VNAR single-domain antibody phage display library and construction method thereof

Abstract

The invention discloses a vNAR single-domain antibody bacteriophage display library and a construction method thereof, and belongs to the technical field of biologica.By providing a separation method of IgNAR positive B cells targeting specific antigens, B cells of the type required for construction of the vNAR single-domain antibody bacteriophage library are accurately obtained, and the construction of the vNAR single-domain antibody bacteriophage display library is facilitated. An amplification primer combination designed on the basis of mRNA sequence characteristics of antibody genes of three types of IgNAR of striped bamboo shark is used for PCR amplification, and when the vNAR single-domain antibody phage library is finally constructed and formed, the proportion of low-efficiency antibodies in the antibody library can be remarkably reduced, so that the efficiency of screening high-affinity antibodies is improved.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a vNAR single domain antibody phage display library and a construction method thereof. Background Art

[0002] Antibodies, also known as immunoglobulins, are special proteins produced by the body's immune system in response to foreign pathogens, such as bacteria and viruses. The typical structure of conventional antibodies consists of two homologous heavy chains and two homologous light chains, forming a "Y-shaped" molecule. In cartilaginous fish, in addition to conventional antibodies, there is also an antibody that naturally lacks light chains and consists of only two homologous heavy chains, which is named immunoglobulin new antigen receptor (Ig new antigen receptor, IgNAR). The heavy chain variable region structure of IgNAR, vNAR (variable new antigen receptor), is the smallest molecular fragment known to have complete antigen binding function. The molecular weight is about 12-18kd, which is only about 1 / 10 of the conventional IgG antibody, so it is named single-domain antibody or nanobody. Compared with traditional conventional antibodies, vNAR has unique advantages such as the ability to recognize hidden antigen epitopes, good tissue permeability, strong physical and chemical stability and stress resistance, simple structure and easy expression, and low production cost. In recent years, vNAR has attracted attention in the fields of biomedicine, life sciences, and genetic engineering technology, and has been used in the development of a variety of in vitro diagnostic reagents and disease treatment drugs.

[0003] Among the many shark species, the bamboo shark is small in size, docile in behavior, easy to artificially breed, widely distributed in my country's waters, and not included in the list of protected animals. It has become the mainstream species used in the preparation and development of vNAR single-domain antibodies in my country. At present, the development and preparation technology of vNAR antibodies is relatively mature, but there are still two technical problems that cannot be ignored in the construction of vNAR antibody libraries.

[0004] First, in terms of the separation of immune cells, currently, immune B cells are mainly isolated from the blood and spleen of bamboo sharks through physical methods such as density gradient centrifugation. The shortcomings are that, firstly, in addition to IgNAR, sharks also have two immunoglobulins, IgM and IgW, and this method cannot separate and obtain IgNAR-specific immune B cells; secondly, in addition to receiving specific antigen immunization, sharks are always exposed to other immunogens in the breeding environment, such as pathogens, and this separation method cannot obtain specific antigen-specific immune B cells.

[0005] Secondly, the existing amplification primers of vNAR genes are either designed for the DNA sequences of the five gene clusters encoding IgNAR of the striped bamboo shark, and more than ten pairs of primers are needed for library construction; or only one pair of forward and reverse primers are used for PCR amplification. The shortcomings are that, firstly, although there are many gene clusters encoding IgNAR, the inventors' previous research found that the five IgNAR gene clusters in the genome of the striped bamboo shark are divided into three subtypes according to their sequence characteristics at the transcription level, so the amplification primers only need to be designed for the sequence characteristics of the three subtypes of IgNAR. Too many primers not only increase the workload, but also may lead to redundancy and increase the difficulty of screening.

[0006] The inventors have previously found that in the immune cells of bamboo sharks, there are mRNA fragments of truncated and full-length IgNAR genes. Truncated antibody fragments can be detected in multiple organs. In vitro translation revealed that the antibodies formed by truncated fragments have weak affinity for binding antigens, or do not have antigen binding ability at all, which may be transcriptional redundancy generated during antibody rearrangement; on the contrary, the heavy chain variable region of the full-length antibody gene fragment exhibits good antigen binding ability after in vitro translation. Therefore, if only a pair of primers both located in the heavy chain variable region are used for amplification, a high proportion of inefficient or ineffective antibodies will be obtained when screening using phage display.

[0007] Based on this, the present invention is proposed. Summary of the invention

[0008] In order to solve the problems existing in the construction of vNAR libraries in the prior art, the present invention provides a vNAR single-domain antibody phage display library and a construction method thereof, which accurately obtains the type of B cells required for vNAR library construction by providing a method for isolating IgNAR-positive B cells targeting specific antigens, and then utilizes the designed vNAR library amplification primer combination to significantly reduce the proportion of low-efficiency antibodies in the antibody library when reconstructing the vNAR library, thereby improving the efficiency of screening high-affinity antibodies.

[0009] The scheme of the present invention is as follows:

[0010] The present invention provides a method for constructing a vNAR single domain antibody phage display library, comprising the following steps:

[0011] S1: Blood of the striped bamboo shark after antigen immunization was collected using an anticoagulant tube, and peripheral blood lymphocytes were separated by horizontal centrifugation using a Percoll solution with a mass concentration gradient of 34%-51%;

[0012] S2: fluorescently labeling the secondary antibody of the striped bamboo shark heavy chain antibody IgNAR with cyanine dye Cy5.5, and separating IgNAR immunoglobulin-positive immune B cells from the peripheral blood lymphocytes in step S1 by flow cytometry sorting;

[0013] S3: using fluorescein isothiocyanate (FITC) to label the antigen protein, and then separating the antigen-targeted IgNAR-positive immune B cells from the IgNAR immunoglobulin-positive immune B cells in step S2 by flow cytometry sorting again;

[0014] S4: extracting total RNA from the antigen-targeted IgNAR-positive immune B cells in step S3 and reversely transcribing it into cDNA;

[0015] S5: using cDNA as a template, performing two rounds of PCR reactions using a combination of PCR amplification primers, purifying the PCR products, and obtaining purified vNAR gene fragments;

[0016] S6: The purified vNAR gene fragment obtained in step S5 is integrated into the pComb3XSS phagemid vector through homologous recombination to construct a recombinant phagemid; the recombinant phagemid is electroporated into TG-1 competent cells to obtain a vNAR single domain antibody phage display library.

[0017] Furthermore, the PCR amplification primers in step S5 are designed based on the sequence characteristics of the full-length antibody genes of the three subtypes of IgNAR of the striped bamboo shark; including a first-round amplification primer pair and a second-round amplification primer pair; the first-round amplification primer pair comprises an upstream primer as shown in SEQ ID No: 1 and a downstream primer as shown in SEQ ID No: 2; the second-round amplification primer pair comprises two pairs of primer combinations, namely, an upstream primer as shown in SEQ ID No: 3 and a downstream primer as shown in SEQ ID No: 4, and an upstream primer as shown in SEQ ID No: 5 and a downstream primer as shown in SEQ ID No: 6.

[0018] Furthermore, the ratio of the two pairs of primer combinations in the second round of amplification primer pairs is an equimolar ratio.

[0019] Furthermore, in the second round of PCR reaction, the upstream primers shown in SEQ ID No: 3 and SEQ ID No: 5 were mixed at a ratio of 3:1, and the downstream primers shown in SEQ ID No: 4 and SEQ ID No: 5 were mixed at a ratio of 3:1.

[0020] The present invention also provides a vNAR single domain antibody phage display library, which is constructed using the above construction method.

[0021] Furthermore, the library capacity is 3.72×107 .

[0022] The present invention also provides a primer combination for constructing a vNAR single domain antibody phage display library, comprising primers as shown in SEQ ID Nos: 1 to 6.

[0023] Compared with the prior art, the beneficial effects of the present invention are:

[0024] 1. In the construction method of the vNAR single-domain antibody phage display library provided by the present invention, an antigen-targeted IgNAR-positive immune B cell separation method is provided, which can accurately obtain the B cells of the required type for vNAR library construction, exclude the interference of non-specific immune cells, including non-IgNAR immunoglobulin-positive B cells, and IgNAR-positive B cells targeting other antigens, thereby improving the targeting and specificity of the vNAR antibody library, thereby improving the efficiency of enriching specific antibodies during antibody screening, reducing the number of cycles required for antibody screening, and thus reducing the workload of antibody library screening.

[0025] 2. In the construction of the existing vNAR single-domain antibody phage display library, the primer combination is mainly designed based on the IgNAR gene cluster sequence of the striped bamboo shark genome, including 10-50 primers, and is composed of non-equal proportions, which makes the operation complicated during PCR; the primer combination for constructing the vNAR single-domain antibody phage display library provided by the present invention is based on the commonality analysis of the three types of IgNAR sequences of the striped bamboo shark, while avoiding inefficient or invalid truncated IgNAR gene fragments. It is composed of only three primer pairs, which is not only simple to operate during PCR, but also can significantly reduce the proportion of low-efficiency antibodies in the antibody library when constructing the vNAR antibody library, thereby improving the efficiency of screening high-affinity antibodies. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Schematic diagram of flow cytometry sorting of antigen-targeted IgNAR-positive immune B cells in Example 3;

[0027] Figure 2 The gel electrophoresis detection results of the nested first round PCR amplification performed by the Primer-F1 / R1 primers provided in Example 4, and the nested second round PCR amplification performed by the Primer-F2 / R2 and Primer-F3 / R3 primers;

[0028] Figure 3 Comparison of the enrichment of specific vNAR single domain antibodies in antibody screening of the vNAR antibody library constructed based on the technical solution of the present invention and the conventional method in Example 5;

[0029] Figure 4This is a schematic diagram of the SDS-PAGE gel electrophoresis results of vNAR single domain antibodies targeting the same antigen from the vNAR antibody library constructed based on the technology of the present invention and the conventional methods in Example 6;

[0030] Figure 5 This is a comparison of the affinities of vNAR single domain antibodies targeting the same antigen screened based on the technology of the present invention and the existing conventional methods in Example 6. DETAILED DESCRIPTION

[0031] The invention is further described in detail below with specific implementation methods.

[0032] The present invention is described with reference to specific embodiments, however, various modifications and variations may be made without departing from the spirit and scope of the present invention. Therefore, the description and drawings of the present invention should be considered as illustrative rather than restrictive.

[0033] Unless otherwise specified, various materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0034] Example 1

[0035] This example provides a method for constructing a vNAR single domain antibody phage display library, comprising the following steps:

[0036] S1: Blood of the striped bamboo shark after antigen immunization was collected using an anticoagulant tube, and peripheral blood lymphocytes were separated by horizontal centrifugation using a Percoll solution with a mass concentration gradient of 34%-51%;

[0037] S2: fluorescently label the secondary antibody of the striped bamboo shark heavy chain antibody IgNAR with cyanine dye Cy5.5, add the fluorescently labeled antibody after resuspending the PBMC cells obtained in step S1, incubate on ice, and then separate IgNAR immunoglobulin-positive immune B cells from the peripheral blood lymphocytes in step S1 by flow cytometry sorting;

[0038] S3: using fluorescein isothiocyanate (FITC) to label the antigen protein, co-incubating the IgNAR-positive immune B cells obtained by sorting in step S2 with the FITC-labeled antigen protein on ice, and then sorting by flow cytometry again to separate the antigen-targeted IgNAR-positive immune B cells from the IgNAR immunoglobulin-positive immune B cells in step S2;

[0039] S4: extracting total RNA from the antigen-targeted IgNAR-positive immune B cells in step S3 and reversely transcribing it into cDNA;

[0040] S5: Using cDNA as template, two rounds of PCR reactions were performed using PCR amplification primer combinations.

[0041] Purifying the PCR product to obtain a purified vNAR gene fragment;

[0042] The PCR amplification primers are designed based on the sequence characteristics of the full-length antibody genes of the three subtypes of IgNAR of the striped bamboo shark; including a first-round amplification primer pair and a second-round amplification primer pair;

[0043] The first round amplification primer pair comprises an upstream primer (Primer-F1) as shown in SEQ ID No: 1 and a downstream primer (Primer-R1) as shown in SEQ ID No: 2; in the first round of PCR amplification, cDNA is used as a template, Primer-F1 / R1 is used as a primer pair for nested first round PCR amplification, a PCR reaction is performed, and the PCR product is purified;

[0044] The second round amplification primer pair includes 2 pairs of primer combinations, namely, the upstream primer (Primer-F2) shown in SEQ ID No:3 and the downstream primer (Primer-R2) shown in SEQ ID No:4, and the upstream primer (Primer-F3) shown in SEQ ID No:5 and the downstream primer (Primer-R3) shown in SEQ ID No:6; the 5' end of the second round amplification primer is added with SfiI restriction site and protective base, which can be used for phage display library construction; high-throughput sequencing adapters are added on both sides of the second round amplification primer, which can be used for sequencing on a second-generation sequencing platform; in the second round of PCR amplification, the PCR product obtained after the first round of amplification is used as a template, Primer-F2 / R2 and Primer-F3 / R3 with Sfi I restriction site and protective base added at both ends are used as a nested second round PCR amplification primer pair, the two primer pairs are mixed at a ratio of 1:1, a PCR reaction is carried out, and the PCR product is purified to obtain a purified vNAR gene fragment;

[0045] Among them, the upstream primers shown in SEQ ID No:3 (Primer-F2) and the upstream primer shown in SEQ ID No:5 (Primer-F3) are mixed at a ratio of 3:1, and the upstream primer shown in SEQ ID No:5 (Primer-F3) and the downstream primer shown in SEQ ID No:6 (Primer-R3) are mixed at a ratio of 3:1;

[0046] S6: The purified vNAR gene fragment obtained in step S5 is integrated into the pComb3XSS phagemid vector through homologous recombination to construct a recombinant phagemid; the recombinant phagemid is electroporated into TG-1 competent cells to obtain a vNAR single domain antibody phage display library.

[0047] In the following examples, the technical process of obtaining human Irisin single-domain antibodies is taken as an example, and the steps of isolating IgNAR-positive immune B cells targeting antigens and amplifying vNAR gene fragments in the vNAR library construction and antibody screening process are described in detail.

[0048] Example 2

[0049] The blood of the striped bamboo shark after antigen immunization was collected by using an anticoagulant tube, and the peripheral blood lymphocytes were separated by horizontal centrifugation using a Percoll solution with a mass concentration gradient of 34%-51%. The specific steps are as follows;

[0050] a) Immunizing the striped bamboo shark with human Irisin recombinant protein using conventional methods; after the immunization, extracting shark venous blood (30 mL) and diluting the blood 4 times with DMEM culture medium;

[0051] b) Prepare a 34%-51% Percoll gradient: add 4 ml of 34% Percoll solution to a 15 mL centrifuge tube, and then slowly add 4 ml of 51% Percoll solution to the bottom of the tube;

[0052] c) Slowly add the Percoll gradient solution to the diluted blood (5 mL) and centrifuge at 400 g at 4°C for 30 min;

[0053] d) Collect about 5 mL of the milky white leukocytes at the interface of 34%-51% Percoll, transfer to a 15 mL centrifuge tube, add 5 mL of DMEM medium containing sodium heparin, mix well, and centrifuge at 400g, 4°C for 30 min;

[0054] e) Remove the supernatant, add 10 mL of DMEM medium containing sodium heparin to resuspend the cells, and then centrifuge at 400g for 10 min at 4°C;

[0055] f) Add RPMI-1640 medium containing 2% fetal bovine serum (FBS) and P / S dual antibody, resuspend the cells, count the cell concentration using a hemocytometer, and adjust the cell concentration to 2×10 6 / mL, and peripheral blood lymphocytes (PBMC cells) were obtained.

[0056] Example 3

[0057] IgNAR-positive immune B cells targeting Irisin were obtained by 2 flow cytometry sorting. The specific steps are as follows:

[0058] a) fluorescently labeling the IgNAR antibody of the bamboo shark with cyanine dye Cy5.5; PBMC cells (2×10 6 The cells were resuspended in 200 μL of PBS solution containing 2% FBS, and fluorescent-labeled antibodies were added. The cells were incubated on ice for 1 hour and vortexed every 15 minutes. After the incubation, the cells were centrifuged at 400 g for 10 minutes, the supernatant was discarded, 1 mL of PBS-2% FBS was added, and the washing was repeated 2-3 times. The cells were resuspended in 200 μL of PBS-2% FBS, and the cells were sorted using the 596 nm channel of a flow cytometer. IgNAR-positive immune B cells were successfully isolated from the PBMC cell population. The results are shown in FIG. Figure 1 As shown in A.

[0059] The antibody of the striped bamboo shark IgNAR in this embodiment is a polyclonal antibody of the striped bamboo shark single domain antibody in the applicant's previously disclosed patent with application number CN202111132704.0.

[0060] b) The recombinant Irisin protein was labeled with FITC, and the IgNAR-positive immune B cells obtained by the sorting in the previous step were co-incubated with the FITC-Irisin protein on ice for 1 hour, and vortexed every 15 minutes; after the incubation, 400g was centrifuged for 10 minutes, the supernatant was discarded, 1mL PBS-2% FBS was added, and the washing was repeated 2-3 times, and the cells were resuspended with 200μL PBS-2% FBS. The cells were sorted using a flow cytometer at 488nm channel, and the IgNAR-positive immune B cells targeting Irisin (for the convenience of description, referred to as specific B cells in the following examples) were successfully isolated. The results are shown in FIG. Figure 1 As shown in B; after cell counting, the total number of specific B cells obtained was approximately 5.36×10 7 On the other hand, approximately the same amount of unsorted PBMC cells were retained as a control for subsequent experiments.

[0061] Example 4

[0062] The total RNA of the specific B cells and unsorted PBMC cells obtained in Example 2 was extracted by the Trizol method and reverse transcribed into cDNA. The cDNA of the specific B cells was used as a template, and IgNAR-Primer F1 and IgNAR-PrimerR1 were used as the upstream and downstream primers to perform a nested first round of amplification. The PCR amplification system is shown in Table 1:

[0063] Table 1 Nested first round amplification system

[0064]

[0065] The reaction conditions of PCR were as follows: 95°C, 1 min; 95°C, 15 s; 58°C, 30 s; 72°C, 1.5 min; 28 cycles; 72°C, 10 min; the results of the first round of nested amplification are shown in Figure 2 A.

[0066] After the PCR product was purified, it was used as a PCR amplification template. vNAR-Primer F2 and vNAR-Primer F3 were mixed in a ratio of 3:1 as upstream primers, and vNAR-Primer R2 and vNAR-Primer R3 were mixed in a ratio of 3:1 as downstream primers for a nested second round of amplification. The PCR amplification system is shown in Table 2:

[0067] Table 2 Nested second round amplification system

[0068]

[0069] The reaction conditions of PCR were as follows: 95°C, 1 min; 95°C, 15 s; 58°C, 30 s; 72°C, 1.5 min; 32 cycles; 72°C, 10 min; the results of the nested second round of amplification are shown in Figure 2 B.

[0070] The sequences of the upstream and downstream primers IgNAR-Primer F1 and IgNAR-Primer R1 are as follows:

[0071] Primer F1: ATGAATATTTTKTTGYTTRCGKKCCTTTTAD;

[0072] Primer R1: TTMTGKGCMGGATYTARCAATGTCG;

[0073] In the above primers, D, M, K, R, and Y represent degenerate bases, as shown in the degenerate base table:

[0074] Table 3 Degenerate base table

[0075] Code Base D A, G, T M A.C K G.T R A.G. Y C.T

[0076] The sequences of the upstream and downstream primers vNAR-Primer F2, vNAR-Primer R2, vNAR-Primer F3, and vNAR-PrimerR3 are as follows:

[0077] Primer F2:GCATGGGTTGAGCAATCACG;

[0078] Primer R2:TTTCACTGTTAGAAAAGTGCC;

[0079] Primer F3:CAACGGGTTGAAAAACACC;

[0080] Primer R3: TTTGCCAGGTTTCACAGTCAG;

[0081] On the other hand, PCR amplification was performed using the cDNA of undifferentiated PBMC cells as a template. The specific primers and operation procedures used referred to the implementation method described in the applicant's previously disclosed invention patent with application number CN202110589206.2.

[0082] Example 5

[0083] The vNAR gene fragment obtained by PCR amplification using the specific B cell cDNA as a template and the primer combination in Example 3 was used as the experimental group; at the same time, the vNAR gene fragment obtained by PCR amplification using the undifferentiated PBMC cell cDNA as a template and the commonly used primers was used as the control group, and they were respectively connected into the pComb3xss phagemid vector to construct a recombinant phagemid vector; the constructed recombinant phagemid vector was transferred into XL1-Blue competent cells by electroporation to obtain a single domain antibody cDNA library, that is, the vNAR single domain antibody phage display library of the present invention.

[0084] The library capacity of the antibody library constructed by IgNAR-positive immune B cells targeting Irisin and unsorted PBMC cells was 3.72×10 7 and 4.36×10 7 .

[0085] Phage display was used for panning, and a total of 3 rounds of screening were performed. In each round of screening, the phage antibody library was tested for antigen-specific antibody enrichment by iELISA. The preparation method of the phage antibody library is as follows:

[0086] The primary / secondary antibody cDNA library was inoculated into 100 mL 2xYTG medium (containing 2% glucose, 100 μg / mL ampicillin and 50 μg / mL tetracycline) and cultured at 37°C and 250 rpm until the bacterial density OD 600 Up to 0.5;

[0087] Join 10 12 pfu VCSM13 helper phage, after standing at room temperature for 15 min, cultured at 37°C and 150 rpm for 1 h; centrifuged at 4000 rpm to collect the bacteria;

[0088] Use 200mL of 2xYTG amp+tet+kana Resuspend the cells in the culture medium and culture at 37°C with shaking at 250 rpm for 16 h;

[0089] The cultured bacterial liquid was transferred to a sterile centrifuge tube, centrifuged at 12000 rpm and 4°C for 20 min, the supernatant was collected, and 1 / 4 volume of PEG / NaCl solution was added, and the mixture was allowed to stand at 4°C ice bath for 1 h to precipitate the phages; centrifuged at 10000 rpm and 4°C for 20 min, the precipitate was collected, and PBS was added to dissolve the precipitate, which is the phage antibody library.

[0090] The results of antigen-specific antibody enrichment test are as follows Figure 3 As shown, after the second round of screening, the enrichment of antigen-specific antibodies in the antibody library constructed based on the IgNAR-positive immune B cells targeting Irisin proposed in the present invention is better than the result of three rounds of screening of the antibody library constructed based on undifferentiated PBMC cells, which means that isolating IgNAR-positive immune B cells targeting Irisin for constructing an antibody library can not only improve the enrichment of antigen-specific antibodies and increase the probability of obtaining high-performance antibodies, but also reduce the number of antibody screening cycles, reduce the workload of antibody screening, and reduce manpower consumption.

[0091] Example 6

[0092] Expression of vNAR single-domain antibody targeting Irisin and determination of its affinity for antigen binding

[0093] Phage ELISA was used to screen out recombinant antibodies that were positive for the antigen Irisin, and the monoclone with the highest positive value was selected (the best positive clone selected from the antibody library constructed based on specific B cells was named SIC-I07, and the best positive clone selected from the antibody library constructed based on undifferentiated PBMC cells was named PMC-I23). The vNAR gene fragment of the best antibody clone selected from the two antibody libraries was cloned and connected into the Pet30a expression vector. After correct sequencing, it was transformed into the Ecoli Shuffle T7 host bacteria for expression. The expressed antibodies were affinity purified, and the molecular weights of the single-domain antibodies of SIC-I07 and PMC-I23 were 18.6kd and 16.4kd, respectively, as shown in the following figure. Figure 4 The antibodies were diluted to a consistent concentration (1 μg / mL) and the affinity of SIC-I07 and PMC-I23 binding to the antigen protein Irisin was measured by BLI (biomembrane interferometry). Figure 5As shown, the affinity of SIC-I07 single domain antibody binding to Irisin is 4.51±0.05 nM, while the affinity of PMC-I23 single domain antibody binding to Irisin is 19.1±0.51 nM. The affinity of SIC-I07 single domain antibody binding to Irisin protein is 4.25 times higher than that of PMC-I23 single domain antibody.

[0094] The above descriptions are merely embodiments of the present invention and are not intended to limit the patent scope of the present invention. Any equivalent structure or equivalent process transformation made using the contents of the present invention specification, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present invention.

Claims

1. A method for constructing a vNAR single domain antibody phage display library, characterized in that: The following steps are involved: S1: Blood of the striped bamboo shark after antigen immunization was collected using an anticoagulant tube, and peripheral blood lymphocytes were separated by horizontal centrifugation using a Percoll solution with a mass concentration gradient of 34%-51%; S2: fluorescently labeling the secondary antibody of the striped bamboo shark heavy chain antibody IgNAR with cyanine dye Cy5.5, and separating IgNAR immunoglobulin-positive immune B cells from the peripheral blood lymphocytes in step S1 by flow cytometry sorting; S3: using fluorescein isothiocyanate (FITC) to label the antigen protein, and then separating the antigen-targeted IgNAR-positive immune B cells from the IgNAR immunoglobulin-positive immune B cells in step S2 by flow cytometry sorting again; S4: extracting total RNA from the antigen-targeted IgNAR-positive immune B cells in step S3 and reversely transcribing it into cDNA; S5: using cDNA as a template, performing two rounds of PCR reactions using a PCR amplification primer combination, purifying the PCR products, and obtaining a purified vNAR gene fragment; S6: The purified vNAR gene fragment obtained in step S5 is integrated into the pComb3XSS phagemid vector through homologous recombination to construct a recombinant phagemid; the recombinant phagemid is electroporated into TG-1 competent cells to obtain a vNAR single domain antibody phage display library.

2. The method for constructing a vNAR single domain antibody phage display library according to claim 1, characterized in that: The PCR amplification primers in step S5 are designed based on the sequence characteristics of the full-length antibody genes of the three subtypes of IgNAR of the striped bamboo shark, including a first-round amplification primer pair and a second-round amplification primer pair; the first-round amplification primer pair comprises an upstream primer as shown in SEQ ID No: 1 and a downstream primer as shown in SEQ ID No: 2; the second-round amplification primer pair comprises two pairs of primer combinations, namely, an upstream primer as shown in SEQ ID No: 3 and a downstream primer as shown in SEQ ID No: 4, and an upstream primer as shown in SEQ ID No: 5 and a downstream primer as shown in SEQ ID No:

6.

3. The method for constructing a vNAR single domain antibody phage display library according to claim 2, characterized in that: The ratio of the two pairs of primer combinations in the second round of amplification primer pairs is an equimolar ratio.

4. The method for constructing a vNAR single domain antibody phage display library according to claim 3, characterized in that: In the second round of PCR reaction, the upstream primers shown in SEQ ID No: 3 and SEQ ID No: 5 were mixed at a ratio of 3:1, and the downstream primers shown in SEQ ID No: 4 and SEQ ID No: 5 were mixed at a ratio of 3:

1.

5. A vNAR single domain antibody phage display library, characterized in that: The vNAR single domain antibody phage display library is constructed by the construction method according to any one of claims 1 to 4.

6. A vNAR single domain antibody phage display library according to claim 5, characterized in that: The library capacity is 3.72×10 7 .

7. A primer combination for constructing a vNAR single domain antibody phage display library, characterized in that: The primer combination includes primers shown in SEQ ID Nos: 1 to 6.

Images