Primer, probe, kit and method for detecting polymorphic site of tacrolimus personalized medication guiding gene CYP3A5*3

Abstract

The invention discloses a tacrolimus personalized medication guiding gene CYP3A5 * 3 polymorphic site detection kit and a use method thereof, the kit utilizes an MGB probe and the energy difference of different polymorphic bases to directly judge the polymorphism of the gene through an amplification curve, and calculation and sequencing analysis are not needed. The kit comprises a pair of primers and a probe which are used for amplifying CYP3A5 * 3 polymorphic sites, the kit further comprises positive samples of three polymorphisms of CYP3A5 * 3CC, CT and TT. The CYP3A5 * 3 typing related sites can be rapidly detected, the sensitivity, specificity and accuracy are superior to those of a first-generation sequencing and double-probe calculation method, rapid and accurate information is provided for individualized drug administration of clinical transplantation patients, and rejection and other side effects after drug administration are avoided.

Description

Technical Field

[0001] The present invention belongs to the field of medicine and biotechnology, and specifically relates to primers and probes, a kit and a method for detecting polymorphic sites of CYP3A5*3, a gene guiding personalized medication of tacrolimus. Technical Background

[0002] Tacrolimus (FK-506) is a fermentation product isolated from Streptomyces. It is a macrolide antibiotic that selectively inhibits calcineurin and can reduce the transcription of IL-2 and some other cytokines in T lymphocytes. Immunosuppressants are drugs that have an inhibitory effect on the body's immune response. They can inhibit the proliferation and function of cells related to the immune response (T cells, B cells, macrophages, etc.) and reduce the body's immune response. As a common immunosuppressant, tacrolimus is mainly used for anti-rejection treatment of organ transplant patients. It is one of the most used immunosuppressants in the field of solid organ transplantation and is occasionally used to treat various immune-mediated diseases. In recent years, as a first-line drug for liver and kidney transplantation, this drug has been marketed in 14 countries including Japan and the United States.

[0003] Tacrolimus is the main immunosuppressive drug used after solid organ and hematopoietic stem cell transplantation. It is a drug with a narrow therapeutic window, and many factors may affect its pharmacokinetic and pharmacodynamic characteristics. For the sake of patient survival, it is crucial to avoid immunosuppression, under-immunosuppression, and over-immunosuppression. In clinical practice, oral tacrolimus usually reaches steady-state blood concentrations within about 72 hours. The pharmacokinetics of tacrolimus are complex and highly variable, especially after oral administration. The dose required to achieve similar exposure may vary from patient to patient by more than 10 times. Despite frequent responsive adjustments to tacrolimus TDM, the optimal dosing strategy to rapidly achieve therapeutic concentrations under adverse clinical conditions in the early postoperative period remains problematic.

[0004] Tacrolimus is a substrate of cytochrome P450 3A4 / 5 (CYP3A4 / 5) enzymes. The most important SNP affecting tacrolimus plasma concentration is rs776746, also known as CYP3A5 c.219-237TC. People with the CC genotype (also known as CYP3A5*3) are CYP3A5 non-expressers and obtain higher tacrolimus concentrations than people with the TT allele CYP3A5 expressers (also known as CYP3A5*1).

[0005] Since the polymorphism of CYP3A5 c.219-237 gene affects the personalized medication of tacrolimus, countries around the world have issued tacrolimus medication guidelines based on pharmacogenomics, and give initial tacrolimus medication recommendations based on the patient's CYP3A5*3 gene phenotype. The "Guidelines for the Detection of Drug Metabolizing Enzymes and Drug Target Genes (Trial)" issued by my country in 2015 also clearly emphasized that CYP3A5 plays an important role in the metabolism of tacrolimus. Its reduced activity can lead to increased tacrolimus blood concentrations and increased adverse reactions. Transplant patients carrying the CYP3A5*3 / *3 genotype should reduce the tacrolimus dosage to avoid adverse drug reactions. Mutations at this site cause changes in the mRNA splicing site, resulting in blocked CYP3A5 protein expression, changes in enzyme activity, and thus affecting the metabolic rate. According to the different phenotypes of CYP3A5*3, the population can be divided into fast metabolizers (*1 / *1), intermediate metabolizers (*1 / *3), and slow metabolizers (*3 / *3). Genotype testing and analysis were performed on the patients, and the tacrolimus dosage was adjusted according to the different phenotypes of the patients.

[0006] Based on the above background analysis, people also need to invent a test kit with simple and fast detection method and simple and accurate result judgment to adapt to personalized guidance on medication. Summary of the invention

[0007] The purpose of the present invention is to provide a tacrolimus personalized medication guidance gene CYP3A5*3 polymorphism site detection kit and its use method, which can be used to quickly detect the three genotypes of CYP3A5*3 by comprehensive application of QPCR method and various types of standard sample comparison analysis technology. The primers for detecting gene CYP3A5*3 polymorphism have the base sequence:

[0008] CYP3A5-MGB-F: 5'-AGCTTAACGAATGCTCTACTGTCA-3'

[0009] CYP3A5-MGB-R: 5'-ATATGATGAAGGGTAATGTGGTCCAAA-3'

[0010] CYP3A5-MGB-P1: 5'-FAM-TCTTTCAATATCTCTTCCCT-MGB-3'.

[0011] Furthermore, primers CYP3A5-MGB-F, CYP3A5-MGB-R and CYP3A5-MGB-P1 can be used to detect wild type c.219-237TT, heterozygous mutant c.219-237TC and homozygous mutant c.219-237CC.

[0012] The present invention also provides a method for detecting the CYP3A5*3c.219-237T>C gene polymorphism site, characterized in that it comprises the following steps:

[0013] (1) Extract genomic DNA from peripheral blood;

[0014] (2) DNA extracted from peripheral blood and wild-type control standard c.219-237TT, heterozygous mutant control standard c.219-237TC, and homozygous mutant control standard c.219-237CC were simultaneously amplified by QPCR, and the sample amplification curves and the amplification curves of the three control standards were obtained respectively.

[0015] (3) comparing the sample amplification curve in step (2) with the amplification curves of three control standards to directly obtain the polymorphism typing of the sample;

[0016] The primers and probes for QPCR are:

[0017] CYP3A5-MGB-F: 5'-AGCTTAACGAATGCTCTACTGTCA-3'

[0018] CYP3A5-MGB-R: 5'-ATATGATGAAGGGTAATGTGGTCCAAA-3'

[0019] CYP3A5-MGB-P1: 5'-FAM-TCTTTCAATATCTCTTCCCT-MGB-3'.

[0020] Furthermore, the present invention also provides a kit for detecting the CYP3A5*3c.219-237T>C gene polymorphism site, comprising the following components:

[0021] (1) Whole blood DNA extraction reagent;

[0022] (2) Primers for single QPCR amplification were mixed with 10 μM CYP3A5-MGB-F: CYP3A5-MGB-R: CYP3A5-MGB-P1 in the ratio of 0.1 μL: 0.1 μL: 0.05 μL. The final concentrations of the primers and probes in the total volume of 20 μL reaction system were 0.05 μM, 0.05 μM, and 0.025 μM, respectively. The sequences of the primers and probes were as follows:

[0023] CYP3A5-MGB-F: 5'-AGCTTAACGAATGCTCTACTGTCA-3'

[0024] CYP3A5-MGB-R: 5'-ATATGATGAAGGGTAATGTGGTCCAAA-3'

[0025] CYP3A5-MGB-P1: 5'-FAM-TCTTTCAATATCTCTTCCCT-MGB-3';

[0026] (3) Wild-type control samples include c.219-237TT, heterozygous mutant control sample c.219-237TC, and homozygous mutant control sample c.219-237CC;

[0027] (4) 2X reaction enzyme mixture.

[0028] Beneficial effects: (1) The present invention designs specific primers and probes for amplifying CYP3A5*3 polymorphic sites, wherein the 5' end of the probe is labeled with FAM, and the 3' end is labeled with MGB. On the other hand, the probe is designed as an MGB probe, and a minor groove binder (MGB) that can insert into the minor groove of DNA is added to the 3' end of the MGB probe, which can greatly improve the Tm value of the probe and increase the specificity of the hybridization reaction. The 5' end of the MGB probe is labeled with a fluorescent group, and the 3' end is labeled with a non-fluorescent quenching group NFQ. The signal generated by the fluorescent reporter group at the 5' end is quenched by the NFQ group, thereby avoiding the background generated by the traditional quenching group and reducing the fluorescent background signal. The design and sequence of the primers and probes of the present invention, such as Figure 1 As shown;

[0029] (2) Using DNA as a template, only one probe can be used to distinguish three types, namely TT, CT, and CC; only one base difference can completely distinguish the differences, because the polymorphic position of the probe for the three types of the present application is located in the middle when it is designed and can well distinguish different types based on energy;

[0030] (3) The kit of the present invention adds three types of standard substances. The type of the sample under test can be directly determined based on the degree of coincidence between the amplification line of the sample under test and the standard substance line, which is intuitive and accurate.

[0031] (4) The detection process is fast and sensitive, the operation is simple and the accuracy is high, and the test results are clear and explicit; the detection is highly specific and uses the most accurate gene mutation detection method currently available, which is highly targeted; the amount of blood collected for the test sample is small, and less experimental equipment is used, which saves costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 The specific designs and sequences of the primers (CYP3A5-MGB-F and CYP3A5-MGB-R) and probe CYP3A5-MGB-P1 of the present invention are shown.

[0033] Figure 2This is the result of the first primer probe concentration test of Example 3: Tests 1, 2, and 3 each have three amplification lines, and these three amplification lines are TT, TC, and CC types of CYP3A5*3 from top to bottom.

[0034] Figure 3 In Example 3, after the first test, the conditions of Test 2 are determined as the final detection conditions, and the amplification line diagram of this condition is tested again.

[0035] Figure 4 In Example 3, under the condition of fixed probe concentration, the changes in the amplification lines under different F and R concentrations were tested. Through this test, it was confirmed again that the conditions of Test 2 were the optimal amplification conditions.

[0036] Figure 5 This is the demonstration result of testing some clinical samples under optimized conditions: sample 7636 is of TT type; samples 7416, 7386, 8345, 4538, and 6873 are of TC type; and samples 3553, 7635, 4615, and 2352 are of CC type.

[0037] Figure 6 It is a demonstration diagram of the detection results of the present invention verified by first-generation sequencing. DETAILED DESCRIPTION

[0038] Example 1

[0039] DNA was extracted from the blood using Tiangen's blood genomic DNA extraction kit (DP348, TIANGEN):

[0040] 1) Draw 300 μl of blood and add 900 μl of red blood cell lysis buffer, mix by inversion, and leave at room temperature for 5 minutes, and mix by inversion several times. Centrifuge at 12000 rpm for 1 min, remove the supernatant, keep the white blood cell pellet, add 200 μl of buffer GA, and oscillate until thoroughly mixed.

[0041] 2) Add 20 μl of proteinase K solution and mix well.

[0042] 3) Add 200 μl of buffer GB, mix thoroughly by inversion, and place at 70°C for 10 minutes. The solution should become clear. Centrifuge briefly to remove water droplets on the inner wall of the tube cap.

[0043] 4) Add 200 μl of anhydrous ethanol and shake thoroughly for 15 seconds. Flocculent precipitation may appear at this time. Centrifuge briefly to remove water droplets on the inner wall of the tube cap.

[0044] 5) Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3 (the adsorption column is placed in a collection tube), centrifuge at 12000 rpm for 30 seconds, pour out the waste liquid, and put the adsorption column CB3 back into the collection tube.

[0045] 6) Add 500 μl of buffer GD to the adsorption column CB3 (please check whether anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column CB3 in a collection tube.

[0046] 7) Add 700 μl of rinse solution PW to the adsorption column CB3 (please check whether anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 30 seconds, pour out the waste liquid, and place the adsorption column CB3 in a collection tube.

[0047] 8) Add 500 μl of rinse solution PW to the adsorption column CB3, centrifuge at 12000 rpm for 30 seconds, and discard the waste solution.

[0048] 9) Place the adsorption column CB3 back into the collection tube, centrifuge at 12000 rpm for 2 minutes, and discard the waste liquid. Place the adsorption column CB3 at room temperature for several minutes to completely dry the residual rinse liquid in the adsorption material.

[0049] 10) Transfer the adsorption column CB3 into a clean centrifuge tube, add 100 μl of elution buffer TE to the middle part of the adsorption membrane, leave it at room temperature for 2-5 minutes, centrifuge it at 12000 rpm for 2 minutes, and collect the solution into the centrifuge tube.

[0050] The formula of the 10× red blood cell lysis solution is: 82 g NH4Cl, 8.4 g NaHCO3, 3.72 g EDTA-Na2, and ddH2O is added to make the volume to 1000 ml.

[0051] Example 2 QPCR reaction

[0052] The preparation method of QPCR reaction system reagents is as follows:

[0053]

[0054]

[0055] The detection was performed on a real-time fluorescence PCR instrument, and the available instruments include ABI7300, 7500 (Applied Biosystems, USA), etc. Reaction conditions: pre-denaturation at 95°C for 2 min; 95°C for 10 s, 60°C for 30 s, reaction for 35 cycles, and fluorescence signal was collected at 60°C.

[0056] The primer sequences are:

[0057] CYP3A5-MGB-F: 5'-AGCTTAACGAATGCTCTACTGTCA-3'

[0058] CYP3A5-MGB-R: 5'-ATATGATGAAGGGTAATGTGGTCCAAA-3'

[0059] CYP3A5-MGB-P1: 5'-FAM-TCTTTCAATATCTCTTCCCT-MGB-3';

[0060] ACTIN-F: 5'-GATACGAAGGGAGGGTGTACCA-3'

[0061] ACTIN-R: 5'-CTCGGCCAGGGTGTTGAA-3'

[0062] ACTIN–P: 5'-HEX-GCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA-3'.

[0063] Example 3 Adjustment of concentrations of CYP3A5*3 upstream primer, downstream primer and probe

[0064] Since the DNA concentration extracted from each sample is different, if the upstream primer of CYP3A5*3

[0065] If the concentrations of the upstream primer (CYP3A5-MGB-F, referred to as F), the downstream primer (CYP3A5-MGB-R, referred to as R) and the probe (CYP3A5-MGB-P1, referred to as P) are sufficient, the amplification lines of each sample will be different, which is not conducive to sample comparison; and diluting the samples to the same concentration will cause cumbersome operation and cost-effective aerosol pollution, which is not suitable for clinical application. Therefore, it is planned to adjust the concentrations of the upstream primer F, the downstream primer R and the probe P to achieve the most suitable and optimal condition that the template remains while the upstream primer F and the downstream primer R are used up. The present invention finally selects the following upstream primer F, downstream primer R and probe P ratio for testing:

[0066]

[0067]

[0068] According to the method of Example 2, the wild-type control standard c.219-237TT, the heterozygous mutant control standard c.219-237TC and the homozygous mutant control standard c.219-237CC were used to test the primer and probe concentrations. The test results are shown in Figure 2 .

[0069] from Figure 2It can be seen that the signal of F:R:P=0.05:0.05:0.025 in test 3 is too weak, that is, the probe concentration is too low, so the primer-probe ratio of 10μM to 0.025μl is first excluded; in the case of test 1, the TT and TC types are partially crossed, and the two lines before the crossover are not arranged in order, which is also excluded; so the conditions of test 2 are initially selected: the conditions of test 2 are tested again, and the results are shown in Figure 3 , it can be seen that the three genotypes are well distinguished. Here, the present invention determines the concentration of the probe in a total volume of 20 μl to be (10*0.05) / 20=0.025 μM.

[0070] To further test the saturation of the probe, the probe concentration was fixed at 0.025 μM, and F and R were tested according to the ratio in the following table:

[0071]

[0072] The test was carried out according to the method of Example 2. The results are shown in Figure 4 As can be seen from the figure: when the probe concentrations of the three test samples are the same, the Ct values ​​all start at around 22, but the three lines of the three types of test 6 are the farthest apart, indicating that they can be better distinguished from each other. Therefore, F:R:P=0.1:0.1:0.05 was finally determined.

[0073] Example 4 Clinical sample detection

[0074] According to the primer and probe concentrations adjusted in Example 3, CYP3A5 typing of 100 clinical samples was tested according to the method in Example 2. The specific identification demonstration diagrams of different types are shown in Figure 5 As can be seen from the figure: the types of CYP3A5*3 can be distinguished intuitively and easily. The test results are shown in the table of Example 5.

[0075] Example 5 Sequencing verification of 100 samples

[0076] The 100 clinical samples of Example 4 were tested by first-generation sequencing, and the comparison results are shown in the following table: From the comparison results in the table, it is found that the coincidence rate is 100%, and the method of the present invention is more time-saving and labor-saving than first-generation sequencing, and the operation is simple, and the judgment results are intuitive and accurate, which fully meets the clinical rapid diagnosis requirements; the specific demonstration diagram of first-generation sequencing is shown in Figure 6 .

[0077]

[0078]

[0079]

[0080] Example 6 CYP3A5*3 polymorphism detection and guidance on precise medication of tacrolimus

[0081] Tacrolimus is an immunosuppressant, which is widely used in clinical immunosuppressive treatment for liver, kidney, heart, lung and other organ transplant patients. Too low blood concentration of tacrolimus in organ transplant patients can lead to rejection and decreased drug sensitivity; high blood concentration is prone to various adverse reactions such as nephrotoxicity and neurotoxicity. CYP3A5 (rs776746, CYP3A5*3) plays an important role in the metabolism of tacrolimus. Its reduced activity can lead to increased blood concentration of tacrolimus and increased adverse reactions.

[0082]

[0083]

Claims

1. A primer and a probe for detecting CYP3A5*3 gene polymorphism using MGB probe method with DNA as template, characterized in that: Included are: CYP3A5-MGB-F: 5'-AGCTTAACGAATGCTCTACTGTCA-3' CYP3A5-MGB-R: 5'-ATATGATGAAGGGTAATGTGGTCCAAA-3' CYP3A5-MGB-P1: 5'-FAM-TCTTTCAATATCTCTTCCCT-MGB-3'; It also includes an internal reference gene ACTIN that indicates sample quality. Its upstream and downstream primers and probes are as follows: ACTIN-F: GATACGAAGGGAGGGTGTACCA ACTIN-R: CTCGGCCAGGGTGTTGAA ACTIN–P: HEX-GCTTCTGATGGCAAGCTCTACGTCTCCT–TAMRA.

2. The primer and probe according to claim 1, characterized in that: In a total reaction volume of 20 μL, the concentration of primers CYP3A5-MGB-F was 0.05 μM, the concentration of CYP3A5-MGB-R was 0.05 μM and the concentration of CYP3A5-MGB-P1 was 0.025 μM.

3. The primer and probe according to claim 1, characterized in that: Primers CYP3A5-MGB-F, CYP3A5-MGB-R and CYP3A5-MGB-P1 can be used to detect wild type c.219-237TT, heterozygous mutant c.219-237TC and homozygous mutant c.219-237CC.

4. A method for detecting the CYP3A5*3c.219-237T>C gene polymorphism site, characterized in that: The following steps are involved: (1) Extract genomic DNA from peripheral blood; (2) using QPCR to simultaneously amplify the DNA extracted in (1), the wild-type control standard c.219-237TT, the heterozygous mutant control standard c.219-237TC, and the homozygous mutant control standard c.219-237CC, to obtain sample amplification curves and amplification curves of the three control standards, respectively; (3) comparing the sample amplification curve in step (2) with the amplification curves of three control standards to directly obtain the polymorphism typing of the sample; The primers and probes for QPCR are: CYP3A5-MGB-F: 5'-AGCTTAACGAATGCTCTACTGTCA-3' CYP3A5-MGB-R: 5'-ATATGATGAAGGGTAATGTGGTCCAAA-3' CYP3A5-MGB-P1: 5'-FAM-TCTTTCAATATCTCTTCCCT-MGB-3'.

5. A kit for detecting the CYP3A5*3c.219-237T>C gene polymorphism site, characterized in that: It includes the following components: (1) Whole blood DNA extraction reagent; (2) Primers and probes for single QPCR amplification were mixed with 10 μM CYP3A5-MGB-F: CYP3A5-MGB-R: CYP3A5-MGB-P1 at a ratio of 0.1 μL: 0.1 μL: 0.05 μL. The final concentrations of the primers and probes in the total volume of 20 μL reaction system were 0.05 μM, 0.05 μM, and 0.025 μM, respectively. The sequences of the primers and probes were: CYP3A5-MGB-F: 5'-AGCTTAACGAATGCTCTACTGTCA-3' CYP3A5-MGB-R: 5'-ATATGATGAAGGGTAATGTGGTCCAAA-3' CYP3A5-MGB-P1: 5'-FAM-TCTTTCAATATCTCTTCCCT-MGB-3'; (3) Control standards include wild-type control standard c.219-237TT, heterozygous mutant control standard c.219-237TC and homozygous mutant control standard c.219-237CC; (4) 2X reaction enzyme mixture.

Images