the sense strand and the antisense strand is independently a 2'-fluoro-modified nucleotide, a 2'-methoxy-modified nucleotide, a SAFE-01-modified nucleotide, or a combination of any two or more thereof.

[0139] In some embodiments, from 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 8 and 9 of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides; from 5' to 3' direction, the 2'-fluoro-modified nucleotides may be located at positions 2, 6, 14 and 16 of the antisense strand, SAFE-01 may be located at position 6 or 7 of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides.

[0140] In some embodiments, each non-fluorinated modified nucleotide is a 2'-methoxy modified nucleotide or a GNA modified nucleotide. In some preferred embodiments, each non-fluorinated modified nucleotide is a 2'-methoxy modified nucleotide, wherein the 2'-methoxy modified nucleotide refers to a nucleotide formed by replacing the 2'-hydroxyl group of the ribose group with a methoxy group.

[0141] siRNA conjugates

[0142] The present disclosure provides a siRNA conjugate, wherein the siRNA conjugate contains the above siRNA and a conjugation group conjugated to the siRNA.

[0143] In general, the conjugated group includes at least one pharmaceutically acceptable targeting group, or further includes a linker, and the siRNA, the linker and the targeting group are connected in sequence. In some embodiments, the targeting group is 1-6. In some embodiments, the targeting group is 2-4. The siRNA molecule can be non-covalently or covalently conjugated to the conjugated group, for example, it can be covalently conjugated to the conjugated group. The conjugation site of siRNA and conjugated group can be at the 3' end or 5' end of the siRNA sense strand, or at the 3' end or 5' end of the antisense strand, or in the internal sequence of siRNA. In some embodiments, the conjugation site of siRNA and conjugated group is at the 3' end of the siRNA sense strand.

[0144] In some embodiments, the conjugated group can be connected to the phosphate group, 2'-hydroxyl group or base of the nucleotide. In some embodiments, the conjugated group can also be connected to the 3'-hydroxyl group, in which case the nucleotides are connected by a 2'-5' phosphodiester bond. When the conjugated group is connected to the end of the siRNA chain, the conjugated group is usually connected to the phosphate group of the nucleotide; when the conjugated group is connected to the internal sequence of the siRNA, the conjugated group is usually connected to the ribose sugar ring or the base. Various connection methods can be referred to in the literature: Muthiah Manoharan et.al.siRNA conjugates carrying sequentially assembled trivalent N-acetylgalactosamine linked through nucleosides elicit robust gene silencing in vivo inhepatocytes.ACS Chemical biology, 2015, 10 (5): 1181-7.

[0145] In specific embodiments, the conjugate group can be linked to the 5' end of the siRNA sense strand, and / or can be linked to the 3' end of the siRNA sense strand; alternatively, the siRNA sense strand and the conjugate group are linked via a phosphate bond or a phosphorothioate bond.

[0146] In some embodiments, the siRNA and the conjugated group can be connected by acid-labile or reducible chemical bonds, which can be degraded in the acidic environment of the cell endosome, thereby making the siRNA free. For non-degradable conjugation methods, the conjugated group can be connected to the sense strand of the siRNA, thereby minimizing the effect of conjugation on the activity of the siRNA.

[0147] In some embodiments, the pharmaceutically acceptable targeting group may be a ligand conventionally used in the field of siRNA administration, such as various ligands described in WO2009082607A2, which is fully incorporated into this specification by reference.

[0148] In some embodiments, the pharmaceutically acceptable targeting group can be selected from one or more of the ligands formed by the following targeting molecules or their derivatives: lipophilic molecules, such as cholesterol, bile acid, vitamins (such as vitamin E), lipid molecules of different chain lengths; polymers, such as polyethylene glycol; polypeptides, such as membrane-permeable peptides; aptamers; antibodies; quantum dots; carbohydrates, such as lactose, polylactose, mannose, galactose, N-acetylgalactosamine (GalNAc); folic acid (folate); receptor ligands expressed by hepatic parenchymal cells, such as asialoglycoproteins, asialosugar residues, lipoproteins (such as high-density lipoproteins, low-density lipoproteins, etc.), glucagon, neurotransmitters (such as adrenaline), growth factors, transferrin, etc.

[0149] In some embodiments, each ligand is independently selected from a ligand that can bind to a cell surface receptor. In some embodiments, at least one ligand is a ligand that can bind to a hepatocyte surface receptor. In some embodiments, at least one ligand is a ligand that can bind to a mammalian cell surface receptor. In some embodiments, at least one ligand is a ligand that can bind to a human hepatocyte surface receptor. In some embodiments, at least one ligand is a ligand that can bind to a liver surface asialoglycoprotein receptor (ASGPR). The types of these ligands are well known to those skilled in the art, and their function is generally to bind to a specific receptor on the surface of the target cell, mediating the delivery of the siRNA connected to the ligand to the target cell.

[0150] In some embodiments, the pharmaceutically acceptable targeting group can be any ligand that binds to an asialoglycoprotein receptor (ASGPR) on the surface of a mammalian hepatocyte. In some embodiments, each ligand is independently an asialoglycoprotein, such as asialo serum mucin (ASOR) or asialo fetuin (ASF). In some embodiments, the ligand is a sugar or a derivative of a sugar.

[0151] In some embodiments, at least one ligand is a sugar. In some embodiments, each ligand is a sugar. In some embodiments, at least one ligand is a monosaccharide, a polysaccharide, a modified monosaccharide, a modified polysaccharide or a sugar derivative. In some embodiments, at least one of the ligands may be a monosaccharide, a disaccharide or a trisaccharide. In some embodiments, at least one ligand is a modified sugar. In some embodiments, each ligand is independently selected from a polysaccharide, a modified polysaccharide, a monosaccharide, a modified monosaccharide, a polysaccharide derivative or a monosaccharide derivative. In some embodiments, each or at least one ligand is selected from the group consisting of the following sugars: glucose and its derivatives, mannan and its derivatives, galactose and its derivatives, xylose and its derivatives, ribose and its derivatives, fucose and its derivatives, lactose and its derivatives, maltose and its derivatives, arabinose and its derivatives, fructose and its derivatives and sialic acid.

[0152] In some embodiments, each of the ligands can be independently selected from D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucose, β-D-glucose, Sugar, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, N-isobutyrylgalactosamine , 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, 2, 3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-pyranoglucoside methyl ester, 4-thio-β-D-pyranose galactose, 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-pyranoglucoside ethyl ester, 2,5-anhydro-D-allose nitrile, ribose, D-ribose, D-4-thioribose, L-ribose or L-4-thioribose. Other selections of the ligand can refer to, for example, the records of CN105378082A, which are incorporated into this specification in full by reference.

[0153] In some embodiments, the pharmaceutically acceptable targeting group in the siRNA conjugate can be galactose or N-acetylgalactosamine, wherein the galactose or N-acetylgalactosamine molecule can be monovalent, divalent, trivalent, or tetravalent. It should be understood that the monovalent, divalent, trivalent, and tetravalent herein refer to the molar ratio of the siRNA molecule to the galactose or N-acetylgalactosamine molecule in the siRNA conjugate after the siRNA molecule and the conjugated group containing the galactose or N-acetylgalactosamine molecule as the targeting group form the siRNA conjugate respectively: 1, 1: 2, 1: 3, or 1: 4. In some embodiments, the pharmaceutically acceptable targeting group is N-acetylgalactosamine. In some embodiments, when the siRNA described in the present application is conjugated to a conjugated group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent or tetravalent. In some embodiments, when the siRNA described herein is conjugated to a conjugation group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent.

[0154] The targeting group can be connected to the siRNA molecule via a suitable linker, and those skilled in the art can select a suitable linker according to the specific type of the targeting group. For these linkers, the types of targeting groups and the connection mode with siRNA, please refer to the disclosure of WO2015006740A2, which is incorporated into this specification in its entirety by reference.

[0155] In some embodiments, the conjugate of the present disclosure has the structure shown below:

[0156]

[0157] in, represents a duplex formed by the siRNA of the present disclosure;

[0158] X is O or S.

[0159] Preparation of siRNA and its conjugates

[0160] By the conventional solid phase phosphoramidite method in the art, nucleoside monomers are connected one by one from the 3'-5' direction according to the nucleotide arrangement order, thereby preparing the siRNA disclosed herein. Each connection of a nucleoside monomer includes a four-step reaction of deprotection, coupling, capping, oxidation or sulfurization. Wherein, when a phosphate is used to connect two nucleotides, when connecting the latter nucleoside monomer, a four-step reaction of deprotection, coupling, capping and oxidation is included. When a thiophosphate is used to connect two nucleotides, when connecting the latter nucleoside monomer, a four-step reaction of protection, coupling, capping and sulfurization is included.

[0161] Any reasonable synthetic route can be used to prepare the siRNA conjugate of the present disclosure. For example, for a conjugate molecule comprising a targeting group and an active reactive group that can react with phosphoramidite to form a covalent bond, the active group in the conjugate molecule can be first protected with a protective agent and then connected to a solid phase carrier, and then the nucleoside monomers are connected one by one in the direction of 3' to 5' according to the nucleotide type and sequence of the siRNA sense chain and antisense chain by a phosphoramidite solid phase synthesis method, and the connection of each nucleoside monomer includes four steps of deprotection, coupling, capping, oxidation or sulfurization; the sense chain and antisense chain of the siRNA are separated and annealed, thereby obtaining the siRNA conjugate of the present disclosure.

[0162] Furthermore, the preparation of siRNA conjugates can also be carried out with reference to the disclosure of existing literature. For example, WO2019010274A1 describes in Example 1 a method of sequentially connecting a linking group having a specific structure and a targeting ligand to siRNA via reaction. The entire contents are incorporated herein by reference.

[0163] Pharmaceutical composition

[0164] The present disclosure provides a pharmaceutical composition comprising the above siRNA and a pharmaceutically acceptable carrier.

[0165] The pharmaceutically acceptable carrier may be a carrier conventionally used in the field of siRNA administration, such as but not limited to magnetic nanoparticles (e.g., Fe-based 3 O 4 or Fe 2 O 3Nanoparticles), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethyleneimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly(D&L-lactic / glycolic acid) copolymer (PLGA), poly(2-aminoethyl ethylene phosphate), poly(2-dimethylaminoethylmethacrylate), and one or more of their derivatives.

[0166] In some embodiments, there are no special requirements for the content of siRNA and pharmaceutically acceptable carrier in the pharmaceutical composition. In some embodiments, the weight ratio of siRNA to pharmaceutically acceptable carrier can be 1:(1-500). In some embodiments, the above weight ratio is 1:(1-50).

[0167] In some embodiments, the pharmaceutical composition may further include other pharmaceutically acceptable excipients, which may be one or more of various preparations or compounds conventionally used in the art. For example, the other pharmaceutically acceptable excipients may include at least one of a pH buffer, a protective agent, and an osmotic pressure regulator.

[0168] The pH buffer may be a tris(hydroxymethyl)aminomethane hydrochloride buffer with a pH value of 7.5-8.5 and / or a phosphate buffer with a pH value of 5.5-8.5, for example, a phosphate buffer with a pH value of 5.5-8.5.

[0169] The protective agent may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose and glucose. Based on the total weight of the pharmaceutical composition, the content of the protective agent may be 0.01-30% by weight.

[0170] The osmotic pressure regulator can be, for example, sodium chloride and / or potassium chloride. The content of the osmotic pressure regulator makes the osmotic pressure of the pharmaceutical composition 200-700 milliosmole / kilogram (mOsm / kg). According to the desired osmotic pressure, those skilled in the art can easily determine the content of the osmotic pressure regulator. In some embodiments, the dosage of the preparation made of the pharmaceutical composition during administration can be adjusted due to different administration methods.

[0171] In some embodiments, the pharmaceutical composition can be a liquid preparation, such as an injection; it can also be a lyophilized powder injection, which is mixed with a liquid excipient during administration to prepare a liquid preparation. The liquid preparation can be, but is not limited to, used for subcutaneous, intramuscular, intraventricular injection or intrathecal injection administration, and can also be, but is not limited to, delivering the pharmaceutical composition by nasal administration, oropharyngeal inhalation, spray administration, etc. In some embodiments, the pharmaceutical composition is delivered by intrathecal injection. In some embodiments, the intrathecal injection of the pharmaceutical composition into the cerebrospinal fluid can be performed in the form of a push injection or via a micropump, which can be implanted under the skin to provide regular and constant delivery of siRNA to the cerebrospinal fluid. In some embodiments, intrathecal administration is via an osmotic pump implanted surgically. In some embodiments, an osmotic pump is implanted in the subarachnoid space of the spinal canal to facilitate intrathecal administration.

[0172] In some embodiments, the pharmaceutical composition can be in the form of a liposome formulation. In some embodiments, the pharmaceutically acceptable carrier used in the liposome formulation comprises an amine-containing transfection compound (hereinafter also referred to as an organic amine), a helper lipid and / or a pegylated lipid.

[0173] The auxiliary lipid is cholesterol, a cholesterol analog and / or a cholesterol derivative;

[0174] The PEGylated lipid is 1,2-dipalmitoyl-sn-glycero-3-phosphatidylethanolamine-N-[methoxy(polyethylene glycol)]-2000.

[0175] Reagent test kit

[0176] The present disclosure provides a kit comprising the above siRNA or the above siRNA conjugate or the above pharmaceutical composition.

[0177] In some embodiments, the kit described herein may provide siRNA in one container. In some embodiments, the kit described herein may include a container providing a pharmaceutically acceptable excipient. In some embodiments, the kit may also include other ingredients, such as stabilizers or preservatives. In some embodiments, the kit described herein may include at least one other therapeutic agent in a container other than the container providing the siRNA described herein. In some embodiments, the kit may include instructions for mixing siRNA with a pharmaceutically acceptable carrier and / or excipient or other ingredients (if any).

[0178] In the kit of the present disclosure, the siRNA and pharmaceutically acceptable carrier and / or adjuvant, and the modified siRNA and / or pharmaceutical composition, and / or pharmaceutically acceptable carrier and / or adjuvant can be provided in any form, such as liquid form, dry form or lyophilized form. In some embodiments, the siRNA and pharmaceutically acceptable carrier and / or adjuvant and the pharmaceutical composition and pharmaceutically acceptable carrier and / or adjuvant are substantially pure and / or sterile. In some embodiments, sterile water can be provided in the kit of the present disclosure.

[0179] Application of the siRNA and siRNA conjugate disclosed herein and pharmaceutical composition containing the siRNA

[0180] The present disclosure provides use of the above siRNA or the above siRNA conjugate or the above pharmaceutical composition for preparing a medicament for regulating the expression of angiotensinogen AGT.

[0181] The present disclosure provides use of the above siRNA or the above siRNA conjugate or the above pharmaceutical composition for preparing a medicament for treating and / or preventing a disease associated with angiotensinogen AGT expression.

[0182] In some embodiments, the disease comprises critical hypertension, essential hypertension, secondary hypertension, isolated systolic or diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt's hypertension, hypertension associated with low plasma renin activity or plasma renin concentration, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis , arteriosclerosis, vascular disease, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, nocturnal hypertension, glomerulosclerosis, aortic coarctation, aortic aneurysm, ventricular fibrosis, heart failure, myocardial infarction, angina pectoris, stroke, kidney disease, renal failure, systemic sclerosis, intrauterine growth retardation (IUGR), fetal growth restriction, obesity, hepatic steatosis / fatty liver, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD); glucose intolerance, type 2 diabetes, and metabolic syndrome.

[0183] The present disclosure provides a method for regulating the expression of angiotensinogen AGT, comprising contacting a therapeutically effective amount of the above-mentioned siRNA or the above-mentioned siRNA conjugate or the above-mentioned pharmaceutical composition with a cell expressing angiotensinogen AGT or administering it to a subject in need thereof. The siRNA or siRNA conjugate or pharmaceutical composition disclosed herein is introduced into the cell to achieve the purpose of regulating the expression of angiotensinogen AGT in the cell through the mechanism of RNA interference.

[0184] The present disclosure provides a method for treating and / or preventing diseases associated with the expression of angiotensinogen AGT, comprising administering a therapeutically effective amount of the above-mentioned siRNA or the above-mentioned siRNA conjugate or the above-mentioned pharmaceutical composition to a subject in need. By administering the siRNA active ingredient of the present disclosure to a subject in need, the purpose of treating and / or preventing the disease caused can be achieved through the mechanism of RNA interference. Therefore, the siRNA or siRNA conjugate or pharmaceutical composition of the present disclosure can be used to treat and / or prevent diseases associated with the expression of angiotensinogen AGT, or to prepare drugs for treating and / or preventing diseases associated with the expression of angiotensinogen AGT.

[0185] The term "administration / administration" as used herein refers to placing the siRNA, pharmaceutical composition and / or siRNA conjugate of the present disclosure into the subject's body by a method or approach that at least partially localizes the siRNA, pharmaceutical composition and / or siRNA conjugate of the present disclosure to the desired site to produce the desired effect. Administration routes suitable for the methods of the present disclosure include local administration and systemic administration. In general, local administration results in more siRNA conjugates being delivered to a specific site compared to the subject's systemic circulation; while systemic administration results in the delivery of the siRNA, pharmaceutical composition and / or siRNA conjugate of the present disclosure to the subject's basic systemic circulation.

[0186] The drug may be administered to a subject by any suitable route known in the art, including but not limited to oral or parenteral routes, such as intravenous administration, intramuscular administration, subcutaneous administration, transdermal administration, airway administration (aerosol), intraventricular administration, intrathecal administration, nasal administration, rectal administration, and topical administration (including buccal administration and sublingual administration). The frequency of administration may be once or more daily, weekly, biweekly, triweekly, monthly, or annually. The dosage of the siRNA, pharmaceutical composition, or siRNA conjugate disclosed herein may be a conventional dosage in the art, which may be determined based on various parameters, especially the age, weight, and sex of the subject. Toxicity and efficacy may be determined by standard pharmaceutical procedures in cell culture or experimental animals, such as determination of LD50 (lethal dose that kills 50% of the population) and ED50 (in quantitative response, the dose that causes 50% of the maximum response intensity, and in qualitative response, the dose that causes 50% of the experimental subjects to have a positive response). The range of human dosages may be derived based on data obtained from cell culture analysis and animal studies. In some embodiments, the dosage of the preparation prepared by the siRNA, pharmaceutical composition or siRNA conjugate is adjusted during administration according to different administration methods.

[0187] Example

[0188] Example 1 Design and synthesis of AGT siRNA

[0189] Herein, if the actual source is not specifically given, the reagent can be obtained from any supplier of molecular biology reagents in a quality / purity suitable for molecular biology applications.

[0190] 1) siRNA design, human AGT (NM_001384479.1) was used as the target gene, and 19 / 21nt siRNA was designed to meet the general rules of active siRNA. The detailed list of unmodified sense and antisense strand sequences is shown in Table 1 below, and the detailed list of modified sense and antisense strand sequences is shown in Table 2 below.

[0191] 2) siRNA synthesis, using solid support-mediated phosphoramidite chemistry to synthesize siRNA sequences at 200 nanomoles (nmol) on a Dr. Oligo48 synthesizer (Biolytic). The solid support is a universal solid support (Shenzhen Comma Bio). Nucleoside monomer raw materials 2'-F RNA, 2'-O-methyl RNA and other nucleoside phosphoramidite monomers were purchased from Shanghai Zhaowei or Suzhou Jima. The coupling time of all phosphoramidites (50mM acetonitrile solution) was 6 minutes (min), 5-ethylthio-1H-tetrazole (ETT) was used as an activator (0.6M acetonitrile solution), 0.22M diphenylacetyl disulfide (PADS) dissolved in a 1:1 volume ratio of acetonitrile and trimethylpyridine (Suzhou Kelema) solution was used as a sulfurization reagent, the sulfurization reaction time was 3 minutes (min), and iodine pyridine / water solution (Kelema) was used as an oxidant, and the oxidation reaction time was 2 minutes (min).

[0192] After solid phase synthesis, the oligoribonucleotides were cleaved from the solid support and soaked in a 3:1 28% ammonia and ethanol solution at 50°C for 16 hours. Then, the supernatant was transferred to another centrifuge tube, concentrated and evaporated to dryness, and purified by C18 reverse chromatography with a mobile phase of 0.1M triethylamine acetate (TEAA) and acetonitrile, and 4,4'-dimethoxytrityl (DMTr) was removed using a 3% trifluoroacetic acid solution. The target oligonucleotides were collected and freeze-dried, identified as the target product by LC-MS, and then quantified by UV (260nm).

[0193] The obtained single-stranded oligonucleotides were annealed according to the two complementary paired sequences at an equal molar ratio, and the double-stranded siRNA obtained was finally dissolved in 1X PBS and adjusted to the required concentration of the experiment.

[0194] Table 1 Unmodified sense strand and antisense strand of AGT siRNA

[0195]

[0196] Table 2 Modified sense strand and antisense strand of AGT siRNA

[0197]

[0198]

[0199] The abbreviations in the above table represent the following meanings:

[0200] abbreviation Nucleotides A 2'-Fluoroadenosine-3'-phosphate Af 2'-Fluoroadenosine-3'-phosphorothioate Cf 2'-Fluorocytidine-3'-phosphate Cfs 2'-Fluorocytidine-3'-phosphorothioate Gf 2'-Fluoroguanosine-3'phosphate Gf 2'-Fluoroguanosine-3'-phosphorothioate Uf 2'-Fluorouridine-3'-phosphate Ufs 2'-Fluorouridine-3'-phosphorothioate Am 2'-O-methyladenosine-3'-phosphate Ams 2'-O-methyladenosine-3'-phosphorothioate Cm 2'-O-methylcytidine-3'-phosphate Cms 2'-O-methylcytidine-3'-phosphorothioate Gm 2'-O-methylguanosine-3'-phosphate Gm 2'-O-methylguanosine-3'-phosphorothioate Um 2'-O-methyluridine-3'-phosphate Ums 2'-O-methyluridine-3'-phosphorothioate s Phosphorothioate Linker VP Vinyl-phosphate

[0201] Ago, Ggo, Cgo, and Ugo are SAFE-01 modified nucleotides, and their specific structures are as follows:

[0202]

[0203] Example 2 Preparation of conjugate

[0204] 1. Preparation of GalNAc Target Head

[0205] L96 was purchased from Ailiying Pharmaceutical Group (Tianjin) Co., Ltd.

[0206] In this example, the synthesis route of compound SA51 (I-1-7) is shown in the figure below:

[0207]

[0208] 2.1 Preparation of intermediate 2-1

[0209]

[0210] Compound (R)-(+)-N-benzyl-3-hydroxypyrrolidine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (16.9 mmol, 3.0 g) and imidazole (3.0 equiv, 50.7 mmol, 3.45 g) were placed in a clean dry reaction bottle, 50 mL of acetonitrile was added, tert-butyldimethylsilyl chloride (1.3 equiv, 21.9 mmol, 3.31 g) was slowly added at room temperature, and then stirred at room temperature for 12 hours. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine, the organic phase was dried, filtered and concentrated, and the crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 20 / 1→5 / 1) to obtain a colorless oil compound 2-1 (4.9 g, 16.8 mmol, 99% yield). Compound 2-1 molecular formula: C17H29ONSi, molecular weight: 291.2, LC-MS measured: 292.4 (M+H).

[0211] 2.2 Preparation of intermediate 2-2

[0212]

[0213] Compound 2-1 (16.8mmol, 4.9g) was placed in a clean dry reaction bottle, 100mL of methanol was added, palladium carbon (wet basis, 10% Pd / C) (10%wt, 490.0mg) was added under hydrogen at room temperature, and then stirred at room temperature for 12 hours. After the reaction, the palladium carbon was removed by filtration, and the filtrate was concentrated to obtain a crude product of white solid compound 2-2 (3.31g, 16.5mmol, 98% yield), which was directly used in the next step without purification. Compound 2-2 molecular formula: C10H23ONSi, molecular weight: 201.1, LC-MS measured: 202.3 (M+H).

[0214] 2.3 Preparation of intermediate 2-3

[0215]

[0216] The compound N-benzyloxycarbonyl-L-serine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (15.0 mmol, 3.58 g) was placed in a clean dry reaction bottle, 100 mL of dichloromethane was added, and benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.5 equiv, 22.5 mmol, 8.53 g), compound 2-2 (1.1 equiv, 16.5 mmol, 3.31 g) and N,N-diisopropylethylamine (3.0 equiv, 45.0 mmol, 5.78 g) were added at room temperature, followed by stirring at room temperature for 1 hour. After the reaction, 150 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered and concentrated. The crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 10 / 1 → 1 / 3) to give a white solid compound 2-3 (4.5 g, 10.65 mmol, 63% two-step yield). Compound 2-3 molecular formula: C21H34O5N2Si, molecular weight: 422.2, LC-MS measured: 423.3 (M+H). 1H NMR (400MHz, CDCl3): δ7.35-7.29 (m, 5H), 5.96 (dd, J = 14.3, 8.3 Hz, 1H), 5.10 (s, 2H), 4.61-4.40 (m, 2H), 3.85-3.68 (m, 2H), 3.65-3.49 (m, 2H), 3.41 (d, J = 12.7 Hz, 1H), 3.31 (s, 1H), 1.95 (qdd, J = 15.0, 11.8, 5.3 Hz, 2H), 1.77 (s, 1H), 0.86 (s, 9H), 0.06 (d, J = 3.1 Hz, 6H).

[0217] 2.4 Preparation of intermediate 2-4

[0218]

[0219] Compound 2-3 (10.65mmol, 4.5g) was placed in a clean dry reaction bottle, 100mL of pyridine was added, and 4,4'-bismethoxytrityl chloride (1.2equiv, 12.78mmol, 4.32g) was added at room temperature, and then stirred at room temperature for 12 hours. After the reaction, 150mL of ethyl acetate was added to the reaction solution, and washed with 150mL of saturated sodium bicarbonate solution and 150mL of saturated brine, the organic phase was dried, filtered and concentrated, and the crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 20 / 1 → 1 / 1) to obtain a light yellow oil compound 2-4 (7.56g, 10.43mmol, 98% yield). Compound 2-4 molecular formula: C42H52O7N2Si, molecular weight: 724.3, LC-MS measured: 747.4 (M+Na).1H NMR (400MHz, CDCl3): δ7.35-7.31(m,1H),7.28(d,J=4.7Hz,4H),7.27-7.23(m,2H),7.23-7.14(m,5H), 7.13-7.11(m,2H),6.80-6.78(m,1H),6.76(dd,J=7.7,5.4Hz,4H),5.72(dd,J=22.7,8.3Hz,1H),5.08- 4.99(m,2H),4.69-4.59(m,1H),4.35-4.30(m,1H),3.73(dd,J=4.5,3.7Hz,6H),3.65-3.44(m,2H),3.3 6-3.20(m,3H),1.86-1.81(m,1H),1.70(s,1H),0.80(d,J=13.1Hz,9H),-0.02(dd,J=14.9,4.2Hz,6H).

[0220] 2.5 Preparation of intermediate 2-5

[0221]

[0222] Compound 2-4 (10.43mmol, 7.56g) was placed in a clean dry reaction bottle, 100mL of methanol was added, palladium carbon (wet basis, 10% Pd / C) (10% wt, 750.0mg) was added under hydrogen at room temperature, and then stirring was continued at room temperature for 12 hours. After the reaction, palladium carbon was removed by filtration, and the filtrate was concentrated to obtain a crude product of white solid compound 2-5 (6.0g, 10.22mmol, 98% yield), which was directly used in the next step without purification. Compound 2-5 molecular formula: C34H46O5N2Si, molecular weight: 590.3, LC-MS measured: 591.6 (M+H).

[0223] 2.6 Preparation of intermediate 2-6

[0224]

[0225] Compound 5-(((2R,3R,4R,5R,6R)-3-acetylamino-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoic acid (commercially available, purchased from Noganlin Biopharmaceutical Technology (Suzhou) Co., Ltd.) (2.06 g, 4.62 mmol) was placed in a clean dry reaction bottle, 100 mL of dichloromethane was added, and benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.5 equiv, 6.93 mmol, 2.63 g) was added at room temperature and stirred for ten minutes. Subsequently, compound 2-5 (1.1 equiv, 5.08 mmol, 3.0 g) and N,N-diisopropylethylamine (3.0 equiv, 13.86 mmol, 17.91 g) were added to the reaction system, and then stirring was continued at room temperature for 1 hour. After the reaction, 150 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered and concentrated. The crude product was separated and purified by silica gel column chromatography (dichloromethane / methanol = 50 / 1 → 10 / 1) to obtain a white solid compound 2-6 (3.58 g, 3.51 mmol, 76% yield). Compound 2-6 molecular formula: C53H73O15N3Si, molecular weight: 1019.3, LC-MS measured: 1018.3 (MH).

[0226] 2.7 Preparation of intermediate 2-7

[0227]

[0228] Compound 2-6 (3.51mmol, 3.58g) was placed in a clean dry reaction bottle, 50mL of pyridine was added, and triethylamine hydrofluoride (5.0equiv, 17.55mmol, 2.97g) was added at room temperature, and then stirred at room temperature for 12 hours. After the reaction, 100mL of ethyl acetate was added to the reaction solution, and washed with 100mL of saturated sodium bicarbonate solution and 100mL of saturated brine, the organic phase was dried, filtered and concentrated, and the crude product was separated and purified by silica gel column chromatography (dichloromethane / methanol=50 / 1→10 / 1) to obtain a light yellow oil compound 2-7 (2.4g, 2.65mmol, 76% yield). Compound 2-7 molecular formula: C47H59O15N3, molecular weight: 905.3, LC-MS measured: 904.4 (MH).1H NMR (400MHz, CDCl3): δ7.30 (dd, J=4.2, 1.9Hz, 1H), 7.29-7.25 (m, 5H), 7.19-7.15 (m, 4H), 6.85-6.81 (m, 4H), 5.40-5.34 (m, 1H), 5.3 0(s,1H),5.26-5.19(m,1H),5.13(ddd,J=14.5,10.9,3.3Hz,1H),4.85-4.78(m,1H),4.75-4.71(m,1H),4.68-4.61(m,1H),4.50(d, J=11.5Hz,1H),4.18-4.11(m,2H),4.06-3.97(m,1H),3.90(dt,J=10.6,6.8Hz,2H),3.80(s,6H),3.67-3.46(m,4H),3.25-3.19(m,2 H),2.34-2.23(m,1H),2.17-2.15(m,3H),2.10-2.03(m,5H),1.98(dt,J=12.9,2.4Hz,4H),1.76-1.61(m,4H),1.37(t,J=7.3Hz,3H).

[0229] 2.8 Preparation of compound SA51 (I-1-7)

[0230]

[0231] Compound 2-7 (2.65mmol, 2.4g) was placed in a clean dry reaction bottle, and 50mL of anhydrous dichloromethane (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) was added. Compound 2-cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite (2.0equiv, 5.3mmol, 1.6g) and 4,5-dicyanoimidazole (1.5equiv, 3.97mmol, 470.0mg) were added under argon protection at room temperature, and stirring was continued for one hour at room temperature. After the reaction, 50mL of dichloromethane was added to the reaction solution, and it was washed with 100mL of saturated sodium bicarbonate solution. The organic phase was dried, filtered and concentrated, and the crude product was purified by C18 reverse phase column (specification: 30μm; Commercially available, purchased from Shanghai Boyun Biotechnology Co., Ltd.) (MeCN:H2O=75%:25%) to prepare white solid I-1-7 (2.03 g, 1.84 mmol, 70% yield). Compound I-1-7 molecular formula: C56H76O15N6P, molecular weight: 1105.5, LC-MS measured: 1128.4 (M+Na).1H NMR (400MHz, DMSO-d6): δ8.12-8.06(m,1H),7.78(dd,J=9.1,2.0Hz,1H),7.35-7.28(m,4H),7.23-7.17(m,5H),6.88(d,J=7.5Hz,4H),5.21(d,J =3.3Hz,1H),4.97(dd,J=11.2,3.0Hz,1H),4.86-4.75(m,1H),4.52(s,1 H),4.47(d,J=8.5Hz,1H),4.04-3.98(m,3H),3.91-3.83(m,1H),3.74(s ,6H),3.70-3.60(m,3H),3.58-3.47(m,3H),3.39(t,J=11.7Hz,2H),3.3 1(d,J=4.1Hz,1H),3.19(qd,J=8.7,3.8Hz,1H),3.02(dt,J=19.9,6.8Hz ,1H),2.78-2.70(m,1H),2.60(td,J=5.8,1.8Hz,1H),2.09(s,5H),1.98 (s,4H),1.89(s,3H),1.73(s,3H),1.44(s,4H),1.20-0.88(m,14H).31P NMR (162MHz, DMSO-d6): δ148.22 (s), 146.82 (t, J = 35.8Hz).

[0232] 2. Conjugate Preparation

[0233] siRNA conjugate preparation

[0234] The solid phase phosphoramidite method was used to initiate the cycle using compound SA51 prepared in the above steps, and nucleoside monomers were connected one by one from the 3'-5' direction according to the nucleotide arrangement order. Each connection of a nucleoside monomer included four steps of deprotection, coupling, capping, oxidation or sulfurization. The same synthesis conditions were used for the sense chain and the antisense chain.

[0235] Instrument models: Biolytic Dr.Oligo 48 solid phase synthesizer, Biocomma Embed CPG Frits universal synthesis column DS0200, Biocomma 96-well plate desalting column DC189650 (80 mg).

[0236] Table 3 Reagents used in the synthesis of siRNA conjugates

[0237]

[0238] The synthesis conditions are as follows:

[0239] The nucleoside monomer was provided in an acetonitrile solution with a concentration of 0.05 M. The conditions for the deprotection reaction in each step were the same, namely, the temperature was 25° C., the reaction time was 3 minutes, the deprotection reagent was DCA, and the injection volume was 180 μL.

[0240] The reaction conditions for each coupling step were the same, including a temperature of 25°C, a reaction time of 3 minutes, a nucleoside monomer injection volume of 90 μL, and a catalyst ACT injection volume of 110 μL.

[0241] The capping conditions were the same for each step, including a temperature of 25°C and a reaction time of 2 minutes. The capping reagent solution was a mixed solution of CapA and CapB (CapB1:CapB2=1:1) at a molar ratio of 1:1. The capping reagent injection volume was 180 μL.

[0242] The oxidation reaction conditions were the same in each step, including a temperature of 25°C, a reaction time of 3 minutes, and an injection volume of 180 μL of the oxidation reagent OXD.

[0243] The reaction conditions for each step of the sulfurization reaction were the same, including a temperature of 25°C, a reaction time of 4 minutes, and a sulfurization reagent of 0.05 M PADS in pyridine acetonitrile. The injection volume of the sulfurization reagent was 180 μL.

[0244] After the last nucleoside monomer is connected, the nucleic acid sequence connected to the solid phase carrier is cut, deprotected, purified, desalted, and then freeze-dried to obtain the sense chain and the antisense chain, wherein:

[0245] The cleavage and deprotection conditions are as follows: the synthesized nucleotide sequence connected to the vector is added to a mixed solution of ammonia water: ethanol = 3:1 to a volume of 0.8 mL, reacted at 50°C for 15 hours, filtered to remove the remaining vector, and the supernatant was vacuum concentrated to dryness.

[0246] Purification and desalting conditions are as follows: Desalting is performed using a C18 reverse phase column. Specific conditions include:

[0247] Sample preparation

[0248] 0.1 M TEAA (triethylamine acetate) was added to the oligonucleotide sample to a volume of 0.8 mL.

[0249] Activation of 96-well plates

[0250] Activation: 0.8 mL of acetonitrile was passed through each well of a 96-well plate for activation;

[0251] Equilibration: The 96-well plate was equilibrated with 0.8 mL of TEAA (pH 7.0) solution.

[0252] The purification process is carried out in the following order:

[0253] Pass 0.8 mL of the solution containing the oligonucleotide through a desalting column;

[0254] Wash the 96-well plate twice with 0.8 mL of 6.5% ammonia to remove failed sequences;

[0255] Rinse the 96-well plate twice with 0.8 mL of deionized water to remove salt;

[0256] The 96-well plate was washed three times with 0.8 mL of 3% trifluoroacetic acid to remove DMT, and the adsorbed layer was observed to turn orange-red;

[0257] Wash the 96-well plate with 0.8 mL of 0.1 M TEAA;

[0258] The 96-well plate was rinsed twice with 0.8 mL of deionized water to remove trifluoroacetic acid and residual salt;

[0259] Elution was performed with 0.6 mL of 20% acetonitrile and the resulting product was collected and lyophilized.

[0260] The detection method is as follows: Waters Acquity UPLC-LTQ LCMS (column: ACQUITY UPLC BEHC18) is used to detect the purity of the sense chain and antisense chain and analyze the molecular weight. The measured values ​​are consistent with the theoretical values, indicating that the synthesized sense chain and antisense chain are conjugated with groups at the 3' end and / or 5' end.

[0261] Annealing operation is as follows: dissolve the sense strand and antisense strand synthesized in step 2 in water for injection, prepare 0.1mg / mL-40mg / mL solution, calibrate the mixture in equal molar ratio using a concentration meter, heat at 90°C for 5 minutes, and then slowly cool down naturally to form a double-stranded structure through hydrogen bonding, take samples and send to detect the SEC purity of the product. The double-stranded sample is freeze-dried.

[0262] Example 3 In vitro testing of siRNA IC 50

[0263] The effect of siRNA targeting AGT on the expression level of AGT mRNA was tested in vitro. Hep3B cells were cultured in DMEM high glucose medium containing 10% fetal bovine serum at 37°C and 5% CO2. During transfection, Hep3B cells were seeded in 96-well plates at a seeding density of 20,000 cells per well and 100 μL of culture medium per well.

[0264] According to the product manual, siRNA was transfected using Lipofectamine RNAiMAX (ThermoFisher, 13778150). siRNA was diluted 2.5 times from 8nM to 0.000839nM for transfection. The siRNA sequence is shown in Table 4. 24 hours after transfection, the cells were purified using a cell RNA extraction kit ( Fanzhi Medical Technology (Jiangsu) Co., Ltd. , FG0410-L) to isolate RNA from cells and use a reverse transcription kit (Takara PrimeScript TM II 1st Strand cDNA Synthesis Kit, 6210A) was used for reverse transcription, and quantitative real-time PCR detection was performed using a qPCR reaction kit (ThermoFisher TaqMan Fast Advanced Master Mix, 4444964) to determine the mRNA level of AGT at various concentrations, and the IC50 value was calculated. The test results are shown in Table 5. The in vitro activities of the conjugates SD004230, SD004231, and SD004232 were superior to those of the clinical compound SD003660.

[0265] Target gene AGT primers and probes:

[0266] Forward primer: GTATGTACACCCGGTCACC (SEQ ID NO: 24);

[0267] Reverse primer: GTTGTTCTGGGTACTACAGCA (SEQ ID NO: 25);

[0268] Probe: CATCCTCTGCCTCCTGGCCTG (SEQ ID NO: 26);

[0269] Primers and probes for internal reference gene β-actin:

[0270] Forward primer: TGCACCACCAACTGCTTAGC (SEQ ID NO: 27);

[0271] Reverse primer: ACTGTGGTCATGAGTCCTTCCA (SEQ ID NO: 28);

[0272] Probe: TCATCCATGACAACTTTGGTA (SEQ ID NO: 29);

[0273] Table 4: In vitro activity test sequences

[0274]

[0275] The abbreviations in the above table represent the following meanings:

[0276]

[0277]

[0278] Table 5: IC of siRNA test subjects in vitro 50

[0279] serial number <![CDATA[IC 50 (nM)]]> Emax% SD003660 0.0674 96.09％ SD004230 0.0282 97.01％ SD004231 0.0225 97.07％ SD004232 0.0395 95.87％

[0280] Example 4 Activity of the conjugate tested in mice

[0281] At least 14 days before the administration of the conjugate, six to eight week old female Bab / C mice were injected with high pressure tail vein injection to construct humanized AGT-expressing mice. As previously described, 2ug of plasmid containing AGT mRNA sequence was injected into mice through the tail vein within 5-7 seconds to generate AGT-SEAP model mice (Zhang G et al., "High levels of foreign gene expression in hepatocytes after tail vein injection of naked plasmid DNA." Human Gene Therapy 1999 Vol. 10, p1735-1737.). The inhibition of AGT expression by AGT siRNA conjugate leads to the inhibition of SEAP expression. One day before administration, blood was collected by orbital bleeding and serum was collected with Phospha-Light according to the product instructions. TMSEAP reporter gene analysis system (Invitrogen) was used to measure the SEAP expression level in serum, and mice were grouped according to the average SEAP level. The experimental group mice were given the conjugate, and the vehicle group mice were given phosphate buffered saline (PBS), and the conjugate was administered subcutaneously at a dose of 1 mg / kg per mouse. Blood was collected again on days 7, 14, and 20 after administration, and serum was collected and analyzed using Phospha-Light according to the product instructions. TM SEAP expression levels in serum were measured using the SEAP reporter gene assay system (Invitrogen). The SEAP level after dosing in each animal was divided by the SEAP level before dosing in that animal to determine the "normalized to pre-treatment" expression ratio.

[0282] The results are expressed as the residual expression level of serum SEAP before and after administration of each group (the vehicle group is 100%). The sequence of the conjugate used for injection is shown in Table 6, and the relative residual expression level of SEAP-AGT is shown in Figure 1 As shown, the conjugates SD004230, SD004231, SD004232 and other compounds have excellent in vivo activity.

[0283] Table 6: In vivo activity test sequences

[0284]

[0285] The abbreviations in the above table represent the following meanings:

[0286] abbreviation Nucleotides A 2'-Fluoroadenosine-3'-phosphate Af 2'-Fluoroadenosine-3'-phosphorothioate Cf 2'-Fluorocytidine-3'-phosphate Cfs 2'-Fluorocytidine-3'-phosphorothioate Gf 2'-Fluoroguanosine-3'phosphate Gf 2'-Fluoroguanosine-3'-phosphorothioate Uf 2'-Fluorouridine-3'-phosphate Ufs 2'-Fluorouridine-3'-phosphorothioate Am 2'-O-methyladenosine-3'-phosphate Ams 2'-O-methyladenosine-3'-phosphorothioate Cm 2'-O-methylcytidine-3'-phosphate Cms 2'-O-methylcytidine-3'-phosphorothioate Gm 2'-O-methylguanosine-3'-phosphate Gm 2'-O-methylguanosine-3'-phosphorothioate Um 2'-O-methyluridine-3'-phosphate Ums 2'-O-methyluridine-3'-phosphorothioate s Phosphorothioate Linker VP Vinyl-phosphate

[0287] References:

[0288] 1.Haase N,Foster DJ,Cunningham MW,Bercher J,Nguyen T,Shulga-MorskayaS,Milstein S,Shaikh S,Rollins J,Golic M,Herse F, K,Bendix I,Serdar M,Napieczynska H,Heuser A,Gellhaus A,Thiele K,Wallukat G,Müller DN,LaMarca B,Dechend R.RNA interference therapeutics targeting angiotensinogen amelioratepreeclamptic phenotype in rodent models.J Clin Invest.2020Jun. 1;130(6):2928-2942.

[0289] 2.Uijl E,Mirabito Colafella KM,Sun Y,Ren L,van Veghel R,Garrelds IM,de Vries R,Poglitsch M,Zlatev I,Kim JB,Hoorn EJ,Foster D,Danser AHJ.Strongand Sustained Antihypertensive Effect of Small Liver Targeting Targeting Angiotensinogen.Hypertension.2019Jun;73(6):1249-1257.

Claims

1. An siRNA comprising a sense strand and an antisense strand, wherein each nucleotide in the siRNA is independently a modified or unmodified nucleotide, wherein the sense strand contains a nucleotide sequence I, and the antisense strand contains a nucleotide sequence II, wherein the nucleotide sequence I and the nucleotide sequence II are at least partially reverse-complemented to form a double-stranded region, wherein the nucleotide sequence I and the nucleotide sequence II are selected from the following sequences: (1) The nucleotide sequence I comprises the nucleotide sequence shown in SEQ ID NO: 1, and the nucleotide sequence II comprises the nucleotide sequence shown in SEQ ID NO: 33: 5'-UCAACUGGAUGAAGAAACA-3'(SEQ ID NO:1) 5'-UGUUUCUUCCAGUUGA-3' (SEQ ID NO: 33).

2. The siRNA according to claim 1, wherein the nucleotide sequence I and the nucleotide sequence II are substantially reverse complementary, essentially reverse complementary or completely reverse complementary; the substantially reverse complementary means that there are no more than 3 base mismatches between the two nucleotide sequences; the substantially reverse complementary means that there are no more than 1 base mismatch between the two nucleotide sequences; the completely reverse complementary means that there is no mismatch between the two nucleotide sequences.

3. The siRNA according to claim 1 or 2, wherein the sense strand further contains a nucleotide sequence III, and the antisense strand further contains a nucleotide sequence IV, and the lengths of the nucleotide sequence III and the nucleotide sequence IV are each independently 0 to 4 nucleotides, wherein the nucleotide sequence III is connected to the 5' end of the nucleotide sequence I, and the nucleotide sequence IV is connected to the 3' end of the nucleotide sequence II, and the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary; the substantially reverse complementary means that there is no more than one base mismatch between the two nucleotide sequences; the completely reverse complementary means that there is no mismatch between the two nucleotide sequences; and / or, the nucleotide sequence III is connected to the 3' end of the nucleotide sequence I, and the nucleotide sequence IV is connected to the 5' end of the nucleotide sequence II, and the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary; the substantially reverse complementary means that there is no more than one base mismatch between the two nucleotide sequences; the completely reverse complementary means that there is no mismatch between the two nucleotide sequences.

4. The siRNA according to any one of claims 1 to 3, wherein the sense strand further contains a nucleotide sequence V and / or the antisense strand further contains a nucleotide sequence VI, the length of the nucleotide sequences V and VI is 0 to 4 nucleotides, the nucleotide sequence V is connected to the 3' end of the sense strand to form a 3' overhang of the sense strand and / or the nucleotide sequence VI is connected to the 3' end of the antisense strand to form a 3' overhang of the antisense strand; preferably, the length of the nucleotide sequence V or VI is 2 nucleotides; more preferably, the bases of the nucleotide sequence V or VI are two consecutive guanines or two consecutive uracils; or, the nucleotide sequence V or VI is mismatched or complementary to the nucleotides at the corresponding positions of the target mRNA.

5. The siRNA according to any one of claims 1 to 4, wherein at least one nucleotide in the sense strand or the antisense strand is a modified nucleotide, and / or at least one phosphate group is a phosphate group having a modified group; preferably, the phosphate group having a modified group is a thiophosphate group formed by replacing at least one oxygen atom in the phosphodiester bond in the phosphate group with a sulfur atom.

6. The siRNA according to any one of claims 1 to 5, wherein The 5' terminal nucleotide of the sense strand is linked to a 5' phosphate group or a 5' phosphate-derivative group, and / or the 5' terminal nucleotide of the antisense strand is linked to a 5' phosphate group or a 5' phosphate-derivative group.

7. The siRNA according to any one of claims 1 to 6, wherein the modified nucleotides are selected from 2'-fluoro-modified nucleotides, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, nucleotide analogs or a combination of any two or more thereof.

8. The siRNA according to any one of claims 1 to 7, wherein The modified nucleotides are selected from 2'-fluoro modified nucleotides, 2'-methoxy modified nucleotides, 2'-O-CH2-CH2-O-CH3 modified nucleotides, 2'-O-CH2-CH=CH2 modified nucleotides, 2'-CH2-CH2-CH=CH2 modified nucleotides, 2'-deoxy nucleotides, nucleotide analogs or a combination of any two or more thereof.

9. The siRNA according to any one of claims 1 to 8, wherein each nucleotide in the sense strand and the antisense strand is independently a 2'-fluoro-modified nucleotide or a non-fluoro-modified nucleotide; Preferably, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 8 and 9 of the sense strand, and the remaining positions are non-fluoro-modified nucleotides; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are non-fluoro-modified nucleotides.

10. The siRNA according to any one of claims 1 to 9, wherein at least one of the following linkages between nucleotides in the siRNA is a phosphorothioate linkage: The connection between the first nucleotide and the second nucleotide at the 5' end of the sense strand; The connection between the second nucleotide and the third nucleotide at the 5' end of the sense strand; The connection between the first nucleotide and the second nucleotide at the 3' end of the sense strand; The connection between the second nucleotide and the third nucleotide at the 3' end of the sense strand; The connection between the first nucleotide and the second nucleotide at the 5' end of the antisense strand; The connection between the second nucleotide and the third nucleotide at the 5' end of the antisense strand; The connection between the first nucleotide and the second nucleotide at the 3' end of the antisense strand; The connection between the second nucleotide and the third nucleotide at the 3' end of the antisense strand.

11. The siRNA according to any one of claims 1 to 10, wherein, in the 5' to 3' direction, the sense strand comprises a phosphorothioate group located at the following positions: Between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand; Between the second nucleotide and the third nucleotide starting from the 5' end of the sense strand; Between the first nucleotide and the second nucleotide starting from the 3' end of the sense strand; Between the second nucleotide and the third nucleotide starting from the 3' end of the sense strand; or, The sense strand contains phosphorothioate groups located at the positions shown below: Between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand; The positive strand is located between the second nucleotide and the third nucleotide starting from the 5' end.

12. The siRNA according to any one of claims 1 to 11, wherein, in the 5' to 3' direction, the antisense strand comprises a phosphorothioate group located at the following positions: Between the first nucleotide and the second nucleotide starting from the 5' end of the antisense strand; Between the second nucleotide and the third nucleotide starting from the 5' end of the antisense strand; Between the first nucleotide and the second nucleotide starting from the 3' end of the antisense strand; The antisense strand is located between the second nucleotide and the third nucleotide starting from the 3' end.

13. The siRNA according to any one of claims 9 to 12, wherein each non-fluorinated modified nucleotide is independently selected from a nucleotide or nucleotide analogue in which the hydroxyl group at the 2' position of the ribose group of the nucleotide is substituted by a non-fluorinated group, and the nucleotide analogue is selected from one of isonucleotides, LNA, ENA, cET BNA, UNA, GNA and SAFE-01.

14. The siRNA according to claim 13, wherein each nucleotide in the sense strand and the antisense strand is independently a 2'-fluoro-modified nucleotide, a 2'-methoxy-modified nucleotide, SAFE-01, or a combination of any two or more thereof; Preferably, from 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 8 and 9 of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides; from 5' to 3' direction, the 2'-fluoro-modified nucleotides may be located at positions 2, 6, 14 and 16 of the antisense strand, SAFE-01 may be located at position 6 or 7 of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides.

15. The siRNA according to claim 1, which is selected from the siRNAs in Table 1 and Table 2. 16 . An siRNA conjugate, comprising the siRNA according to claim 1 and a conjugation group conjugated to the siRNA. 17 . The siRNA conjugate according to claim 16 , wherein the conjugated group comprises a pharmaceutically acceptable targeting group and a linker, and the siRNA, the linker and the targeting group are sequentially covalently or non-covalently linked.

18. The siRNA conjugate according to claim 17, wherein the siRNA conjugate has the following structure: in, represents a duplex formed by the siRNA of the present disclosure; X is O or S.

19. A pharmaceutical composition comprising the siRNA according to any one of claims 1 to 15, or the siRNA conjugate according to any one of claims 16 to 18, and a pharmaceutically acceptable carrier. 20 . A kit comprising the siRNA according to claim 1 , or the siRNA conjugate according to claim 16 , or the pharmaceutical composition according to claim 19 .

21. Use of the siRNA according to any one of claims 1 to 15, or the siRNA conjugate according to any one of claims 16 to 18, or the pharmaceutical composition according to claim 19 for preparing a medicament for regulating the expression of angiotensinogen AGT.

22. Use of the siRNA according to any one of claims 1 to 15, or the siRNA conjugate according to any one of claims 16 to 18, or the pharmaceutical composition according to claim 19 for preparing a medicament for treating and / or preventing diseases associated with angiotensinogen AGT expression.

23. The use according to claim 22, wherein the diseases associated with the expression of angiotensinogen AGT include critical hypertension, essential hypertension, secondary hypertension, isolated systolic or diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt's hypertension, hypertension associated with low plasma renin activity or plasma renin concentration, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension; hypertensive heart disease, high Hypertensive nephropathy, atherosclerosis, arteriosclerosis, vascular disease, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, nocturnal hypertension, glomerulosclerosis, aortic coarctation, aortic aneurysm, ventricular fibrosis, heart failure, myocardial infarction, angina pectoris, stroke, kidney disease, renal failure, systemic sclerosis, intrauterine growth retardation (IUGR), fetal growth restriction, obesity, hepatic steatosis / fatty liver, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD); glucose intolerance, type 2 diabetes and metabolic syndrome.

24. A method for regulating the expression of angiotensinogen AGT, comprising contacting a therapeutically effective amount of the siRNA according to any one of claims 1 to 15, or the siRNA conjugate according to any one of claims 16 to 18, or the pharmaceutical composition according to claim 19 with a cell expressing angiotensinogen AGT or administering it to a subject in need thereof.

25. A method for treating and / or preventing a disease associated with angiotensinogen AGT expression, comprising administering a therapeutically effective amount of the siRNA according to any one of claims 1 to 15, or the siRNA conjugate according to any one of claims 16 to 18, or the pharmaceutical composition according to claim 19 to a subject in need thereof.

Images