Redirecting tropism of AAV capsid

Abstract

The present disclosure relates to redirecting tropism of AAV capsids, in particular, the disclosure relates to compositions, methods and processes for preparing, using and / or formulating adeno-associated virus capsid proteins wherein the capsid proteins comprise a targeting peptide insert that enhances tropism to a target tissue.

Description

[0001] This application is a divisional application of the Chinese patent application with application number 2019800783638, application date October 2, 2019, and invention name “Redirecting the tropism of AAV capsid”.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of: U.S. Provisional Patent Application No. 62 / 740,310, entitled AAV CAPSID LIBRARIES AND TISSUE Targeting PEPTIDE INSERS, filed on October 2, 2018; U.S. Provisional Patent Application No. 62 / 839,883, entitled REDIRECTION OF TROPISM AAV CAPSIDS, filed on April 29, 2019; the contents of each of which are incorporated herein by reference in their entirety.

[0004] Reference to a sequence listing

[0005] This application is submitted with a sequence listing in electronic format. The sequence listing is provided in the form of a file entitled 20571060PCTSL.txt, which was created on October 2, 2019 and is 428,491 bytes in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

[0006] Public domain

[0007] The present disclosure relates to compositions, methods and processes for making, using and / or formulating adeno-associated virus capsid proteins, wherein the capsid proteins comprise targeting peptide inserts that enhance tropism for target tissues. background

[0009] Gene delivery to the adult central nervous system (CNS) remains a major challenge in gene therapy, and engineered AAV capsids with improved brain tropism represent an attractive solution.

[0010] Adeno-associated virus (AAV)-derived vectors are promising tools for clinical gene transfer due to their non-pathogenicity, low immunogenicity, low rate of integration into the host genome, and long-term transgene expression in non-dividing cells. However, the transduction efficiency of natural AAV variants in certain organs is too low for clinical application, and capsid neutralization by pre-existing neutralizing antibodies may prevent treatment of a large proportion of patients. For these reasons, great efforts have been made to obtain novel capsid variants with enhanced properties. To date, among many tested approaches, the most significant progress has come from the directed evolution of AAV capsids, which is performed by selecting capsid variants in vitro or in vivo using randomization of the capsid sequence using error-prone PCR, shuffling of various parental serotypes, or insertion of fully randomized short peptides at specific positions.

[0011] In order to carry out the directed evolution of AAV capsids, the sequence encoding the viral capsid is itself flanked by inverted terminal repeats (ITRs) so that it can be packaged into its own capsid. After a mixed population of capsids infects cultured cells or animals, DNA encoding capsid variants that have successfully homed to the target tissue is recovered by PCR for further rounds of selection. In this method, all viral DNA material present in a given tissue is recovered without distinguishing between specific cell types or vectors capable of complete transduction (cell surface binding, endocytosis, transport, nuclear import, uncoating, second chain synthesis, transcription). For example, in the case of highly complex tissues containing multiple cell types, such as the central nervous system (CNS), it is highly preferred to apply more stringent selective pressure to recover capsid variants that can transduce neurons and / or astrocytes rather than microglia or vascular endothelial cells.

[0012] Attempts to improve the CNS tropism of AAV capsids following systemic administration have met with limited success.

[0013] Two previous approaches have been used to address this problem. The first strategy used was to co-infect cultured cells (Grimm et al., 2008) or in situ animal tissues (Lisowski et al., 2014) with adenovirus to trigger exponential replication of infectious AAV DNA. Another successful approach involved the use of cell-specific CRE transgenic mice (Deverman et al., 2016), allowing viral DNA recombination specifically in astrocytes and then recovering CRE recombinant capsid variants. Both approaches proved successful, allowing the isolation of several capsid variants with enhanced transduction of target cell populations.

[0014] This finding suggests that cell type-specific library selection could improve the results of directed evolution. However, the transgenic CRE system used by Deverman et al. is not tractable in other animal species, and the AAV variants selected by directed evolution in mouse tissues did not show similar properties in large animals. Therefore, it is necessary to perform the entire directed evolution process directly in non-human primates to increase the likelihood of translatability to human subjects. None of the previously described transduction-specific methods are suitable for large animal studies because: 1) many target tissues (e.g., CNS) are not easily co-infected with adenovirus, 2) specific Ad tropism itself can bias library distribution, and 3) large animals are generally not suitable for transgenesis and cannot be genetically engineered to express CRE recombinase in defined cell types.

[0015] To address this issue, we developed a broadly applicable functional AAV capsid library screening platform for cell type-specific biopanning in non-transgenic animals. In TRACER (tropic redirection of AAV by cell type-specific expression of RNA), T ropism R edirection of A AV by C ell type-specific E xpressionof R In the NA platform system, the capsid gene is placed under the control of a cell type-specific promoter to drive capsid mRNA expression in the absence of helper virus co-infection. This RNA-driven selection increases the selective pressure to favor capsid variants that transduce specific cell types.

[0016] The TRACER platform allows the generation of AAV capsid libraries, allowing specific recovery and subcloning of capsid mRNA expressed in transduced cells without the need for transgenic animals or helper virus co-infection. Since mRNA transcription is a hallmark of complete transduction, these methods will allow identification of fully infected AAV capsid mutants. In addition to its higher stringency, this method also allows the identification of highly tropic capsids for specific cell types using libraries designed to express CAP mRNA under the control of any cell-specific promoter, such as, but not limited to, the synapsin-1 promoter (neurons), the GFAP promoter (astroglia), the TBG promoter (liver), the CAMK promoter (skeletal muscle), the MYH6 promoter (cardiomyocytes).

[0017] Public Content

[0018] The present disclosure provides compositions and methods for engineering and / or redirecting the tropism of AAV capsids. Also provided herein are peptides that can be inserted into the AAV capsid sequence to increase the tropism of the capsid to specific tissues. On the one hand, the peptides can be used to target the capsid to the brain, or to areas of the brain or spinal cord.

[0019] The present disclosure provides a method for producing one or more variant AAV capsid polypeptides. In certain embodiments, the variant AAV capsid polypeptide exhibits at least one of improved transduction or increased cell or tissue specificity relative to the parent AAV capsid polypeptide. In certain embodiments, the method includes: (a) generating a variant AAV capsid polypeptide library, wherein the library includes (i) a plurality of capsid polypeptides having a random sequence region of 2, 3, 4, 5, 6, 7, 8 or 9 consecutive amino acids, or (ii) a plurality of capsid polypeptides from more than one parent AAV capsid polypeptide; (b) generating an AAV vector library by cloning the capsid polypeptides of library (a) (i) or (a) (ii) into an AAV vector, wherein the AAV vector includes a first promoter and a second promoter, wherein the second promoter drives the expression of capsid mRNA in the absence of co-infection with a helper virus.

[0020] In certain embodiments, the first promoter is AAV2 P40. In certain embodiments, the second promoter is a ubiquitous promoter. In certain embodiments, the first promoter is AAV2 P40 and the second promoter is a ubiquitous promoter.

[0021] In certain embodiments, the first promoter is AAV2 P40. In certain embodiments, the second promoter is a cell type specific promoter. In certain embodiments, the first promoter is AAV2 P40 and the second promoter is a cell type specific promoter.

[0022] In certain embodiments, the promoter is selected from any of the promoters listed in Table 3. In certain embodiments, a ubiquitous promoter or a cell-specific promoter allows for expression of RNA encoding a capsid polypeptide.

[0023] In certain embodiments, the method includes recovering RNA encoding capsid polypeptide.In certain embodiments, the method includes determining the sequence of capsid polypeptide.In certain embodiments, the capsid polypeptide recovered shows target cell transduction or target cell specificity (tropism) increase compared to the parent capsid polypeptide.

[0024] In certain embodiments, the target cell is a neuronal cell, a neural stem cell, an astrocyte, an oligodendrocyte, a microglia, a retinal cell, a tumor cell, a hematopoietic stem cell, an insulin-producing beta cell, a lung epithelial cell, an endothelial cell, a hepatocyte, a skeletal muscle cell, a muscle stem cell, a muscle satellite cell, or a cardiomyocyte.

[0025] In certain embodiments, the AAV vector comprises a first promoter and a second promoter, wherein the second promoter is located downstream of the capsid gene and drives the expression of its antisense RNA in the absence of helper virus co-infection.

[0026] In some embodiments, the first promoter is AAV2 P40 and the second promoter is a ubiquitous promoter. In some embodiments, the first promoter is AAV2 P40 and the second promoter is a cell-specific promoter. In some embodiments, a ubiquitous or cell-specific promoter allows the gene encoding the capsid polypeptide of the variant AAV to be expressed in the antisense direction, thereby producing antisense RNA. In some embodiments, the method includes recovering the antisense RNA, which can be converted into RNA encoding a variant AAV capsid polypeptide for determining the sequence of the variant AAV capsid polypeptide.

[0027] In certain embodiments, the variant AAV capsid polypeptide exhibits increased target cell transduction or target cell specificity (tropism) compared to the parent capsid polypeptide.

[0028] Detailed Description of the Drawings

[0029] The foregoing and other objects, features and advantages will be apparent from the following description of certain embodiments of the present disclosure, as illustrated in the accompanying drawings. The drawings are not necessarily drawn to scale, emphasis instead being placed upon illustrating the principles of the various embodiments of the present disclosure.

[0030] Figure 1A and Figure 1B A full map of wild-type AAV capsid gene transcription and the CMV-CAP vector is shown. Figure 1A Transcription of VP1, VP2, and VP3 AAV transcripts from the wild-type AAV genome is shown. The transcription start site for each viral promoter is shown. SD, splice donor, SA, splice acceptor. The start codon sequence for each reading frame is shown. Translation of AAP and VP3 was performed by leaky scanning of the primary mRNA. Figure 1B The structure of the CMV-p40 dual promoter vector used to determine the minimal regulatory sequences necessary for efficient virus production is shown. The pREP2ΔCAP vector shown at the bottom was derived by deleting most of the CAP reading frame and is used to provide REP protein in trans.

[0031] Figure 2A and Figure 2B is a histogram representation of the data and shows the effect of CMV promoter position on virus yield and CAP mRNA splicing. Figure 2A Shows the use Figure 1A-1BAverage yield of AAV9 produced in HEK-293T cells using constructs described in and co-transfected with Ad helper vector. Wild-type AAV9 plasmid (pAV9) was used as a positive control. Y-axis values ​​represent AAV DNA copies / μl (total ~1000ul, left graph) or percentage of wtAAV9 (right graph) from each 15cm plate. Figure 2B Evidence for expression of CAP transcripts in transfected cells is shown. RT-PCR was performed on mRNA from transfected 293T cells using primers specific for the major spliced ​​CAP transcript. Note the lack of p40 driven transcription in the absence of the Ad helper vector (lane 2).

[0032] Figure 3A , Figure 3B and Figure 3C The effect of REP helper plasmid optimization on virus yield is shown. Figure 3A The design of the improved pREP helper vector is shown. The deletion of the MscI fragment removes the C-terminal part of the VP protein necessary for capsid formation. The asterisk indicates an early stop codon that was introduced to disrupt the coding potential of the VP1, VP2 and VP3 reading frames. Figure 3B The yields of synapsin-p40-CAP9 AAV produced with various REP plasmid constructs are shown. The values ​​on the Y axis represent the percentage of VG relative to wild-type AAV9. Figure 3C Quantification of recombination and / or aberrant packaging of full-length REP from pREP plasmid is shown. qPCR was performed on the resulting viral stocks using a Taqman probe located at the N-terminal portion of REP lacking the ITR-containing vector.

[0033] Figure 4A , Figure 4B , Figure 4C and Figure 4D In vivo analysis of second generation vectors is described. Figure 4A The design of the Pro9 vector is shown. The structures of all three vectors are based on the BstEII construct. The AAV9 capsid RNA is placed under the control of P40 and CMV, hSyn1 or GFAP promoters, respectively. Figure 4B Silver staining of SDS-PAGE gels obtained by running 1e10 VG of each vector after two iodixanol purifications is shown. Figure 4C Biodistribution of viral DNA in mouse brain (cortex), liver, and heart following tail vein injection of 1e12 VG per mouse is shown. AAV9 VP3 DNA was quantified by Taqman PCR and normalized to the mouse transferrin receptor gene. Figure 4DRecovery of capsid RNA from mouse tissues is shown. Total RNA was reverse transcribed and Taqman PCR was performed using capsid-specific Taqman primers and probes. Values ​​represent VP3 cDNA copies normalized to the TBP housekeeping gene.

[0034] Figure 5A , Figure 5B , Figure 5C , Figure 5D and Figure 5E In vitro analysis of intronic second generation vectors is described. Figure 5A Designs of intronic Pro9 vectors with a hybrid CMV / globin intron are shown. AAV9 capsid RNA was placed under the control of P40 and CBA, hSyn1, or GFAP promoters in a tandem configuration (top) or in a reverse configuration (bottom). In the reverse promoter vector, an additional SV40 polyadenylation site (orange) was added at the 3' end to allow polyadenylation of the antisense CAP9 transcript. Figure 5B AAV9 CAP cDNA amplification is shown. All vectors described were generated using triple transfection with pHelper (p-helper) and pREP-3stops (pREP-3stop), and the resulting viruses were used to infect HEK-293T cells at an MOI of 1e4 VG per cell. RNA was extracted 48 hours after infection and RT-PCR was performed with primers that amplify the complete capsid (top) or C-terminal fragments (bottom). Figure 5C Shown is the quantification of AAV9 VP3 cDNA by Taqman PCR from cells infected with intronless virus or intron-containing virus with a tandem promoter in the forward orientation and normalized to the GAPDH housekeeping gene. Values ​​represent the ratio of VP3 to GAPDH cDNA. Figure 5D Figure 3: Capsid RNA recovered from cells infected with either tandem or reverse constructs. Total RNA was reverse transcribed and PCR was performed using the entire capsid gene flanked by primers. White arrows indicate VP3 size variants generated by aberrant splicing of the antisense CAP mRNA. Figure 5E Analysis of globin intron splicing is shown. PCR was performed on CAG9 plasmid (left) or cDNA from HEG-293T cells transduced with CAG9 virus using forward primers located before (Glo ex1) or within (GloSpliceF4 (SEQ ID NO: 26) and GloSpliceF6 (SEQ ID NO: 13)) the globin exon-exon junction. Primers spanning the junction between exon 1 (not underlined) and exon 2 (underlined) are depicted at the bottom.

[0035] Figure 6In vitro evidence is provided that the presence of the P40 promoter downstream of either the synapsin or Gfabc1D promoter does not relieve repression of either promoter in HEK-293T cells.

[0036] Figure 7 The basic principle of the TRACER platform is shown.

[0037] Figure 8 Features of the TRACER platform, including the use of tissue-specific promoters and RNA recovery, are shown.

[0038] Fig. 9 An implementation of the TRACER production architecture is provided.

[0039] Fig.10 A comparison between traditional vDNA recovery and second-generation vRNA recovery is provided.

[0040] Fig.11 An overview of the use of cell-specific RNA expression for targeted evolution is provided.

[0041] Fig. 12A and Fig. 12B Provided are representative native AAV ( Fig. 12A ) and TRACER libraries ( Fig. 12B )'s capsid gene transcription diagram.

[0042] Fig.13 is a diagram of AAV6, AAV5 and AAV-DJ capsid peptide display libraries used for in vivo evolution (SEQ ID NOs 27-32, respectively, in order of appearance).

[0043] Fig.14 is a diagram of the AAV9 capsid peptide display library used for in vivo evolution (SEQ ID NOs: 33-42 in order of appearance).

[0044] Fig.15A and Fig. 15B The method used for library construction is shown. Fig.15A The sequences of the insertion sites used for introduction into the random library are shown (SEQ ID NOs 43-46, respectively, in order of appearance). Fig. 15B A description of the assembly process is provided.

[0045] Fig.16 An exemplary diagram of a cloning-free rolling circle procedure for library amplification is provided (SEQ ID NO 47; NNK 7 ).

[0046] Fig.17Sequences of codon-mutated AAV9 library shuffles designed to minimize wild-type contamination are provided (SEQ ID NOs 33-34 and 48-52, respectively, in order of appearance).

[0047] Fig.18 A description of biopanning of an AAV9 peptide library is provided.

[0048] Fig.19 The recovery process from the initial pool is shown, with a recovery of 50%.

[0049] Fig. 20 Examples of recovery and amplification of cDNA from GFAP-driven libraries (Panel B and Panel F) are provided.

[0050] Fig.21A , Fig.21B and Fig. 21C The progression of AAV9 peptide library diversity throughout the biopanning process is shown. Fig.21A RNA library evolution is described. Fig.21B and Fig. 21C Amino acid profiles of NNK machine mix preparations for P0 and P1 viruses are shown.

[0051] Fig. 22 Neuronal (SYN)-AAV9 peptide library compositions at P2 are provided.

[0052] Fig.23 Astrocyte (GFAP)-AAV9 peptide library compositions at P2 are provided.

[0053] Fig.24 An assessment of brain / liver specificity among GFAP-AAV9 peptide library candidates is provided.

[0054] Fig.25 An assessment of brain / liver specificity among GFAP-AAV9 peptide library candidates is provided.

[0055] Fig.26 An example subset selection of variants is provided.

[0056] Fig. 27 An exemplary design of the library generation and cloning process is provided.

[0057] Fig.28 The NNK / NNM codon distribution (covariance of codon mutants) of AAV generated with a synthetic library of 666 sequence variants (GFAP promoter) is provided.

[0058] Fig.29The NNK / NNM codon distribution (covariance of codon mutants) of AAV generated with a synthetic library of 666 sequence variants (SYN9 promoter) is provided.

[0059] Fig.30 Data are presented on tissue recovery from brain and liver samples taken one month after injection.

[0060] Fig.31A , Fig.31B , Fig.31C and Fig.31D Results for control capsids from Syn-driven synthetic library NGS analysis are presented. Fig.31A Enrichment analysis of internal AAV9, PHP.B and PHP.eB controls is shown (SEQ ID NOs 53-58 and 53-58, respectively, in order of appearance). Fig.31B , Fig.31C and Fig.31D Shown is the NNK / NNM codon distribution in mRNA from mouse brain tissue.

[0061] Fig.32A and Fig.32B The results of NGS analysis of the neuronal synthetic library are provided (SEQ ID NOs 59-60, 59-61, 61-63, 62, 64, 64, 63, 65-67, 67, 65, 68, 66, 69, 70-71 and 70-74, respectively, in order of appearance).

[0062] Fig.33 The results of NGS analysis of astrocyte synthetic libraries are provided (SEQ ID NOs 53-58, 53-58, and 53-58, respectively, in order of appearance).

[0063] Fig.34A and Fig.34B Covariances of codon mutants in the astrocyte synthetic library are provided.

[0064] Fig.35The results of NGS analysis of astrocyte synthetic libraries are provided (SEQ ID NOs 75, 75-78, 76-77, 79-83, 65, 78, 84, 80, 85, 70, 86, 82, 81, 79, 87, 65, 85, 84, 70, 86, 88-90, 87, 91, 83, 88, 63, 89-90, 92-93, 91, 94-97, 93, 95, 98, 98, 97, 63, 92, 94, 99-101, 75, 75-78, 76-77, 79-83, 65, 78, 84, 80, 85 , 70, 86, 82, 81, 79, 87, 65, 85, 84, 70, 86, 88-90, 87, 91, 83, 88, 63, 89-90, 92-93, 91, 94-97, 93, 95, 98, 98, 97, 63, 92, 94, 99-102, 99, 103, 103-104, 96, 105-106, 101, 100, 102, 107, 104-105, 108-113, 106, 60, 66, 114-1 17, 109, 113, 72, 108, 110, 67, 118-119, 116, 120, 120, 107, 112, 121-123, 66, 124-125, 115, 118, 126, 121, 127-128, 60, 129, 119, 130-132, 72, 133, 123, 125, 69, 134-139, 62, 124, 67, 111, 114, 126, 140-141, 122, 142, 128-129, 143, 138, 144, 134, 62, 136, 145, 141, 146-153, 127, 154, 69, 144, 155, 71, 156, 133, 132, 137, 147, 157-158, 135, 159, 140, 117, 160, 139, 161-162, 130, 163, 143, 164, 152, 151, 165-167, 155, 168, 71, 169 and 146)

[0065] Fig.36 NGS analysis of GFAP synthetic libraries is provided.

[0066] Fig.37A and Fig.37B The top 38 variants from the synthetic library screen are presented. Fig.37APhylogenetic analysis of 9-mer peptide sequences is shown, as are sequences of peptide variants (SEQ ID NOs 67, 59, 64, 61, 77, 84, 96, 60, 80, 82, 66, 62, 83, 85, 106, 131, 94, 90, 76, 68-69, 79, 75, 81, 88, 139, 78, 155, 102, 63, 140, 87, 70, 105, 120, 89, 65 and 109, respectively, in order of appearance). Highlighted sequences represent peptides selected for individual transduction assays. Fig.37B A graphical representation of the neuronal and astroglial tropism of each peptide is shown, with both axes representing reverse sorting in the synaptic protein and GFAP screens.

[0067] Fig.38 The highest consensus sequences compared to PHP.N and PHP.B are provided (SEQ ID NOs 168 and 71, respectively, in order of appearance).

[0068] Fig.39 Figure 1 is a diagram of the Gibson assembly library cloning process.

[0069] Fig.40 Examples of TRIM / NNK peptide prevalence are provided (SEQ ID NOs 170-171, respectively, in order of appearance).

[0070] Fig.41 Peptide diversity statistics are provided for a study using Illumina adapters with 42 million bacterial transformants, 81 million sequence reads, and 12 million sequence variants (SEQ ID NOs 172-173, 48-49, and 174-175, in order of appearance).

[0071] Fig.42 A schematic diagram of clonal-free DNA amplification by rolling circle amplification is provided.

[0072] Fig.43 A diagram of telomerase monomer processing is provided (SEQ ID NOs 176-178, respectively, in order of appearance).

[0073] Fig.44 A plot comparing the traditional approach and the clone-free approach is provided.

[0074] Fig.45A , Fig.45B and Fig.45C Provides Syn-driven ( Fig.45A ) and GFAP-driven ( Fig.45B) Full ranking of the 333 variants. Capsid variants are ranked by their average brain RNA enrichment score (average of NNK and NNM codons). The rankings of the internal control capsids PHP.B, PHP.eB, and AAV9 are indicated ( Fig.45A and Fig.45B A comparison of the combined Syn-driven results and the GFAP-driven results is provided ( Fig.45C ). The GFAP-driven library represents only 4 animals, as 2 / 6 mice showed very different ranking profiles and were considered outliers.

[0075] Fig.46A and Fig.46B Comparison of NGS analysis of neuronal and astrocyte synthetic libraries is provided. Fig.46A Rankings of capsids using either the SYN or GFAP promoter are shown; Fig.46B Shown is a scatter plot showing the correlation of Syn- versus GFAP-driven libraries.

[0076] Fig.47 One embodiment of a multi-species (eg, rodent) study followed by next generation sequencing (NGS) is shown.

[0077] Fig.48A , Fig.48B and Fig.48C Results from a multi-strain / species comparison of 333 capsid variants are presented. Fig.48A Shown are the rankings of 333 capsids by brain RNA enrichment scores in C57BL / 6 mice, BALB / C mice, and rats. Capsids were ranked based on Syn-driven brain enrichment scores in C57BL / 6 mice. Fig.48B Shown are scatter plots showing the correlation between C57BL / 6 and BALB / C enrichment scores from Syn- and GFAP-driven libraries. Fig.48C A Venn diagram is shown showing the intersection and consensus sequences of capsids with >10-fold enrichment scores in the brain compared to AAV9 (Syn- or GFAP-driven) in the C57BL / 6 and BALB / C strains. In rat, no capsids showed >10-fold enrichment scores relative to AAV9.

[0078] Fig.49A , Fig.49B , Fig.49C and Fig.49D Provides Fig.49A Transduction (RNA) and biodistribution (DNA) analysis of the 10 capsid variants shown in (SEQ ID NOs 179-188, respectively, in order of appearance). Each capsid was used to package the self-complementary CBA-EGFP genome ( Fig.49B) and injected intravenously into C57BL / 6 mice. Fig.49C RNA expression in brain and spinal cord samples is shown. Fig.49D DNA distribution in brain and spinal cord samples is shown.

[0079] Fig.50A , Fig.50B and Fig.50C Results of testing individual capsids and their mRNA expression in brain, spinal cord, and liver are presented. Brain ( Fig.50A ),spinal cord( Fig.50B ) and liver( Fig.50C ) EGFP mRNA expression results.

[0080] Fig.51 Results of NGS screening using the neuronal NeuN marker for GFAP screening and SYN screening are provided ( Fig.51 ).

[0081] Fig.52 Results of tests on individual capsids throughout the brain are presented.

[0082] Fig.53 Results for other individual capsids tested throughout the brain are provided.

[0083] Fig.54 Results of tests of individual capsids in the cerebellum are presented.

[0084] Fig.55 Results of testing of individual capsids in the cortex are presented.

[0085] Fig.56 Results from testing individual capsids in the hippocampus are presented.

[0086] Fig.57A and Fig.57B Transduction data for 10 capsid variants in mouse liver are provided ( Fig.57B ), by EGFP RNA expression and whole tissue fluorescence analysis ( Fig.57A ).

[0087] Fig.58A and Fig.58B Provides 333 capsid variants for transduction of C57BL / 6 mouse BMVEC ( Fig.58A ) and human BMVEC ( Fig.58B )'s results from a comparative study of the CNS efficacy of

[0088] Fig.59A , Fig.59B and Fig.59C A diagram of NGS analysis of full-length capsid variants and the recovered external barcodes is provided. Universal barcode pairs ( Fig.59C). The 5' ( Fig.59A ) and CAP sequence 3' barcode pair ( Fig.59B )'s complete ITR to ITR construct.

[0089] Fig.60A , Fig.60B and Fig.60C Detailed analysis of viral production and RNA splicing using an intron barcoding platform with multiple configurations is provided. Universal ITR to ITR constructs are shown in Fig.60A (SEQ ID NOs 189-193 in order of appearance), and intron barcode yield ( Fig.60B ), and the gel column shows the results of AAV intron splicing and globin intron splicing ( Fig.60C ).

[0090] Public Detailed Description

[0091] The details of one or more embodiments of the present disclosure are set forth in the following attached description. Although any materials and methods similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, preferred materials and methods are now described. By description, other features, purposes and advantages of the present disclosure will be apparent. In the specification, the singular form also includes the plural form, unless the context clearly indicates otherwise. Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those of ordinary skill in the art to which the present disclosure belongs, which are generally understood. In the event of a conflict, this specification shall prevail.

[0092] According to the present disclosure, AAV particles with enhanced tropism for target tissues (e.g., CNS) are provided, as well as related methods for targeting, preparing, formulating, and using the same. Targeting peptides and nucleic acid sequences encoding the targeting peptides are provided. These targeting peptides can be inserted into AAV capsid protein sequences in vivo, in vitro, or in vitro to alter the tropism for specific cell types, tissues, organs, or organisms.

[0093] As used herein, "AAV particles" or "AAV vectors" comprise capsid proteins and a viral genome, wherein the viral genome comprises at least one payload region and at least one inverted terminal repeat (ITR). AAV particles and / or their constituent capsids and viral genomes can be engineered to alter tropism for specific cell types, tissues, organs, or organisms.

[0094] As used herein, "viral genome" or "vector genome" refers to the nucleic acid sequence encapsulated in the AAV particle. The viral genome comprises a nucleic acid sequence having at least one payload region encoding a payload and at least one ITR.

[0095] As used herein, a "payload region" is any nucleic acid molecule encoding one or more "payloads" of the present disclosure. As a non-limiting example, a payload region can be a nucleic acid sequence encoding a payload comprising an RNAi agent or a polypeptide.

[0096] As used herein, "targeting peptide" refers to a peptide of 3-20 amino acids in length. These targeting peptides can be inserted or attached to the parent amino acid sequence to change the properties (e.g., tropism) of the parent protein. As a non-limiting example, the targeting peptide can be inserted into the AAV capsid sequence to enhance targeting to a desired cell type, tissue, organ, or organism.

[0097] The AAV particles and payloads of the present disclosure can be delivered to one or more target cells, tissues, organs or organisms. In a preferred embodiment, the AAV particles of the present disclosure show enhanced tropism to target cell types, tissues or organs. As a non-limiting example, the AAV particles can enhance tropism to cells and tissues of the central or peripheral nervous system (respectively CNS and PNS). The AAV particles of the present disclosure can additionally or alternatively reduce tropism to undesirable target cell types, tissues or organs.

[0098] Adeno-associated virus (AAV) is a small, non-enveloped, icosahedral capsid virus of the Parvoviridae family, characterized by a single-stranded DNA viral genome. The Parvoviridae family of viruses consists of two subfamilies: the Parvovirinae, which infect vertebrates, and the Denguevirinae, which infect invertebrates. The Parvoviridae family includes the Dependent virus genus, which includes AAV, and is capable of replicating in vertebrate hosts, including, but not limited to, humans, primates, bovine, canine, equine, and ovine species.

[0099] Parvoviruses and other members of the Parvoviridae family are generally described in Kenneth I. Berns, "Parvoviridae: The Viruses and Their Replication" (FIELDS VIROLOGY) (3rd ed. 1996), Chapter 69, the contents of which are incorporated by reference in their entirety.

[0100] AAV has proven useful as a biological tool due to its relatively simple structure, ability to infect a variety of cells (including quiescent and dividing cells) without integration into the host genome and without the need for replication, and its relatively mild immunogenicity profile. The genome of this virus can be engineered to contain the minimum components for assembling a functional recombinant virus or viral particle, which is loaded with a payload, or engineered to target specific tissues and express or deliver a desired payload.

[0101] The wild-type AAV vector genome is a linear, single-stranded DNA (ssDNA) molecule with a length of about 5,000 nucleotides (nt). The reverse terminal repeat sequence (ITR) usually caps the viral genome at the 5' and 3' ends, providing a replication origin for the viral genome. Although it is not desired to be bound by theory, the AAV viral genome usually includes two ITR sequences. These ITRs have a characteristic T-shaped hairpin structure, which is limited by the self-complementary region (145nt in wild-type AAV) at the 5' and 3' ends of ssDNA, forming an energy-stable double-stranded region. The double-stranded hairpin structure includes a variety of functions, including but not limited to serving as a starting point for DNA replication by acting as a primer for the endogenous DNA polymerase complex of the host virus replication cell.

[0102] The wild-type AAV viral genome also includes the nucleotide sequences of two open reading frames, one for four nonstructural Rep proteins (Rep78, Rep68, Rep52, Rep40, encoded by the Rep gene), and the other for three capsid or structural proteins (VP1, VP2, VP3, encoded by the capsid gene or Cap gene). Rep proteins are important for replication and packaging, while capsid proteins assemble to form the protein shell of AAV or AAV capsid. Alternative splicing and alternate start codons and promoters result in the production of four different Rep proteins from a single open reading frame and three capsid proteins from a single open reading frame. Although as a non-limiting example, for AAV9 / hu.14 (SEQ ID NO: 123 of US 7,906,111, the contents of which are incorporated herein by reference in their entirety), it varies with the AAV serotype, VP1 refers to amino acids 1-736, VP2 refers to amino acids 138-736, and VP3 refers to amino acids 203-736. In other words, VP1 is the full-length capsid sequence, while VP2 and VP3 are shorter components of the whole. As a result, changes in the sequence in the VP3 region are also changes in VP1 and VP2, but the percentage difference of VP3 compared to the parent sequence will be the largest because it is the shortest of the three sequences. Although described herein with respect to amino acid sequences, the nucleic acid sequences encoding these proteins can be similarly described. These three capsid proteins are assembled together to form the AAV capsid protein. Although not wishing to be bound by theory, the AAV capsid protein typically includes a 1:1:10 molar ratio of VP1:VP2:VP3. As used herein, "AAV serotype" is primarily defined by the AAV capsid. In some cases, ITRs are also specifically described by AAV serotypes (e.g., AAV2 / 9).

[0103] The AAV vectors of the present disclosure can be recombinantly produced and can be based on an adeno-associated virus (AAV) parent or reference sequence. As used herein, a "vector" is any molecule or entity that transports, transduces, or otherwise acts as a carrier of a heterologous molecule (e.g., a nucleic acid described herein).

[0104] In addition to single-stranded AAV viral genomes (e.g., ssAAV), the present disclosure also provides self-complementary AAV (scAAV) viral genomes. The scAAV vector genome comprises DNA strands that anneal together to form double-stranded DNA. By skipping second-strand synthesis, scAAV can be rapidly expressed in transduced cells.

[0105] In one embodiment, the AAV particles of the present disclosure are scAAV.

[0106] In one embodiment, the AAV particles of the present disclosure are ssAAV.

[0107] Methods for producing and / or modifying AAV particles, such as pseudotyped AAV vectors, are disclosed in the art (PCT Patent Publication Nos. WO200028004; WO200123001; WO2004112727; WO2005005610 and WO2005072364, the contents of each of which are incorporated herein by reference in their entirety).

[0108] In one embodiment, an AAV particle of the present disclosure comprising a capsid and a viral genome with an inserted targeting peptide can have increased tropism for a cell type or tissue of the human CNS.

[0109] AAV capsid

[0110] The AAV particles of the present disclosure may comprise or be derived from any natural or recombinant AAV serotype. AAV serotypes may differ in characteristics such as, but not limited to, packaging, tropism, transduction, and immunogenicity. Without wishing to be bound by theory, AAV capsid proteins are generally considered to be the driving factor for the tropism of AAV particles for specific tissues.

[0111] In one embodiment, the AAV particles can have capsid proteins and ITR sequences derived from the same parental serotype (e.g., AAV2 capsid and AAV2 ITR). In another embodiment, the AAV particles can be pseudotyped AAV particles, wherein the capsid proteins and ITR sequences are derived from different parental serotypes (e.g., AAV9 capsid and AAV2 ITR; AAV2 / 9).

[0112] The AAV particles of the present disclosure may include an AAV capsid protein having a targeting peptide inserted into a parent sequence. The parent capsid or serotype may include or be derived from any natural or recombinant AAV serotype. As used herein, a "parent" sequence is a nucleotide or amino acid sequence into which a targeting sequence is inserted (i.e., a nucleotide is inserted into a nucleic acid sequence or an amino acid sequence is inserted into an amino acid sequence).

[0113] In a preferred embodiment, the parent AAV capsid nucleotide sequence is shown as SEQ ID NO:1.

[0114] In another embodiment, the parent AAV capsid nucleotide sequence is a K449R variant of SEQ ID NO: 1, wherein the codon encoding lysine (e.g., AAA or AAG) at position 449 (nucleotides 1345-1347) of the amino acid sequence is exchanged for a codon encoding arginine (CGT, CGC, CGA, CGG, AGA, AGG). The K449R variant has the same function as wild-type AAV9.

[0115] In one embodiment, the parent AAV capsid amino acid sequence is shown in SEQ ID NO:2.

[0116] In another embodiment, the parent AAV capsid amino acid sequence is shown in SEQ ID NO:3.

[0117] In one embodiment, the parent AAV capsid sequences are those shown in Table 1.

[0118] Table 1. AAV capsid sequences

[0119]

[0120] Each patent, application, and / or publication listed in Table 1 is incorporated herein by reference in its entirety.

[0121] The parent AAV serotype and the associated capsid sequence can be any of those known in the art. Non-limiting examples of such AAV serotypes include AAV9, AAV9 K449R (or K449R AAV9), AAV1, AAVrh10, AAV-DJ, AAV-DJ8, AAV5, AAVPHP.B (PHP.B), AAVPHP.A (PHP.A), AAVG2B-26, AAVG2B-13, AAVTH1.1-32, AAVTH1.1-35, AAVPHP.B2 (PHP.B2), AAVPHP.B3 (PHP.B3), AAVPHP.N / PHP.B-DGT, AAVPHP.B-EST, AAVPHP.B-GGT, AAVPHP.B-ATP, AAVPHP.B-ATT-T, AAVPHP .B-DGT-T, AAVPHP.B-GGT-T, AAVPHP.B-SGS, AAVPHP.B-AQP, AAVPHP.B-QQP, AAVPHP.B-SNP(3), AAVPHP.B-SNP, AAVPHP.B-QGT, AAVPHP.B-N QT, AAVPHP.B-EGS, AAVPHP.B-SGN, AAVPHP.B-EGT, AAVPHP.B-DST, AAVPHP.B-DST, AAVPHP.B-STP, AAVPHP.B-PQP, AAVPHP.B-SQP, AAVPHP.B- QLP, AAVPHP.B-TMP, AAVPHP.B-TTP, AAVPHP.S / G2A12, AAVG2A15 / G2A3(G2A3), AAVG2B4(G2B4), AAVG2B5(G2B5), PHP.S, AAV2, AAV2G9, AAV3 , AAV3a, AAV3b, AAV3-3, AAV4, AAV4-4, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45 , AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV12, AAV16.3, AAV24.1, AAV27.3, AAV42.12, AAV42-1b, AAV42-2, AAV42-3 a, AAV42-3b, AAV42-4, AAV42-5a, AAV42-5b, AAV42-6b, AAV42-8, AAV42-10, AAV42-11, AAV42-12, AAV42-13, AAV42-15, AAV42-aa, AAV43-1,AAV43-12、AAV43-20、AAV43-21、AAV43-23、AAV43-25、AAV43-5、AAV44.1、AAV44.2、AAV44.5、AAV223.1、AAV223.2、AAV223.4、AAV223.5、AAV223.6、AA V223.7、AAV1-7 / rh.48、AAV1-8 / rh.49、AAV2-15 / rh.62、AAV2-3 / rh.61、AAV2-4 / rh.50、AAV2-5 / rh.51、AAV3.1 / hu.6、AAV3.1 / hu.9、AAV3-9 / rh.52、AAV3. AV3-11 / rh.53、AAV4-8 / r11.64、AAV4-9 / rh.54、AAV4-19 / rh.55、AAV5-3 / rh.57、AAV5-22 / rh.58、AAV7.3 / hu.7、AAV16.8 / hu.10、AAV16.12 / hu.11、AAV29.3 / bb.1、AAV29.5 / bb.2、AAV106.1 / hu.37、AAV114.3 / hu.40、AAV127.2 / hu.41、AAV127.5 / hu.42、AAV128.3 / hu.44、AAV130.4 / hu.48、AAV145.1 / h u.53、AAV145.5 / hu.54、AAV145.6 / hu.55、AAV161.10 / hu.60、AAV161.6 / hu.61、AAV33.12 / hu.17、AAV33.4 / hu.15、AAV33.8 / hu.16、AAV52 / hu.19、AAV52.1 / hu.20、AAV58.2 / hu.25、AAVA3.3、AAVA3.4、AAVA3.5、AAVA3.7、AAVC1、AAVC2、AAVC5、AAVF3、AAVF5、AAVH2、AAVrh.72、AAVhu.8、AAVrh.68、AAVrh .70、AAVpi.1、AAVpi.3、AAVpi.2、AAVrh.60、AAVrh.44、AAVrh.65、AAVrh.55、AAVrh.47、AAVrh.69、AAVrh.45、AAVrh.59、AAVhu.12、AAVh6、AAVh-1 / hu .1、AAVH-5 / hu.3、AAVLG-10 / rh.40、AAVLG-4 / rh.38、AAVLG-9 / hu.39、AAVN721-8 / rh.43、AAVCh.5、AAVCh.5R1、AAVcy.2、AAVcy.3、AAVcy.4、AAVcy.5.AAVCy.5R1、AAVCy.5R2、AAVCy.5R3、AAVCy.5R4、AAVcy.6、AAVhu.1、AAVhu.2、AAVhu.3、AAVhu.4、AAVhu.5、AAVhu.6、AAVhu.7、AAVhu.9、AAVhu.10、AAVhu.11、AAVhu.13、AAVhu.15、AAVhu.16、AAVhu.17、AAVhu.18、AAVhu.20、AAVhu.21、AAVhu.22、AAVhu.23.2、AAVhu.24、AAVhu.25、AAVhu.27、AAVhu.28、AAVhu.29、AAVhu.29R、AAVhu.31、AAVhu.32、AAVhu.34、AAVhu.35、AAVhu.37、AAVhu.39、AAVhu.40、AAVhu.41、AAVhu.42、AAVhu.43、AAVhu.44、AAVhu.44R1、AAVhu.44R2、AAVhu.44R3、AAVhu.45、AAVhu.46、AAVhu.47、AAVhu.48、AAVhu.48R1、AAVhu.48R2、AAVhu.48R3、AAVhu.49、AAVhu.51、AAVhu.52、AAVhu.54、AAVhu.55、AAVhu.56、AAVhu.57、AAVhu.58、AAVhu.60、AAVhu.61、AAVhu.63、AAVhu.64、AAVhu.66、AAVhu.67、AAVhu.14 / 9、AAVhu.t 19、AAVrh.2、AAVrh.2R、AAVrh.8、AAVrh.8R、AAVrh.10、AAVrh.12、AAVrh.13、AAVrh.13R、AAVrh.14、AAVrh.17、AAVrh.18、AAVrh.19、AAVrh.20、AAVrh.21、AAVrh.22、AAVrh.23、AAVrh.24、AAVrh.25、AAVrh.31、AAVrh.32、AAVrh.33、AAVrh.34、AAVrh.35、AAVrh.36、AAVrh.37、AAVrh.37R2、AAVrh.38、AAVrh.39、AAVrh.40、AAVrh.46、AAVrh.48、AAVrh.48.1、AAVrh.48.1.2、AAVrh.48.2、AAVrh.49、AAVrh.51、AAVrh.52、AAVrh.53、AAVrh.54、AAVrh.56、AAVrh.57、AAVrh.58, AAVrh.61, AAVrh.64, AAVrh.64R1, AAVrh.64R2, AAVrh.67, AAVrh.73, AAVrh.74, AAVrh8R, AAVrh8R A586R mutant, AAVrh8R R533A mutant, AAAV, BAAV, goat AAV, bovine AAV, AAVhE1.1, AAVhEr1.5, AAVhER1.14, AAVhEr1.8, AAVhEr1.16, AAVhEr1.18, AAVhEr1.35, AAVhEr1.7, AAVhEr1.36, AAVhEr2.29, AAVhEr2.4, AAVhEr2.16, AAVhEr2.30, AAVhEr2.31, AAVhEr2.36, AAVhER1.23, AAVhEr3.1, AAV2.5T, AAV-PAEC, AAV-LK01, AAV-LK02, AAV-LK03, AAV-LK04, AAV-LK05, AAV-LK06, AAV-LK07, AAV-LK08, AAV-LK09, AAV-LK10, AAV-LK11, AAV-LK12, AAV-LK13, AAV-LK14, AAV-LK15, AAV-LK16, AAV-LK17, AAV-LK18, AAV-LK19, AAV-PAEC2, AAV-PAEC4, AAV-PAEC6, AAV-PAEC7, AAV-PAEC8, AAV-PAEC11, AAV-PAEC12, AAV-2-pre-miRNA-101, AAV-8h, AAV-8b, AAV-h, AAV-b, AAV SM 10-2, AAV shuffling 100-1, AAV shuffling 100-3, AAV shuffling 100-7, AAV shuffling 10-2, AAV shuffling 10-6, AAV shuffling 10-8, AAV shuffling 100-2, AAV SM 10-1, AAV SM 10-8, AAV SM 100-3, AAV SM 100-10, BNP61 AAV, BNP62 AAV, BNP63 AAV, AAVrh.50, AAVrh.43, AAVrh.62, AAVrh.48, AAVhu.19, AAVhu.11, AAVhu.53, AAV4-8 / rh.64, AAVLG-9 / hu.39, AAV54.5 / hu.23, AAV54.2 / hu.22, AAV54.7 / hu.24, AAV54.1 / hu.21, AAV54.4R / hu.27, AAV46.2 / hu.28, AAV46.6 / hu.29, AAV128.1 / hu.43True form AAV (ttAAV), UPenn AAV 10, Japanese AAV 10 serotype, AAV CBr-7.1, AAV CBr-7.10, AAV CBr-7.2, AAV CBr-7.3, AAV CBr-7.4, AAV CBr-7.5, AAV CBr-7.7, AAV CBr-7.8, AAV CBr-B7.3, AAVCBr-B7.4, AAV CBr-E1, AAV CBr-E2, AAV CBr-E3, AAV CBr-E4, AAV CBr-E5, AAV CBr-e5, AAV CBr-E6, AAV CBr-E7, AAV CBr-E8, AAV CHt-1, AAV CHt-2, AAV CHt-3, AAV CHt-6.1, AAV CHt-6.10, AAV CHt-6.5, AAV CHt-6.6, AAV CHt-6.7, AAV CHt-6.8, AAV CHt-P1, AAVCHt-P2, AAV CHt-P5, AAV CHt-P6, AAV CHt-P8, AAV CHt-P9, AAV CKd-1, AAV CKd-10, AAVCKd-2, AAV CKd-3, AAV CKd-4, AAV CKd-6, AAV CKd-7, AAV CKd-8, AAV CKd-B1, AAV CKd-B2, AAV CKd-B3, AAV CKd-B4, AAV CKd-B5, AAV CKd-B6, AAV CKd-B7, AAV CKd-B8, AAV CKd-H1, AAV CKd-H2, AAV CKd-H3, AAV CKd-H4, AAV CKd-H5, AAV CKd-H6, AAV CKd-N3, AAV CKd-N4, AAV CKd-N9, AAV CLg-F1, AAV CLg-F2, AAV CLg-F3, AAV CLg-F4, AAV CLg-F5, AAV CLg-F6, AAV CLg-F7, AAV CLg-F8, AAV CLv-1, AAV CLv1-1, AAV Clv1-10, AAV CLv1-2, AAV CLv-12, AAV CLv1-3, AAV CLv-13, AAV CLv1-4, AAV Clv1-7, AAV Clv1-8, AAV Clv1-9, AAV CLv-2, AAV CLv-3, AAV CLv-4, AAV CLv-6, AAV CLv-8, AAV CLv-D1, AAV CLv-D2, AAV CLv-D3, AAV CLv-D4,AAV CLv-D5, AAV CLv-D6, AAV CLv-D7, AAV CLv-D8, AAV CLv-E1, AAV CLv-K1, AAV CLv-K3, AAV CLv-K6, AAV CLv-L4, AAV CLv-AAV-5 CLv-L6, AAV CLv-M1, AAV CLv-M11, AAV CLv-M2, AAV CLv-M5, AAV CLv-M6, AAV CLv-M7, AAV CLv-M8, AAV CLv-M9, AAV CLv-1, AAV CLv-1 CLv-R2, AAV CLv-R3, AAV CLv-R4, AAV CLv-R5, AAV CLv-R6, AAV CLv-R7, AAVCLv-R8, AAV CLv-R9, AAV CSp-1, AAV CSp-10AAV CSp-11、AAV CSp-2、AAV CSp-3、AAVCSp-4、AAV CSp-6、AAV CSp-7、AAV CSp-8、AAV CSp-8.10、AAV CSp-8.2、AAV CSp-8.8、AAV CSp-8. CSp-8.6、AAV CSp-8.7、AAV CSp-8.8、AAV CSp-8.9、AAV CSp-9, AAV.hu.48R3, AAV.VR-355, AAV3B, AAV4, AAV5, AAVF1 / HSC1, AAVF 11 / HSC11、AAVF12 / HSC12、AAVF13 / HSC13、AAVF14 / HSC14、AAVF15 / HSC15、 AAVF16 / HSC16、AAVF17 / HSC17、AAVF2 / HSC2、AAVF3 / HSC3、AAVF4 / HSC4、A AVF5 / HSC5, AAVF6 / HSC6, AAVF7 / HSC7, AAVF8 / HSC8, AAVF9 / HSC9

[0122] In some embodiments, the serotype may be AAVDJ or a variant thereof, such as AAVDJ8 (or AAV-DJ8), as described in Grimm et al. (Journal of Virology 82(12):5887-5911 (2008), U.S. Publication No. US20140359799 and U.S. Patent No. 7,588,772, which are incorporated herein by reference in their entirety). The amino acid sequence of AAVDJ8 may comprise two or more mutations to remove the heparin binding domain (HBD). As a non-limiting example, the AAV-DJ sequence is described by SEQ ID NO: 1 in U.S. Pat. No. 7,588,772 (the contents of which are incorporated herein by reference in their entirety), and the AAVDJ8 sequence may comprise two mutations: (1) R587Q, wherein the arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gln) and (2) R590T, wherein the arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr). As another non-limiting example, the AAVDJ8 sequence may comprise three mutations: (1) K406R, wherein the lysine (K; Lys) at amino acid 406 is changed to arginine (R; Arg), (2) R587Q, wherein the arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gln) and (3) R590T, wherein the arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr).

[0123] In one embodiment, the parent AAV capsid sequence comprises an AAV9 sequence.

[0124] In one embodiment, the parent AAV capsid sequence comprises a K449R AAV9 sequence.

[0125] In one embodiment, the parent AAV capsid sequence comprises an AAVDJ sequence.

[0126] In one embodiment, the parent AAV capsid sequence comprises an AAVDJ8 sequence.

[0127] In one embodiment, the parent AAV capsid sequence comprises an AAVrh10 sequence.

[0128] In one embodiment, the parent AAV capsid sequence comprises an AAV1 sequence.

[0129] In one embodiment, the parent AAV capsid sequence comprises an AAV5 sequence.

[0130] Without wishing to be bound by theory, it is understood that the parent AAV capsid sequence comprises the VP1 region. In one embodiment, the parent AAV capsid sequence comprises the VP1, VP2 and / or VP3 regions, or any combination thereof. The parent VP1 sequence can be considered synonymous with the parent AAV capsid sequence.

[0131] The present disclosure relates to structural capsid proteins (including VP1, VP2 and VP3) encoded by capsid (Cap) genes. These capsid proteins form the outer protein structural shell (i.e., capsid) of viral vectors such as AAV. The VP capsid proteins synthesized by Cap polynucleotides usually include methionine as the first amino acid (Met1) in the peptide sequence, which is related to the start codon (AUG or ATG) in the corresponding Cap nucleotide sequence. However, the first methionine (Met1) residue or usually any first amino acid (AA1) is usually cleaved off by protein processing enzymes such as Met-aminopeptidases after or during protein synthesis. This "Met / AA-cleavage" process is usually associated with the corresponding acetylation of the second amino acid (e.g., alanine, valine, serine, threonine, etc.) in the polypeptide sequence. Met-cleavage usually occurs on VP1 and VP3 capsid proteins, but may also occur on VP2 capsid protein.

[0132] When Met / AA cleavage is incomplete, a mixture of one or more (one, two or three) VP capsid proteins including viral capsids may be produced, some of which may contain Met1 / AA1 amino acids (Met+ / AA+), and some of which may lack Met1 / AA1 amino acids (Met- / AA-) due to Met / AA cleavage. For further discussion of Met / AA cleavage in capsid proteins, see Jin et al. Direct Liquid Chromatography / Mass Spectrometry Analysis for Complete Characterization of Recombinant Adeno-Associated Virus Capsid Proteins. Hum Gene Ther Methods. 2017 Oct. 28(5): 255-267; Hwang et al. N-Terminal Acetylation of Cellular Proteins Creates Specific Degradation Signals. Science. 2010 February 19. 327(5968): 973–977; the contents of which are incorporated herein by reference in their entirety.

[0133] According to the present disclosure, the reference to capsid protein is not limited to cleaved (Met- / AA-) or uncleaved (Met+ / AA+), and in the context may refer to an independent capsid protein, a viral capsid including a mixture of capsid proteins, and / or a polynucleotide sequence (or fragment thereof) encoding, describing, producing or leading to the capsid protein of the present disclosure. Direct reference to "capsid protein" or "capsid polypeptide" (e.g., VP1, VP2 or VP2) may also include VP capsid protein, which includes Met1 / AA1 amino acids (Met+ / AA+) and the corresponding VP capsid protein, which lacks Met1 / AA1 amino acids (Met- / AA-) due to Met / AA cleavage.

[0134] Further in accordance with the present disclosure, reference to a specific SEQ ID NO: (whether protein or nucleic acid) comprising or encoding one or more capsid proteins comprising Met1 / AA1 amino acids (Met+ / AA+), respectively, should be understood to teach a VP capsid protein which, upon inspection of the sequence, lacks the Met1 / AA1 amino acid, and obviously any sequence lacking only the first listed amino acid (whether or not having Met1 / AA1).

[0135] As a non-limiting example, a reference to a VP1 polypeptide sequence that is 736 amino acids in length and includes the "Met1" amino acid (Met+) encoded by the AUG / ATG start codon can also be understood to teach a VP1 polypeptide sequence that is 735 amino acids in length and does not include the "Met1" amino acid (Met-) of the Met+ sequence of 736 amino acids. As a second non-limiting example, a reference to a VP1 polypeptide sequence that is 736 amino acids in length and includes the "AA1" amino acid (AA1+) encoded by any NNN start codon can also be understood to teach a VP1 polypeptide sequence that is 735 amino acids in length and does not include the "AA1" amino acid (AA1-) of the AA1+ sequence of 736 amino acids.

[0136] Reference to a viral capsid formed by a VP capsid protein (e.g., reference to a specific AAV capsid serotype) can incorporate a VP capsid protein comprising a Met1 / AA1 amino acid (Met+ / AA1+), a corresponding VP capsid protein lacking the Met1 / AA1 amino group due to Met / AA1 cleavage (Met- / AA1-), and combinations thereof (Met+ / AA1+ and Met- / AA1-).

[0137] As non-limiting examples, the AAV capsid serotype may include VP1 (Met+ / AA1+), VP1 (Met- / AA1-), or a combination of VP1 (Met+ / AA1+) and VP1 (Met- / AA1-). The AAV capsid serotype may also include VP3 (Met+ / AA1+), VP3 (Met- / AA1-), or a combination of VP3 (Met+ / AA1+) and VP3 (Met- / AA1-); and may also include similar optional combinations of VP2 (Met+ / AA1) and VP2 (Met- / AA1-).

[0138] In one embodiment, the parent AAV capsid sequence can comprise an amino acid sequence that is 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of the above sequences.

[0139] In one embodiment, the parent AAV capsid sequence can be encoded by a nucleotide sequence that is 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of the above sequences.

[0140] In one embodiment, the parent sequence is not an AAV capsid sequence, but a different vector (e.g., lentivirus, plasmid, etc.). In another embodiment, the parent sequence is a delivery vehicle (e.g., nanoparticle), and the targeting peptide is attached thereto.

[0141] Targeting peptides

[0142] Disclosed herein are targeting peptides and related AAV particles comprising a capsid protein having one or more targeting peptide inserts for use in enhancing or improving transduction of a target tissue (eg, cells of the CNS or PNS).

[0143] In one embodiment, the targeting peptide can guide the AAV particles to cells or tissues of the CNS. The cells of the CNS can be, but are not limited to, neurons (e.g., excitatory, inhibitory, motor, sensory, autonomous, sympathetic, parasympathetic, Purkinje, Bates, etc.), glial cells (e.g., microglia, astrocytes, oligodendrocytes) and / or supporting cells of the brain, such as immune cells (e.g., T cells). The tissues of the CNS can be, but are not limited to, the cortex (e.g., frontal lobe, parietal lobe, occipital lobe, temporal lobe), thalamus, hypothalamus, striatum, putamen, caudate nucleus, hippocampus, entorhinal cortex, basal nucleus, or deep cerebellar nucleus.

[0144] In one embodiment, the targeting peptide can direct the AAV particles to cells or tissues of the PNS. The cells or tissues of the PNS can be, but are not limited to, dorsal root ganglia (DRG).

[0145] Following intravenous administration, the targeting peptide can direct the AAV particles to the CNS (eg, the cortex).

[0146] Following intravenous administration, the targeting peptide can direct the AAV particles to the PNS (eg, DRG).

[0147] The length of targeting peptide can change.In one embodiment, the length of targeting peptide is 3-20 amino acid.As limiting examples, the length of targeting peptide can be 3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20 or 3-5,3-8,3-10,3-12,3-15,3-18,3-20,5-10,5-15,5-20,10-12,10-15,10-20,12-20 or 15-20 amino acid.

[0148] The targeting peptide of the present disclosure can be identified and / or designed by any method known in the art. As a non-limiting example, such as Deverman et al. (Nature Biotechnology 34 (2): 204-209 (2016)), Chan et al. (Nature Neuroscience 20 (8): 1172-1179 (2017)), and the CREATE system described in International Patent Application Publication Nos. WO2015038958 and WO0100100671 (the contents of each of which are incorporated herein by reference in their entirety) can be used as a means for identifying the targeting peptide in mice or other research animals (such as but not limited to non-human primates).

[0149] Targeting peptides and related AAV particles can be identified from a library of AAV capsids comprising targeting peptide variants. In one embodiment, the targeting peptide can be a sequence of 7 amino acids (7 aggressiveness). In another embodiment, the targeting peptide can be a sequence of 9 amino acids (9 aggressiveness). The creation or design method of the targeting peptide may also be different, and non-limiting examples include random peptide selection, site saturation mutagenesis and / or optimization of specific regions (e.g., flanking regions or central core) of the peptide.

[0150] In one embodiment, the targeting peptide library comprises targeting peptides of 7 amino acids in length (7-mers) randomly generated by PCR.

[0151] In one embodiment, the targeting peptide library comprises targeting peptides with 3 mutant amino acids. In one embodiment, these 3 mutant amino acids are continuous amino acids. In another embodiment, these 3 mutant amino acids are not continuous amino acids. In one embodiment, the parent targeting peptide is 7 aggressiveness. In another embodiment, the parent peptide is 9 aggressiveness.

[0152] In one embodiment, the targeting peptide library comprises 7-mer targeting peptides, wherein the amino acids of the targeting peptide and / or flanking sequences are formed by site saturation mutagenesis of 3 consecutive amino acids. In one embodiment, the NNK (N=any base; K=G or T) codon is used to generate site saturation mutation sequences.

[0153] AAV particles containing capsid proteins with targeting peptide inserts are produced, and a viral genome encoding a reporter gene (e.g., GFP) is encapsulated therein. These AAV particles (or AAV capsid libraries) are then administered to transgenic mice by intravenous delivery to the tail vein. Due to the expression of Cre, administration of these capsid libraries to cre-expressing mice results in expression of the reporter gene payload in the target tissue.

[0154] AAV particles and / or viral genomes can be recovered from target tissues to identify targeting peptides and enriched associated AAV particles, which indicate enhanced target tissue transduction. Enrichment can be determined using standard methods in the art, such as, but not limited to, next generation sequencing (NGS), viral genome quantification, biochemical assays, immunohistochemistry, and / or imaging of target tissue samples.

[0155] The target tissue can be any cell, tissue or organ of the subject. As non-limiting examples, samples can be collected from the brain, spinal cord, dorsal root ganglia and associated nerve roots, liver, heart, gastrocnemius, soleus, pancreas, kidney, spleen, lung, adrenal gland, stomach, sciatic nerve, saphenous nerve, thyroid gland, eye (with or without optic nerve), pituitary gland, skeletal muscle (rectus), colon, duodenum, ileum, jejunum, leg skin, superior cervical ganglion, bladder, ovary, uterus, prostate, testis and / or any site found to have lesions or concerns.

[0156] Targeting peptide sequence

[0157] In one embodiment, the targeting peptide may comprise a sequence as shown in Table 2. In Table 2, "_1" refers to a NNM codon, wherein A or C is at the third position, and "_2" refers to a NNK codon, wherein G or T is at the third position. In addition, since Met or Trp can only be encoded by codons ATG and TGG, respectively, the NNM codon cannot cover the entire amino acid pool. Therefore, some "NNM" sequences also include some codons ending with G.

[0158] Table 2. Peptides

[0159]

[0160]

[0161]

[0162]

[0163]

[0164]

[0165]

[0166]

[0167]

[0168]

[0169]

[0170]

[0171]

[0172] In one embodiment, the targeting peptide can comprise an amino acid sequence that is 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of the sequences shown in Table 2.

[0173] In one embodiment, the targeting peptide may comprise 4 or more consecutive amino acids of any targeting peptide disclosed herein. In one embodiment, the targeting peptide may comprise 4 consecutive amino acids of any sequence listed in Table 2. In one embodiment, the targeting peptide may comprise 5 consecutive amino acids of any sequence listed in Table 2. In one embodiment, the targeting peptide may comprise 6 consecutive amino acids of any sequence listed in Table 2.

[0174] In one embodiment, the AAV particle of the present disclosure comprises an AAV capsid having a targeting peptide insert, wherein the targeting peptide has an amino acid sequence as listed in any one of Table 2.

[0175] In one embodiment, the AAV particle of the present disclosure comprises an AAV capsid having a targeting peptide insert, wherein the targeting peptide has an amino acid sequence comprising at least 4 consecutive amino acids of any sequence listed in any one of Table 2.

[0176] In one embodiment, the AAV particle of the present disclosure comprises an AAV capsid having a targeting peptide insert, wherein the targeting peptide has an amino acid sequence that substantially comprises any sequence listed in any one of Table 2.

[0177] In one embodiment, an AAV particle of the present disclosure comprises an AAV capsid polynucleotide having a targeting nucleic acid insert, wherein the targeting nucleic acid insert has a nucleotide sequence that essentially comprises the nucleotide sequence listed in any one of Table 2.

[0178] The AAV particles of the present disclosure comprising a targeting nucleic acid insert can have a polynucleotide sequence having a polynucleotide sequence that is 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to the parental capsid sequence.

[0179] The AAV particles of the disclosure comprising a targeting peptide insert can have an amino acid sequence that is 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to the parental capsid sequence.

[0180] In any DNA and RNA sequences cited and / or described herein, the single letter symbols have the following descriptions: A represents adenine; C represents cytosine; G represents guanine; T represents thymine; U represents uracil; W represents a weak base, such as adenine or thymine; S represents a strong nucleotide, such as cytosine and guanine; M represents an amino nucleotide, such as adenine and cytosine; K represents a keto nucleotide, such as guanine and thymine; R represents a purine adenine and Guanine; Y represents the pyrimidines cytosine and thymine; B represents any base that is not A (e.g., cytosine, guanine, and thymine); D represents any base that is not C (e.g., adenine, guanine, and thymine); H represents any base that is not G (e.g., adenine, cytosine, and thymine); V represents any base that is not T (e.g., adenine, cytosine, and guanine); N represents any nucleotide (not a vacancy); and Z represents zero.

[0181] In any amino acid sequence referred to and / or described herein, the single letter symbols have the following descriptions: G (Gly) represents glycine; A (Ala) represents alanine; L (Leu) represents leucine; M (Met) represents methionine; F (Phe) represents phenylalanine; W (Trp) represents tryptophan; K (Lys) represents lysine; Q (Gln) represents glutamine; E (Glu) represents glutamic acid; S (Ser) represents serine; P (Pro) represents proline; V (Val) represents valine; I (Ile) represents leucine; represents isoleucine; C (Cys) represents cysteine; Y (Tyr) represents tyrosine; H (His) represents histidine; R (Arg) represents arginine; N (Asn) represents asparagine; D (Asp) represents aspartic acid; T (Thr) represents threonine; B (Asx) represents aspartic acid or asparagine; J (Xle) represents leucine or isoleucine; O (Pyl) is pyrrolysine; U (Sec) represents selenocysteine; X (Xaa) represents any amino acid; Z (Glx) represents glutamine or glutamic acid.

[0182] Use of targeting peptides in AAV particles

[0183] The targeting peptide can be an independent peptide, or can be inserted or linked to a parent sequence. In one embodiment, the targeting peptide is inserted into the capsid protein of the AAV particle.

[0184] One or more targeting peptides can be inserted into a parent AAV capsid sequence to produce the AAV particles of the disclosure.

[0185] The targeting peptide can be inserted into the parent AAV capsid sequence at any position that produces a fully functional AAV particle. The targeting peptide can be inserted into VP1, VP2 and / or VP3. The numbering of amino acid residues varies with AAV serotype, so the exact amino acid position of the targeting peptide insertion may not be critical. As used herein, the amino acid position of the parent AAV capsid sequence is described using AAV9 (SEQ ID NO: 2) as a reference.

[0186] In one embodiment, the targeting peptide is inserted into a hypervariable region of the AAV capsid sequence. Non-limiting examples of such hypervariable regions include loop IV and loop VIII of the parent AAV capsid. Without wishing to be bound by theory, these surface-exposed loops are unstructured and poorly conserved, making them ideal regions for inserting targeting peptides.

[0187] In one embodiment, the targeting peptide is inserted into loop IV. In another embodiment, the targeting peptide is used to replace a portion or all of loop IV. As a non-limiting example, adding a targeting peptide to a parent AAV capsid sequence can result in a substitution or mutation of at least one amino acid of the parent AAV capsid.

[0188] In one embodiment, the targeting peptide is inserted into loop VIII. In another embodiment, the targeting peptide is used to replace a portion or all of loop VIII. As a non-limiting example, adding a targeting peptide to a parent AAV capsid sequence can result in a substitution or mutation of at least one amino acid of the parent AAV capsid.

[0189] In one embodiment, more than one targeting peptide is inserted into the parent AAV capsid sequence. As a non-limiting example, the targeting peptide can be inserted at loop IV and loop VIII in the same parent AAV capsid sequence.

[0190] The targeting peptide can be inserted into any amino acid position of the parent AAV capsid sequence, for example, but not limited to, 586-592, 588-589, 586-589, 452-458, 262-269, 464-473, 491-495, 546-557, and / or 659-668.

[0191] In a preferred embodiment, the targeting peptide is inserted into the parent AAV capsid sequence between amino acids at positions 588 and 589 (loop VIII). In one embodiment, the parent AAV capsid is AAV9 (SEQ ID NO: 2). In a second embodiment, the parent AAV capsid is K449R AAV9 (SEQ ID NO: 3).

[0192] The targeting peptides described herein can increase the transduction of the AAV particles of the present disclosure to the target tissue compared to the parent AAV particles lacking the targeting peptide insert. In one embodiment, the targeting peptide increases the transduction of the AAV particles to the target tissue by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 200%, 300%, 400%, 500% or more compared to the parent AAV particles lacking the targeting peptide insert.

[0193] In one embodiment, the targeting peptide increases transduction of the AAV particles to cells or tissues of the CNS by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 200%, 300%, 400%, 500% or more compared to a parent AAV particle lacking the targeting peptide insert.

[0194] In one embodiment, the targeting peptide increases transduction of the AAV particles into cells or tissues of the PNS by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 200%, 300%, 400%, 500% or more compared to a parent AAV particle lacking the targeting peptide insert.

[0195] In one embodiment, the targeting peptide increases transduction of the AAV particles into cells or tissues of the DRG by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 200%, 300%, 400%, 500% or more compared to a parent AAV particle lacking the targeting peptide insert.

[0196] AAV production

[0197] The virus production disclosed herein describes processes and methods for producing AAV particles with enhanced, improved and / or increased tropism for target tissues, which can be used to contact target cells to deliver a payload.

[0198] The present disclosure provides a method for producing AAV particles comprising a targeting peptide. In one embodiment, AAV particles are prepared by carrying out viral genome replication in a viral replication cell. Any method known in the art can be used to prepare AAV particles. In one embodiment, AAV particles are produced in mammalian cells (e.g., HEK293). In another embodiment, AAV particles are produced in insect cells (e.g., Sf9).

[0199] Methods for preparing AAV particles are well known in the art and are described in, for example, U.S. Pat. Nos. 6,204,059, 5,756,283, 6,258,595, 6,261,551, 6,270,996, 6,281,010, 6,365,394, 6,475,769, 6,482,634, 6,485,966, 6,943,019, 6,953,690, 7,022,519, 7,238,526, and 7,571,769. 291498 and US7491508, US5064764, US6194191, US6566118, US8137948; or International Publication Nos. WO1996039530, WO1998010088, WO1999014354, WO1999015685, WO1999047691, WO2000055342, WO2000075353 and WO2001023597; Methods In Molecular Biology, ed. Richard, Humana Press, NJ (1995); O'Reilly et al., Baculovirus Expression Vectors, A Laboratory Manual, Oxford Univ. Press (1994); Samulski et al., J. Vir. 63:3822-8 (1989); Kajigaya et al., Proc. Nat'l. Acad. Sci. USA 88:4646-50 (1991); Ruffing et al., J. Vir. 66:6922-30 (1992); Kimbauer et al., Vir., 219:37-44 (1996); Zhao et al., Vir. 272:382-93 (2000), the contents of each of which are incorporated herein by reference in their entirety. In one embodiment, the AAV particles are prepared using the methods described in International Patent Publication No. WO2015191508, the contents of which are incorporated herein by reference in their entirety.

[0200] Therapeutic applications

[0201] The present disclosure provides a method for treating a disease, disorder and / or condition in a mammalian subject, including a human subject, comprising administering to the subject an AAV particle described herein, wherein the AAV particle comprises a novel capsid defined by the present disclosure ("TRACER AAV particle"); or administering to the subject any of the compositions described herein, including the pharmaceutical compositions described herein.

[0202] In one embodiment, TRACER AAV particles of the present disclosure are prophylactically administered to a subject to prevent the onset of disease. In another embodiment, TRACER AAV particles of the present disclosure are administered to treat a disease or symptom (mitigation of its impact). In yet another embodiment, TRACER AAV particles of the present disclosure are administered to cure (eliminate) a disease. In another embodiment, TRACER AAV particles of the present disclosure are administered to prevent or slow down the progress of a disease. In yet another embodiment, TRACER AAV particles of the present disclosure are used to reverse the deleterious effects of a disease. Disease state and / or progress can be determined or monitored by standard methods known in the art.

[0203] In some embodiments, the TRACER AAV particles of the present disclosure are used in the medical field to treat, prevent, alleviate or ameliorate neurological diseases and / or disorders.

[0204] In some embodiments, the TRACER AAV particles of the present disclosure are used in the medical field to treat, prevent, alleviate or ameliorate tauopathy.

[0205] In some embodiments, the TRACER AAV particles of the present disclosure are used in the medical field to treat, prevent, alleviate or ameliorate Alzheimer's disease.

[0206] In some embodiments, the TRACER AAV particles of the present disclosure are used in the medical field to treat, prevent, alleviate or ameliorate Friedreich's ataxia or any disease caused by the loss or partial loss of Frataxin protein.

[0207] In some embodiments, the TRACER AAV particles of the present disclosure are used in the medical field to treat, prevent, alleviate or ameliorate Parkinson's disease.

[0208] In some embodiments, the TRACER AAV particles of the present disclosure are used in the medical field to treat, prevent, alleviate or ameliorate amyotrophic lateral sclerosis.

[0209] In some embodiments, the TRACER AAV particles of the present disclosure are used in the medical field to treat, prevent, alleviate or ameliorate Huntington's disease.

[0210] In some embodiments, the TRACER AAV particles of the present disclosure are used in the medical field to treat, prevent, alleviate or ameliorate chronic or neuropathic pain.

[0211] In some embodiments, the TRACER AAV particles of the present disclosure are used in the medical field to treat, prevent, alleviate or ameliorate diseases related to the central nervous system.

[0212] In some embodiments, the TRACER AAV particles of the present disclosure are used in the medical field to treat, prevent, alleviate or ameliorate diseases related to the peripheral nervous system.

[0213] In one embodiment, a TRACER AAV particle of the disclosure is administered to a subject suffering from at least one of the diseases or symptoms described herein.

[0214] As used herein, any disease associated with the central or peripheral nervous system and its components (eg, neurons) can be considered a "neurological disease."

[0215] Any neurological disease may be treated with the TRACER AAV particles of the present disclosure or pharmaceutical compositions thereof, including, but not limited to, Absence of the Septum Pellucidum, Acid Lipase Disease, Acid Maltase Deficiency, Acquired Epileptiform Aphasia, Acute Disseminated Encephalomyelitis, Attention Deficit-Hyperactivity Disorder (ADHD), Adie's Pupil, Adie's Syndrome, Adrenoleukodystrophy, Agenesis of the Corpus Callosum, Agnosia, Aicardi Syndrome, Aicardi-Goutieres Syndrome, and the like. Syndrome Disorder, AIDS-Neurological Complications, Alexander Disease, Alpers' Disease, Alternating Hemiplegia, Alzheimer's Disease, ALS, Anencephaly, Aneurysm, Angelman Syndrome, Angiomatosis, Anoxia, Antiphospholipid Syndrome, Aphasia, Apraxia, Arachnoid Cysts, Arachnoiditis, Arnold-Chiari Malformation, Arteriovenous Malformation, Asperger Syndrome, Ataxia, Ataxia-telangiectasiaTelangiectasia, Ataxias and Cerebellar or Spinocerebellar Degeneration, Atrial Fibrillation and Stroke, Attention Deficit-Hyperactivity Disorder, Autism Spectrum Disorder, Autonomic Dysfunction, Back Pain, Barth Syndrome, Batten Disease, Becker's Myotonia, Bechet's Disease, Bell's Palsy, Benign Essential Blepharospasm, Benign Focal Amyotrophy, Benign Intracranial Hypertension, Bernhardt-Roth Syndrome Syndrome, Binswanger's Disease, Blepharospasm, Bloch-Sulzberger Syndrome, Brachial Plexus Birth Injuries, Brachial Plexus Injuries, Bradbury-Eggleston Syndrome, Brain and Spinal Tumors, Brain Aneurysm, Brain Injury, Brown-Sequard Syndrome, Bulbarpalsy, Bulbospinal Muscular Atrophy, Cerebral Autosomal Dominant Arteriopathy with Sub-cortical Infarcts and Leukocytic EncephalopathyInfarcts and Leukoencephalopathy (CADASIL), Canavan Disease, Carpal Tunnel Syndrome, Causalgia, Cavernous Malformation, Central Cervical Cord Syndrome, Central Cord Syndrome, Central Pain Syndrome, Central Pontine Myelinolysis, Cephalic Disorders, Ceramidase Deficiency, Cerebellar Degeneration, Cerebellar Hypoplasia, Cerebral Aneurysms, Cerebral Arteriosclerosis, Cerebral Atrophy Atrophy, Cerebral Beriberi, Cerebral Cavernous Malformation, Cerebral Gigantism, Cerebral Hypoxia, Cerebral Palsy, Cerebro-Oculo-Facio-Skeletal Syndrome (COFS), Charcot-Marie-Tooth Disease, Chiari Malformation, Cholesterol Ester Storage Disease, Chorea, Choreoacanthocytosis, Chronic Inflammatory Demyelinating Polyneuropathy (CIDP), Chronic Orthostatic Intolerance, Chronic Pain, Cockayne Syndrome Type IISyndrome Type II, Coffin Lowry Syndrome, Colpocephaly, Coma, Complex Regional Pain Syndrome, Concentric sclerosis (Baló's sclerosis), Congenital Facial Diplegia, Congenital Myasthenia, Congenital Myopathy, Congenital Vascular Cavernous Malformations, Corticobasal Degeneration, Cranial Arteritis, Craniosynostosis, Cree encephalitis, Creutzfeldt-Jakob Disease, Chronic progressive external ophtalmoplegia, Cumulative Trauma Disorders, Cushing's Syndrome, Cytomegalic Inclusion Body Disease, Cytomegalovirus Infection, Dancing Eyes-Dancing Feet Syndrome, Dandy-Walker Syndrome, Dawson Disease, De Morsier's Syndrome, Dejerine-Klumpke Palsy, Dementia, Dementia-Multi-Infarct, Dementia-Semantic, Dementia-Subcortical, Dementia With Lewy Bodies, Demyelinationdiseases), Dentate Cerebellar Ataxia, Dentatorubral Atrophy, Dermatomyositis, Developmental Dyspraxia, Devic's Syndrome, Diabetic Neuropathy, Diffuse Sclerosis, Distal hereditary motor neuronopathies, Dravet Syndrome, Dysautonomia, Dysgraphia, Dyslexia, Dysphagia, Dyspraxia, Dyssynergia Cerebellaris Myoclonica, Dyssynergia Cerebellaris Progressiva), Dystonias, Early Infantile Epileptic Encephalopathy, Empty Sella Syndrome, Encephalitis, Encephalitis Lethargica, Encephaloceles, Encephalomyelitis, Encephalopathy, Encephalopathy (familial infantile), Encephalotrigeminal Angiomatosis, Epilepsy, Epileptic Hemiplegia, Episodic ataxia, Erb's Palsy, Erb-Duchenne and Dejerine-Klumpke Palsies, Essential Tremor Tremor, Extrapontine Myelinolysis, Faber's disease, Fabry diseaseDisease), Fahr's Syndrome, Fainting, Familial Dysautonomia, Familial Hemangioma, Familial Idiopathic Basal Ganglia Calcification, Familial Periodic Paralyses, Familial Spastic Paralysis, Farber's Disease, Febrile Seizures, Fibromuscular Dysplasia, Fisher Syndrome, Floppy Infant Syndrome, Foot Drop, Friedreich's Ataxia, Frontotemporal Dementia, Gaucher Disease, Generalized Gangliosidosis (GM1, GM2) Gangliosidoses (GM1, GM2), Gerstmann's Syndrome, Gerstmann-Straussler-Scheinker Disease, Giant Axonal Neuropathy, Giant Cell Arteritis, Giant Cell Inclusion Disease, Globoid Cell Leukodystrophy, Glossopharyngeal Neuralgia, Glycogen Storage Disease, Guillain-Barré Syndrome, Hallervorden-Spatz Disease, Head Injury, Headache, Hemicrania Continua, Hemifacial SpasmSpasm、Hemiplegia Alterans、Hereditary Neuropathies、Hereditary Spastic Paraplegia、Heredopathia Atactica Polyneuritiformis、Herpes Zoster、Herpes Zoster Oticus、Hirayama Syndrome、Holmes-Adie Syndrome、Holoprosencephaly、HTLV-1 Associated Myelopathy、Hughes Syndrome、Hughes Syndrome、Huntington's Disease、Hurler Syndrome、Hydranencephaly、Hydrocephalus、Hydrocephalus-Normal Pressure、Hydromyelia、Hypercortisolism、Hypersomnia、Hypertonia、Hypotonia、Hypoxia、Immune-Mediated Encephalomyelitis、Inclusion Body Myositis、Incontinentia Pigmenti、Infantile Hypotonia、Infantile Neuroaxonal Dystrophy、Infantile Phytanic Acid Storage Disease、Infantile Refsum Disease、Infantile Spasms、Inflammatory Myopathies、Iniencephaly、Intestinal Lipodystrophy、Intracranial Cysts Cysts), intracranial hypertensionHypertension), Isaacs' Syndrome, Joubert Syndrome, Kearns-Sayre Syndrome, Kennedy's Disease, Kinsbourne syndrome, Kleine-Levin Syndrome, Klippel-Feil Syndrome, Klippel-Trenaunay Syndrome (KTS), Klüver-Bucy Syndrome, Korsakoff's Amnesic Syndrome, Krabbe Disease, Kugelberg-Welander Disease, Kuru, Lambert-Eaton Myasthenic Syndrome Syndrome, Landau-Kleffner Syndrome, Lateral Femoral Cutaneous Nerve Entrapment, Lateral Medullary Syndrome, Learning Disabilities, Leigh's Disease, Lennox-Gastaut Syndrome, Lesch-Nyhan Syndrome, Leukodystrophy, Levine-Critchley Syndrome, Lewy Body Dementia, Lichtheim's disease, Lipid Storage Diseases, Lipoid Proteinosis, Lissencephaly, Locked-In Syndrome, Lou Gehrig'sDisease), Lupus-Neurological Sequelae, Lyme Disease-Neurological Complications, Lysosomal storage disorders, Machado-Joseph Disease, Macroencephaly, Megalencephaly, Melkersson-Rosenthal Syndrome, Meningitis, Meningitis and Encephalitis, Menkes Disease, Meralgia Paresthetica, Metachromatic Leukodystrophy, Microcephaly, Migraine, Miller Fisher Syndrome, Mini Stroke, Mitochondrial Myopathy, Mitochondrial DNA Deletion Syndrome depletionsyndrome、Moebius Syndrome、Monomelic Amyotrophy、Morvan Syndrome、Motor Neuron Diseases、Moyamoya Disease、Mucolipidoses、Mucopolysaccharidoses、Multi-Infarct Dementia、Multifocal Motor Neuropathy、Multiple Sclerosis、Multiple System Atrophy、Multiple System Atrophy with Orthostatic Hypotension、Muscular DystrophyDystrophy、Myasthenia-Congenital、Myasthenia Gravis、Myelinoclastic Diffuse Sclerosis、Myelitis、Myoclonic Encephalopathy of Infants、Myoclonus、Myoclonus epilepsy、Myopathy、Myopathy-Congenital、Myopathy-Thyrotoxic、Myotonia、Myotonia Congenita、Narcolepsy、NARP(neuropathy,ataxia and retinitis pigmentosa)、Neuroacanthocytosis、Neurodegeneration with Brain Iron Accumulation、Neurodegenerative Diseases disease), Neurofibromatosis, Neuroleptic Malignant Syndrome, Neurological Complications of AIDS, Neurological Complications of Lyme Disease, Neurological Consequences of Cytomegalovirus Infection, Neurological Manifestations of Pompe Disease, Neurological Sequelae Of Lupus, Neuromyelitis Optica, Neuromyotonia, Neuronal Ceroid Lipofuscinosis, Neuronal Migration DisordersDisorders、Neuropathic pain、Neuropathy-Hereditary、Neuropathy、Neurosarcoidosis、Neurosyphilis、Neurotoxicity、Nevus Cavernosus、Niemann-Pick Disease、O'Sullivan-McLeod Syndrome、Occipital Neuralgia、Ohtahara Syndrome、Olivopontocerebellar Atrophy、Opsoclonus Myoclonus、Orthostatic Hypotension、Overuse Syndrome、Pain-Chronic、Pantothenate Kinase-Associated Neurodegenerative Diseases Neurodegeneration、Paraneoplastic Syndromes、Paresthesia、Parkinson's Disease、Paroxysmal Choreoathetosis、Paroxysmal Hemicrania、Parry-Romberg、Pelizaeus-Merzbacher Disease、Pena Shokeir II Syndrome、Perineural Cysts、Peroneal muscular atrophy、Periodic Paralyses、Peripheral Neuropathy、Periventricular Leukomalacia、Persistent Vegetative State、Pervasive Developmental Disorders、PhytanicAcid Storage Disease、Pick's Disease、Pinched Nerve、Piriformis Syndrome、Pituitary Tumors、Polymyositis、Pompe Disease、Porencephaly、Post-Polio Syndrome、Postherpetic Neuralgia、Postinfectious Encephalomyelitis、Postural Hypotension、Postural Orthostatic Tachycardia Syndrome、Postural Tachycardia Syndrome、Primary Dentatum Atrophy、Primary Lateral Sclerosis、Primary Progressive Aphasia Aphasia), Prion Diseases, Progressive bulbar palsy, Progressive hemifacial atrophy, Progressive locomotor ataxia, Progressive multifocal leukoencephalopathy, Progressive muscular atrophy, Progressive sclerosing poliodystrophy, Progressive supranuclear palsy, Prosopagnosia, Pseudobulbar palsy, Pseudo-Torch syndrome, Pseudotoxoplasmosis syndrome, Pseudotumor cerebri, Psychogenic motorMovement, Ramsay Hunt Syndrome I, Ramsay Hunt Syndrome II, Rasmussen's Encephalitis, Reflex Sympathetic Dystrophy Syndrome, Refsum Disease, Refsum Disease-Infantile, Repetitive Motion Disorders, Repetitive Stress Injuries, Restless Legs Syndrome, Retrovirus-Associated Myelopathy, Rett Syndrome, Reye's Syndrome, Rheumatic Encephalitis, Riley-Day Syndrome, Sacral Nerve Root Cysts Cysts, Saint Vitus Dance, Salivary Gland Disease, Sandhoff Disease, Schilder's Disease, Schizencephaly, Seitelberger Disease, Seizure Disorder, Semantic Dementia, Septo-Optic Dysplasia, Severe Myoclonic Epilepsy of Infancy (SMEI), Shaken Baby Syndrome, Shingles, Shy-Drager Syndrome, Sjogren's Syndrome Syndrome、Sleep Apnea、Sleeping Sickness、Sotos Syndrome、Spasticity、Spina Bifida、Spinal Cord Infarction、Spinal Cord Injury、Spinal Cord Tumors、Spinal Muscular Atrophy、Spinocerebellar Ataxia、Spinocerebellar Atrophy、Spinocerebellar Degeneration、Sporadic ataxia、Steele-Rhardson-Olszewski Syndrome、Stiff-Person Syndrome、Striatonigral Degeneration, Stroke, Sturge-Weber Syndrome, Subacute Sclerosing Panencephalitis, Subcortical Arteriosclerotic Encephalopathy, Short-lasting, Unilateral, Neuralgiform (SUNCT) Headache, Swallowing Disorders, Sydenham Chorea, Syncope, Syphilitic Spinal Sclerosis, Syringohydromyelia, Syringomyelia, Systemic Lupus Erythematosus, Tabes Dorsalis, Tarsive Dyskinesia, Tarlov Cyst Cysts, Tay-Sachs disease, temporal arteritisArteritis, Tethered Spinal Cord Syndrome, Thomsen's Myotonia, Thoracic Outlet Syndrome, Thyrotoxic Myopathy, TicDouloureux, Todd's Paralysis, Tourette Syndrome, Transient Ischemic Attack, Transmissible Spongiform Encephalopathies, Transverse Myelitis, Traumatic Brain Injury, Tremor, Trigeminal Neuralgia, Tropical Spastic Paraparesis, Troyer Syndrome, Tuberous Sclerosis, Vascular Erectile Tumors Tumor, Vasculitis Syndromes of the Central and Peripheral Nervous Systems, Vitamin B12 deficiency, Von Economo's Disease, Von Hippel-Lindau Disease (VHL), Von Recklinghausen's Disease, Wallenberg's Syndrome, Werdnig-Hoffman Disease, Wernicke-Korsakoff Syndrome, West Syndrome, Whiplash, Whipple's Disease, Williams Syndrome.Syndrome), Wilson Disease, Wolman's Disease, and X-Linked Spinal and Bulbar Muscular Atrophy.

[0216] Treatments for neurological disorders

[0217] TRACER AAV particles encoding protein payloads

[0218] The present disclosure provides methods for introducing the TRACER AAV particles of the present disclosure into cells, the methods comprising introducing into the cells any vector sufficient to increase the amount of target mRNA and protein production occurring. In some aspects, the cells can be neurons, such as but not limited to motor, hippocampal, entorhinal, thalamic, cortical, sensory, sympathetic or parasympathetic neurons, and glial cells, such as astrocytes, microglia and / or oligodendrocytes.

[0219] The present disclosure discloses a method for treating a neurological disease related to a function / existence deficiency of a target protein (e.g., ApoE, FXN) in a subject in need of treatment. The method optionally includes administering a composition comprising the TRACER AAV particles of the present disclosure to the subject in a therapeutically effective amount. As a non-limiting example, the TRACER AAV particles can increase the expression of a target gene, increase the generation of a target protein, and therefore reduce one or more symptoms of a neurological disease in a subject, thereby treating the subject.

[0220] In one embodiment, a composition comprising a TRACER AAV particle of the disclosure is administered to the central nervous system of a subject by systemic administration. In one embodiment, the systemic administration is intravenous injection.

[0221] In some embodiments, a composition comprising a TRACER AAV particle of the present disclosure is administered to the central nervous system of a subject. In other embodiments, a composition comprising a TRACER AAV particle of the present disclosure is administered to a CNS tissue of a subject (e.g., the putamen, thalamus, or cortex of a subject).

[0222] In one embodiment, a composition comprising a TRACER AAV particle of the present disclosure is administered to the central nervous system of a subject by intraparenchymal injection. Non-limiting examples of intraparenchymal injections include intra-putamen, intra-cortical, intra-thalamic, intra-striatal, intra-hippocampal, or entorhinal cortex.

[0223] In one embodiment, a composition comprising a TRACER AAV particle of the present disclosure is administered to the central nervous system of a subject by intraparenchymal and intravenous injection.

[0224] In one embodiment, the TRACER AAV particles of the present disclosure can be delivered to specific types of target cells, including, but not limited to, thalamic, hippocampal, entorhinal, cortical, motor, sensory, excitatory, inhibitory, sympathetic, or parasympathetic neurons; glial cells, including oligodendrocytes, astrocytes, and microglia; and / or other cells surrounding neurons, such as T cells.

[0225] In one embodiment, the TRACER AAV particles of the present disclosure may be delivered to neurons in the nucleocapsid, thalamus, and / or cortex.

[0226] In some embodiments, the TRACER AAV particles of the present disclosure may be used as a therapy for neurological diseases.

[0227] In some embodiments, the TRACER AAV particles of the present disclosure can be used as a therapy for tauopathy.

[0228] In some embodiments, the TRACER AAV particles of the present disclosure may be used as a therapy for Alzheimer's disease.

[0229] In some embodiments, the TRACER AAV particles of the present disclosure may be used as a therapy for amyotrophic lateral sclerosis.

[0230] In some embodiments, the TRACER AAV particles of the present disclosure may be used as a therapy for Huntington's disease.

[0231] In some embodiments, the TRACER AAV particles of the present disclosure may be used as a therapy for Parkinson's disease.

[0232] In some embodiments, the TRACER AAV particles of the present disclosure may be used as a therapy for Friedreich's ataxia.

[0233] In some embodiments, the TRACER AAV particles of the present disclosure may be used as a therapy for chronic or neuropathic pain.

[0234] In one embodiment, administering the TRACER AAV particles described herein to a subject can increase the level of a target protein in the subject. In a subject (e.g., but not limited to, the CNS, a CNS region, or a specific cell of the CNS of a subject), the level of the target protein can be increased by about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-1 In some embodiments, the TRACER AAV particles can increase the protein level of a target protein by at least 50%. As a non-limiting example, TRACER AAV particles can increase the protein level of the target protein by at least 40%. As a non-limiting example, a subject can have a 10% increase in the target protein. As a non-limiting example, TRACER AAV particles can increase the protein level of the target protein by several times over baseline. In one embodiment, TRACER AAV particles cause the target protein level to increase by 5-6 times.

[0235] In one embodiment, administering the TRACER AAV particles described herein to a subject can increase the expression of a target protein in the subject. In a subject (e.g., but not limited to, the CNS, a CNS region, or a specific cell of the CNS of a subject), the expression of the target protein can be increased by about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-1 In some embodiments, the TRACER AAV particles can increase the expression of a target protein by at least 50%. As a non-limiting example, the TRACER AAV particles can increase expression of a target protein by at least 40%.

[0236] In one embodiment, intravenous administration of TRACER AAV particles described herein to a subject can increase CNS expression of a target protein in a subject. In a subject (e.g., but not limited to, a subject's CNS, a CNS region, or a specific cell of the CNS), the expression of the target protein can be increased by about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-1 In some embodiments, the TRACER AAV particles can increase the expression of a target protein in the CNS by at least 50%. As a non-limiting example, the TRACER AAV particles can increase expression of a target protein in the CNS by at least 40%.

[0237] In some embodiments, the TRACER AAV particles of the present disclosure can be used to increase target protein expression in astrocytes to treat neurological diseases. The target protein in astrocytes can be increased by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10- 45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20 -70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60% 5-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%,50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95% or 90-95%.

[0238] In some embodiments, TRACER AAV particles can be used to increase target proteins in microglia. The increase in target protein in microglia can independently increase by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-50%, 10-65%, 10-70%, 10-80%, 10-95%, or more than 95%. -45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-7 0%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60 %, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%, 50-95%,55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95% or 90-95%.

[0239] In some embodiments, TRACER AAV particles can be used to increase target protein in cortical neurons. The increase in target protein in cortical neurons can independently increase by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10- -45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-7 0%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60 %, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%, 50-95%,55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95% or 90-95%.

[0240] In some embodiments, TRACER AAV particles can be used to increase target protein in hippocampal neurons. The increase in target protein in hippocampal neurons can independently increase by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10- -45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-7 0%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60 %, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%, 50-95%,55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95% or 90-95%.

[0241] In some embodiments, TRACER AAV particles can be used to increase target protein in DRGs and / or sympathetic neurons. The increase in target protein in DRGs and / or sympathetic neurons can independently increase by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10- 40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-6 5%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%, 35-55 %, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%,50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95% or 90-95%.

[0242] In some embodiments, the TRACER AAV particles of the present disclosure can be used to increase target proteins in sensory neurons to treat neurological diseases. The target protein in sensory neurons can be increased by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-4 5%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20- 70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60% 5-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%,50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95% or 90-95%.

[0243] In some embodiments, the TRACER AAV particles of the present disclosure can be used to increase the target protein and alleviate the symptoms of a neurological disease in a subject. The increase in the target protein and / or the alleviation of the symptoms of a neurological disease can be independently changed (increasing the production of the target protein and reducing the symptoms of a neurological disease) by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-2 0%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20- 45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 25-95%, 30-3 ...0 0-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%,50-70%, 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95% or 90-95%.

[0244] In one embodiment, the TRACER AAV particles of the present disclosure can be used to reduce the decline in functional ability and activities of daily living as measured by standard assessment systems, such as, but not limited to, the Total Functional Capacity (TFC) scale.

[0245] In one embodiment, the TRACER AAV particles of the present disclosure can be used to improve the performance of any assessment used to measure symptoms of a neurological disease. Such assessments include, but are not limited to, ADAS-cog (Alzheimer's Disease Assessment Scale-Cognition), MSE (Mini-Mental State Examination), GDS (Geriatric Depression Scale), FAQ (Functional Activities Questionnaire), ADL (Activities of Daily Living), GPCOG (General Practitioner Assessment of Cognition), Mini-Cog, AMTS (Abbreviated Mental Test Score), Clock-drawing test, 6-CIT (6-item Cognitive Impairment Test), TYM (Test Your Memory), MoCa (Montreal Cognitive Assessment), ACE-R (Addenbrookes Cognitive Assessment), MIS (Memory Impairment Screen), BADLS (Bristol Activities of Daily Living) Scale, Bristol Activities of Daily Living Scale), Barthel Index, Functional Independence Measure, Instrumental Activities of Daily Living, IQCODE (Informant Questionnaire on Cognitive Decline in the Elderly,Questionnaire for Cognitive Decline in the Elderly), Neuropsychiatric Inventory, The Cohen-Mansfield Agitation Inventory, BEHAVE-AD, EuroQol, Short Form-36, and / or MBR Caregiver Strain Instrument, or any other test described in Sheehan B (Ther Adv Neurol Disord. 5(6):349-358 (2012)), the contents of which are incorporated herein by reference in their entirety.

[0246] In some embodiments, the compositions of the present disclosure are administered as a sole therapy or in combination therapy for the treatment of a neurological disease.

[0247] TRACER AAV particles encoding target proteins can be used in combination with one or more other therapeutic agents. "In combination with" does not mean that the agents must be administered simultaneously and / or formulated for delivery together, although these delivery methods fall within the scope of the present disclosure. The composition can be administered simultaneously with, before, or after one or more other desired therapeutic agents or medical procedures. Typically, the agent will be administered at a dose determined for each agent and / or on a schedule.

[0248] Therapeutic agents that can be used in combination with the TRACER AAV particles of the present disclosure can be small molecule compounds that are antioxidants, anti-inflammatory agents, anti-apoptotic agents, calcium regulators, anti-glutamatergic agents, structural protein inhibitors, compounds involved in muscle function, and compounds involved in metal ion regulation. As non-limiting examples, combined therapy can be combined with one or more neuroprotectants (e.g., small molecule compounds, growth factors, and hormones) that have been tested for their neuroprotective effects on motor neuron degeneration.

[0249] Compounds tested for treating neurological disorders that can be used in combination with the TRACER AAV particles described herein include, but are not limited to, cholinesterase inhibitors (donepezil, rivastigmine, galantamine), NMDA receptor antagonists (such as memantine), antipsychotics, antidepressants, anticonvulsants (such as sodium valproate and levetiracetam for myoclonus), secretase inhibitors, amyloid aggregation inhibitors, copper or zinc modulators, BACE inhibitors, tau aggregation inhibitors (such as methylene blue, phenothiazines, anthraquinones, n-anilines or rhodamine), microtubule stabilizers (e.g., NAP, taxol, or paclitaxel), kinase or phosphatase inhibitors (e.g., inhibitors targeting GSK3β (lithium) or PP2A), Aβ peptide or tau phospho-epitope immunization, anti-tau or anti-amyloid antibodies, dopamine depleting agents (e.g., tetrabenazine for chorea), benzodiazepines (e.g., clonazepam for myoclonus, chorea, dystonia, spasticity, and / or spasticity), amino acid precursors of dopamine (e.g., phenytoin for spasticity), levodopa), skeletal muscle relaxants (e.g., baclofen, tizanidine for spasticity and / or spasticity), inhibitors of acetylcholine release at the neuromuscular junction to cause muscle paralysis (e.g., botulinum toxin for bruxism and / or dystonia), atypical neuroleptics (e.g., olanzapine and quetiapine for psychosis and / or dysphoria; risperidone, sulpiride, and haloperidol for psychosis, chorea, and / or dysphoria; clozapine for resistant psychosis; aripiprazole for psychosis with prominent negative symptoms), selective serotonin reuptake inhibitors (SSRIs) (e.g., citalopram, fluoxetine, paroxetine, sertraline, mirtazapine, venlafaxine for depression, anxiety, obsessive-compulsive behavior, and / or dysphoria), hypnotics (e.g., zopiclone and / or zolpidem to alter the sleep-wake cycle), anticonvulsants (e.g., valproate and carbamazepine for mania or hypomania), and mood stabilizers (e.g., lithium for mania or hypomania).

[0250] Neurotrophic factors can be used in combination therapy with TRACER AAV particles of the present disclosure for the treatment of nervous system diseases. Generally, neurotrophic factors are defined as substances that promote the survival, growth, differentiation, proliferation and / or maturation of neurons or stimulate the increase of neuronal activity. In some embodiments, the method also includes delivering one or more trophic factors to a subject in need of treatment. Trophic factors can include but are not limited to IGF-I, GDNF, BDNF, CTNF, VEGF, Colivelin, Zaliroden, thyrotropin-releasing hormone and ADNF and variants thereof.

[0251] In one aspect, the TRACER AAV particles described herein can be co-administered with TRACER AAV particles expressing neurotrophic factors, such as AAV-IGF-I (see, e.g., Vincent et al., Neuromolecular medicine, 2004, 6, 79-85; the contents of which are incorporated herein by reference in their entirety) and AAV-GDNF (see, e.g., Wang et al., J Neurosci., 2002, 22, 6920-6928; the contents of which are incorporated herein by reference in their entirety)).

[0252] In one embodiment, administration of the TRACER AAV particles to a subject will increase expression of the target protein in the subject, and the increase in target protein expression will reduce the effects and / or symptoms of a neurological disease in the subject.

[0253] As a non-limiting example, the target protein may be an antibody or a fragment thereof.

[0254] TRACER AAV particles containing RNAi agents or regulatory polynucleotides

[0255] The present disclosure provides a method of introducing a TRACER AAV particle of the present disclosure comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules into a cell, the method comprising introducing any vector into the cell in an amount sufficient to cause target mRNA degradation, thereby activating target-specific RNAi in the cell. In some aspects, the cell can be a neuron, such as, but not limited to, a motor, hippocampal, entorhinal, thalamic, cortical, sensory, sympathetic or parasympathetic neuron, and a glial cell, such as an astrocyte, a microglia and / or an oligodendrocyte.

[0256] The present disclosure discloses a method for treating a neurological disease associated with a dysfunction of a target protein in a subject in need of treatment. The method optionally includes administering to the subject a therapeutically effective amount of a composition comprising TRACER AAV particles of the present disclosure, wherein the TRACER AAV particles comprise a viral genome having a nucleic acid sequence encoding one or more siRNA molecules. As a non-limiting example, the siRNA molecule can silence the expression of a target gene, inhibit the production of a target protein, and reduce one or more symptoms of a neurological disease in a subject, thereby treating the subject.

[0257] In some embodiments, compositions comprising TRACER AAV particles of the present disclosure comprising a viral genome encoding one or more siRNA molecules comprise an AAV capsid that allows for enhanced transduction of CNS and / or PNS cells following intravenous administration.

[0258] In some embodiments, a composition comprising TRACER AAV particles of the present disclosure is administered to the central nervous system of a subject, wherein the TRACER AAV particles have a viral genome encoding at least one siRNA molecule. In other embodiments, a composition comprising TRACER AAV particles of the present disclosure is administered to a tissue of a subject (e.g., a subject's putamen, thalamus, or cortex).

[0259] In one embodiment, a composition comprising a TRACER AAV particle of the present disclosure comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules is administered to the central nervous system of a subject by systemic administration. In one embodiment, systemic administration is intravenous injection.

[0260] In one embodiment, a composition comprising TRACER AAV particles of the present disclosure is administered to the central nervous system of a subject by intraparenchymal injection, wherein the TRACER AAV particles comprise a viral genome having a nucleic acid sequence encoding one or more siRNA molecules. Non-limiting examples of intraparenchymal injections include intra-putamen, intra-cortex, intra-thalamus, intra-striatum, intra-hippocampus, or intra-entorhinal cortex.

[0261] In one embodiment, a composition comprising TRACER AAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules is administered to the central nervous system of a subject by intraparenchymal injection or intravenous injection.

[0262] In one embodiment, TRACER AAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be delivered to specific types of target cells, including but not limited to thalamic, hippocampal, entorhinal, cortical, motor, sensory, excitatory, inhibitory, sympathetic or parasympathetic neurons; glial cells, including oligodendrocytes, astrocytes and microglia; and / or other cells surrounding neurons, such as T cells.

[0263] In one embodiment, TRACER AAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be delivered to neurons in the nucleocapsid, thalamus, and / or cortex.

[0264] In one embodiment, TRACER AAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be used as a therapy for neurological diseases.

[0265] In one embodiment, TRACER AAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be used as a therapy for tauopathy.

[0266] In one embodiment, TRACER AAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be used as a therapy for Alzheimer's disease.

[0267] In one embodiment, TRACER AAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be used as a therapy for amyotrophic lateral sclerosis.

[0268] In one embodiment, TRACER AAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be used as a therapy for Huntington's disease.

[0269] In one embodiment, TRACER AAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be used as a therapy for Parkinson's disease.

[0270] In one embodiment, TRACER AAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be used as a therapy for Friedreich's ataxia.

[0271] In one embodiment, administering to a subject a TRACER AAV particle comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can reduce the target protein level in the subject. In a subject (e.g., but not limited to, the CNS, a CNS region, or a specific cell of the CNS of a subject), the target protein level can be reduced by about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-1 In some embodiments, the TRACER AAV particles can reduce the protein level of a target protein by at least 50%. As a non-limiting example, the TRACER AAV particles can reduce the protein level of a target protein by at least 40%.

[0272] In one embodiment, administering to a subject a TRACER AAV particle comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can reduce the expression of a target protein in a subject. In a subject (e.g., but not limited to, the CNS, a CNS region, or a specific cell of the CNS of a subject), the expression of the target protein can be reduced by about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-1 In some embodiments, the TRACER AAV particles can reduce the expression of a target protein by at least 50%. As a non-limiting example, the TRACER AAV particle can reduce expression of a target protein by at least 40%.

[0273] In one embodiment, administering to a subject a TRACER AAV particle comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can reduce the expression of a target protein in the CNS of the subject. In a subject (e.g., but not limited to, the CNS, a CNS region, or a specific cell of the CNS of a subject), the expression of the target protein can be reduced by about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-1 In some embodiments, the TRACER AAV particles can reduce the expression of a target protein by at least 50%. As a non-limiting example, the TRACER AAV particle can reduce expression of a target protein by at least 40%.

[0274] In one embodiment, TRACER AAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be used to inhibit a target protein in astrocytes to treat neurological diseases. The target protein in astrocytes can be inhibited by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10- 40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20 -60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 3 5-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%,or 90-95%. The target protein in astrocytes can be reduced by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15- 75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75 %, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%,40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55- 65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95% or 90-95%.

[0275] In one embodiment, TRACER AAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be used to inhibit a target protein in microglia. Inhibition of a target protein in microglia can independently inhibit 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-95%, or more than 95%. -40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-6 0%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45 %, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%,or 90-95%. The reduction may be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20% , 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-8 5%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25 -90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%,40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95% or 90-95%.

[0276] In one embodiment, TRACER AAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be used to inhibit a target protein in cortical neurons. Inhibition of the target protein in cortical neurons can be independently inhibited by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 1 0-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20- 60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45 %, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%,or 90-95%. The reduction may be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20% , 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-8 5%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25 -90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%,40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95% or 90-95%.

[0277] In one embodiment, TRACER AAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be used to inhibit a target protein in hippocampal neurons. Inhibition of the target protein in hippocampal neurons can be independently inhibited by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10- -40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-6 0%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45 %, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%,or 90-95%. The reduction may be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20% , 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-8 5%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25 -90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%,40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95% or 90-95%.

[0278] In one embodiment, TRACER AAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be used to inhibit a target protein in DRG and / or sympathetic neurons. Inhibition of target protein in DRG and / or sympathetic neurons can be independently inhibited by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%,or 90-95%. The reduction may be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10 -20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-8 0%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80 %, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%,40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95% or 90-95%.

[0279] In one embodiment, TRACER AAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be used to inhibit a target protein in sensory neurons to treat a neurological disease. The target protein in the sensory neurons may be inhibited by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10- 40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20 -60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 3 5-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%,or 90-95%. The target protein in sensory neurons may be reduced by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5- 95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25- 80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%,40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95% or 90-95%.

[0280] In one embodiment, TRACER AAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be used to inhibit a target protein and alleviate symptoms of a neurological disease in a subject. Inhibition of the target protein and / or alleviation of symptoms of a neurological disorder may independently reduce or inhibit 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10- 30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20 -50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 25-95%, 0-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%,or 90-95%. ,

[0281] In one embodiment, TRACER AAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be used to reduce the decline in functional ability and activities of daily living as measured by standard assessment systems, such as, but not limited to, the Total Functional Capacity (TFC) scale.

[0282] In some embodiments, the compositions of the present disclosure are administered as a sole therapy or in combination therapy for the treatment of a neurological disease.

[0283] The TRACER AAV particles comprising viral genomes having nucleic acid sequences encoding one or more siRNA molecules can be used in combination with one or more other therapeutic agents. "Combined with ..." does not mean that the medicaments must be administered simultaneously and / or formulated for delivery together, although these delivery methods fall within the scope of the present disclosure. Compositions can be administered simultaneously with one or more other required therapeutic agents or medical procedures, before or after them. Typically, the medicament will be administered at a dosage determined for each medicament and / or on a schedule.

[0284] Therapeutic agents that can be used in combination with TRACERAAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be small molecule compounds that are antioxidants, anti-inflammatory agents, anti-apoptotic agents, calcium regulators, anti-glutamatergic agents, structural protein inhibitors, compounds involved in muscle function, and compounds involved in metal ion regulation.

[0285] Compounds tested for treating neurological diseases that can be used in combination with TRACERAAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules include, but are not limited to, cholinesterase inhibitors (donepezil, rivastigmine, galantamine), NMDA receptor antagonists (such as memantine), antipsychotics, antidepressants, anticonvulsants (such as sodium valproate and levetiracetam for myoclonus), secretase inhibitors, amyloid aggregation inhibitors, copper or zinc modulators, BACE inhibitors anti-tau agents, tau aggregation inhibitors (e.g., methylene blue, phenothiazines, anthraquinones, n-anilines, or rhodamines), microtubule stabilizers (e.g., NAP, taxol, or paclitaxel), kinase or phosphatase inhibitors (e.g., inhibitors targeting GSK3β (lithium) or PP2A), Aβ peptide or tau phospho-epitope immunization, anti-tau or anti-amyloid antibodies, dopamine depleting agents (e.g., tetrabenazine for chorea), benzodiazepines (e.g., clonazepam for myoclonus, chorea, dystonia, spasticity, and / or spasticity) , amino acid precursors of dopamine (e.g., levodopa for spasticity), skeletal muscle relaxants (e.g., baclofen, tizanidine for spasticity and / or spasticity), inhibitors of acetylcholine release at the neuromuscular junction to cause muscle paralysis (e.g., botulinum toxin for bruxism and / or dystonia), atypical neuroleptics (e.g., olanzapine and quetiapine for psychosis and / or dysphoria; risperidone, sulpiride, and haloperidol for psychosis, chorea, and / or dysphoria; dapoxetine for resistant psychosis clozapine for psychosis; aripiprazole for psychosis with prominent negative symptoms), selective serotonin reuptake inhibitors (SSRIs) (e.g., citalopram, fluoxetine, paroxetine, sertraline, mirtazapine, venlafaxine for depression, anxiety, obsessive-compulsive behaviors, and / or irritability), hypnotics (e.g., zopiclone and / or zolpidem to alter the sleep-wake cycle), anticonvulsants (e.g., valproate and carbamazepine for mania or hypomania), and mood stabilizers (e.g., lithium for mania or hypomania).

[0286] Neurotrophic factors can be used for the combined treatment of TRACER AAV particles with a viral genome comprising a nucleotide sequence encoding one or more siRNA molecules for the treatment of nervous system diseases. Generally, neurotrophic factors are defined as substances that promote the survival, growth, differentiation, proliferation and / or maturation of neurons or stimulate the increase in neuronal activity. In some embodiments, this method also includes delivering one or more trophic factors to a subject in need of treatment. Trophic factors can include but are not limited to IGF-I, GDNF, BDNF, CTNF, VEGF, Colivelin, Zaliroden, thyrotropin-releasing hormone and ADNF and variants thereof.

[0287] In one aspect, TRACER AAV particles encoding a nucleic acid sequence of at least one siRNA duplex targeting a target gene can be co-administered with TRACER AAV particles expressing a neurotrophic factor, such as AAV-IGF-I (see, e.g., Vincent et al., Neuromolecular medicine, 2004, 6, 79-85; the contents of which are incorporated herein by reference in their entirety) and AAV-GDNF (see, e.g., Wang et al., J Neurosci., 2002, 22, 6920-6928; the contents of which are incorporated herein by reference in their entirety)).

[0288] In one embodiment, administration of the TRACER AAV particles to a subject will reduce expression of the target protein in the subject, and the reduction in target protein expression will reduce the effects and / or symptoms of a neurological disease in the subject.

[0289] definition

[0290] Adeno-associated virus: As used herein, the term "adeno-associated virus" or "AAV" refers to a member of the genus Dependentovirus, including any particle, sequence, gene, protein, or component derived therefrom.

[0291] AAV particle: As used herein, an "AAV particle" is a virus comprising a capsid and a viral genome having at least one payload region and at least one ITR. As described herein, an "AAV particle of the present disclosure" is a parent capsid sequence comprising at least one targeting peptide insert. The AAV particles of the present disclosure can be recombinantly produced and can be based on a parent or reference sequence of an adeno-associated virus (AAV). AAV particles may be derived from any serotype described herein or known in the art, including a combination of serotypes (i.e., "pseudotyped" AAV) or multiple genomes (e.g., single-stranded or self-complementary). In addition, AAV particles may be replication-defective and / or targeted. In one embodiment, the AAV particles may have a targeting peptide inserted into the capsid to enhance the tropism of the desired target tissue. It should be understood that reference to the AAV particles of the present disclosure also includes pharmaceutical compositions thereof, even if not explicitly stated.

[0292] Administration: As used herein, the term "administering" refers to providing an agent or composition to a subject.

[0293] Amelioration: As used herein, the term "amelioration" or "ameliorating" refers to a lessening of the severity of at least one symptom or disease indicator. For example, in the context of neurodegenerative diseases, amelioration includes a reduction in neuronal loss.

[0294] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to humans at any stage of development. In some embodiments, "animal" refers to non-human animals at any stage of development. In some embodiments, non-human animals are mammals (e.g., rodents, mice, rats, rabbits, monkeys, dogs, cats, sheep, cattle, primates, or pigs). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and worms. In some embodiments, animals are transgenic animals, genetically engineered animals, or clones.

[0295] Antisense strand: As used herein, the term "antisense strand" or "first strand" or "guide strand" of a siRNA molecule refers to a strand that is substantially complementary to a segment of about 10-50 nucleotides (e.g., about 15-30, 16-25, 18-23, or 19-22 nucleotides) of an mRNA that targets a silenced gene. The antisense strand or first strand has a sequence that is sufficiently complementary to the desired target mRNA sequence to guide target-specific silencing, for example, complementarity sufficient to trigger the RNAi mechanism or process to destroy the desired target mRNA.

[0296] Approximately: As used herein, as applied to one or more values, the term "approximately" or "about" refers to a value similar to the reference value. In certain embodiments, the term "approximately" or "about" refers to a range of values ​​that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction (greater or less than) of the reference value, unless otherwise specified or obvious from the context (unless the number exceeds 100% of the possible values).

[0297] Capsid: As used herein, the term "capsid" refers to the protein shell of a viral particle.

[0298] Complementary and substantially complementary: The term "complementary" as used herein refers to the ability of polynucleotides to form base pairs with each other. Base pairs are usually formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide chains. Complementary polynucleotide chains can form base pairs in a Watson-Crick manner (e.g., A to T, A to U, C to G) or in any other manner that allows the formation of a duplex. It is known to those skilled in the art that when RNA is used instead of DNA, uracil (rather than thymine) is considered to be a base complementary to adenine. However, when U is mentioned in the context of the present disclosure, the ability to replace T is implied, unless otherwise stated. Perfect complementarity or 100% complementarity represents such a situation: each nucleotide unit of one polynucleotide chain can form hydrogen bonds with the nucleotide units of the second polynucleotide chain. Less than perfect complementarity represents such a situation: some (but not all) nucleotide units of the two chains can form hydrogen bonds with each other. For example, for two 20-mers, if only two base pairs on each chain can form hydrogen bonds with each other, then the polynucleotide chains show 10% complementarity. In the same example, if 18 base pairs on each strand can form hydrogen bonds with each other, then the polynucleotide strands exhibit 90% complementarity. The term "substantially complementary" as used herein means that the siRNA has a sequence (e.g., in the antisense strand) sufficient to bind to a desired target mRNA and trigger RNA silencing of the target mRNA.

[0299] Control elements: As used herein, "control elements," "regulatory control elements," or "regulatory sequences" refer to promoter regions, polyadenylation signals, transcription termination sequences, upstream regulatory domains, replication origins, internal ribosome entry sites ("IRES"), enhancers, and the like, which provide for replication, transcription, and translation of coding sequences in recipient cells. Not all of these control elements are always required, as long as the selected coding sequence is capable of replication, transcription, and / or translation in the appropriate host cell.

[0300] Delivery: As used herein, "delivery" refers to the act or manner of delivering an AAV particle, compound, substance, entity, moiety, cargo, or payload.

[0301] Element: As used herein, the term "element" refers to a distinct portion of an entity. In some embodiments, an element may be a polynucleotide sequence with a specific purpose that is incorporated into a longer polynucleotide sequence.

[0302] Encapsulation: As used herein, the term "encapsulation" means to enclose, surround, or enclose. For example, capsid proteins typically encapsulate the viral genome.

[0303] Engineered: As used herein, an embodiment of the present disclosure is "engineered" when it is designed to have features or properties that are different from the starting point, wild-type or original molecule.

[0304] Effective amount: As used herein, the term "effective amount" of an agent is an amount sufficient to achieve a beneficial or desired result, e.g., a clinical result, and as such, an "effective amount" depends on the context in which it is used. For example, in the context of administering an agent to treat cancer, an effective amount of the agent, for example, is an amount sufficient to achieve treatment as defined herein, compared to the response obtained without the administration of the agent.

[0305] Expression: As used herein, "expression" of a nucleic acid sequence refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of the RNA transcript (e.g., by splicing, editing, 5' cap formation and / or 3' end processing); (3) translation of the RNA into a polypeptide or protein; and (4) post-translational modification of the polypeptide or protein.

[0306] Characteristic: As used herein, a "characteristic" refers to a feature, characteristic, or distinctive element.

[0307] Formulation: As used herein, a "formulation" includes at least one AAV particle (active ingredient) and excipients and / or inactive ingredients.

[0308] Fragment: As used herein, "fragment" refers to a part. For example, an antibody fragment may include CDR or heavy chain variable region or scFv, etc.

[0309] Functional: As used herein, a "functional" biomolecule is a biomolecule that is in a form that exhibits the properties and / or activities that characterize it.

[0310] Gene expression: The term "gene expression" refers to the process by which a nucleic acid sequence is successfully transcribed and (in most cases) translated to produce a protein or peptide. For clarity, when referring to the measurement of "gene expression", this should be understood to mean that either the nucleic acid product of transcription (e.g., RNA or mRNA) or the amino acid product of translation (e.g., polypeptide or peptide) can be measured. Methods for measuring the amount or level of RNA, mRNA, polypeptides and peptides are well known in the art.

[0311] Homology: As used herein, the term "homology" refers to the overall relatedness between polymer molecules, such as polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. In some embodiments, if the sequences of polymer molecules are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% identical or similar, they are considered to be "homologous" to each other. The term "homologous" necessarily refers to a comparison between at least two sequences (polynucleotide or polypeptide sequences). According to the present disclosure, if the polypeptides encoded by two polynucleotide sequences are at least about 50%, 60%, 70%, 80%, 90%, 95% or at least 99% of at least one at least about 20 amino acid fragments, they are considered to be homologous. In some embodiments, homologous polynucleotide sequences are characterized by the ability to encode fragments of at least 4-5 uniquely specified amino acids. For polynucleotide sequences less than 60 nucleotides in length, homology is determined by the ability to encode fragments of at least 4-5 uniquely specified amino acids. According to the present disclosure, two protein sequences are considered homologous if the proteins are at least about 50%, 60%, 70%, 80% or 90% identical for at least one fragment of about 20 amino acids.

[0312] Identity: As used herein, the term "identity" refers to the overall correlation between polymer molecules, such as polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules. For example, the percentage of identity of two polynucleotide sequences can be calculated by comparing the two sequences for the purpose of optimal comparison (e.g., gaps can be introduced in one or both of the first and second nucleic acid sequences to achieve optimal comparison, and non-identical sequences can be ignored for the purpose of comparison). In certain embodiments, the length of the sequence compared for the purpose of comparison is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or 100% of the length of the reference sequence. The nucleotides at the corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, the molecules are identical at that position. Taking into account the number of gaps and the length of each gap, the percentage of identity between the two sequences is a function of the number of identical positions shared by the sequences, and the gaps need to be introduced to achieve optimal comparison of the two sequences. The alignment of sequences and the determination of the percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using methods such as those described below: Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, AM and Griffin, HG, eds., Humana Press, New Jersey, 1994; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; the contents of each of which are incorporated herein by reference in their entirety.For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4: 11-17), which has been incorporated into the ALIGN program (version 2.0) using a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. Alternatively, the percent identity between two nucleotide sequences can be determined using the GAP program in the GCG software package using the NWSgapdna.CMP matrix. Methods commonly used to determine percent identity between sequences include, but are not limited to, those disclosed in Carillo, H. and Lipman, D., SIAM J Applied Math., 48: 1073 (1988), which is incorporated herein by reference. Techniques for determining identity have been incorporated into publicly available computer programs. Exemplary computer software for determining homology between two sequences include, but are not limited to, the GCG program package, Devereux, J., et al., Nucleic Acids Research, 12(1), 387 (1984)), BLASTP, BLASTN and FASTA Altschul, SF et al., J. Molec. Biol., 215, 403 (1990)).

[0313] Inhibit the expression of a gene: As used herein, the phrase "inhibit the expression of a gene" refers to causing a reduction in the amount of an expression product of a gene. The expression product may be an RNA (e.g., mRNA) transcribed from a gene or a polypeptide translated from an mRNA transcribed from a gene. Typically, a reduction in the level of mRNA will result in a reduction in the level of a polypeptide translated therefrom. The level of expression may be determined using standard techniques for measuring mRNA or protein.

[0314] Insertion: As used herein, the term "insertion" may refer to the addition of a targeting peptide sequence to a parent AAV capsid sequence. An "insertion" may result in the replacement of one or more amino acids of a parent AAV capsid sequence. Alternatively, an insertion may result in no changes to the parent AAV capsid sequence other than the addition of the targeting peptide sequence.

[0315] Inverted terminal repeat: As used herein, the term "inverted terminal repeat" or "ITR" refers to cis-regulatory elements that are used to package a polynucleotide sequence into a viral capsid.

[0316] Library: As used herein, the term "library" refers to a diverse collection of linear polypeptides, polynucleotides, viral particles or viral vectors. As an example, the library can be a DNA library or an AAV capsid library.

[0317] Nervous system disease: As used herein, a "neurological disease" is any disease related to the central or peripheral nervous system and its components (eg, neurons).

[0318] Naturally occurring: As used herein, "naturally occurring" or "wild-type" refers to occurring in nature without artificial assistance or human intervention.

[0319] Open reading frame: As used herein, "open reading frame" or "ORF" refers to a sequence that does not contain a stop codon in a given reading frame.

[0320] Parent sequence: As used herein, a "parent sequence" is a nucleic acid or amino acid sequence from which a variant is derived. In one embodiment, the parent sequence is the sequence into which the heterologous sequence is inserted. In other words, the parent sequence can be considered a receptor or receptor sequence. In one embodiment, the parent sequence is an AAV capsid sequence into which a targeting sequence is inserted.

[0321] Particle: As used herein, a "particle" is a virus composed of at least two components, a protein capsid and a polynucleotide sequence enclosed within the capsid.

[0322] Patient: As used herein, "patient" refers to a subject who may seek or is in need of treatment, is in need of treatment, is receiving treatment, is about to receive treatment, or is being cared for by a trained professional for a particular disease or illness.

[0323] Payload region: As used herein, a "payload region" is any nucleic acid sequence (e.g., within a viral genome) encoding one or more "payloads" of the present disclosure. As a non-limiting example, the payload region can be a nucleic acid sequence within the viral genome of an AAV particle that encodes a payload, wherein the payload is an RNAi agent or a polypeptide. The payload of the present disclosure can be, but is not limited to, a peptide, a polypeptide, a protein, an antibody, an RNAi agent, etc.

[0324] Peptide: As used herein, a "peptide" is less than or equal to 50 amino acids in length, such as about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length.

[0325] Pharmaceutically acceptable: As used herein, the phrase "pharmaceutically acceptable" is used herein to refer to compounds, substances, compositions and / or dosage forms that are, within the scope of sound medical judgment, suitable for contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications, commensurate with a reasonable benefit / risk ratio.

[0326] Prevention: As used herein, the terms "preventing" or "prevention" refer to partially or completely delaying the onset of an infection, disease, disorder, and / or condition; partially or completely delaying the onset of one or more symptoms, characteristics, or clinical manifestations of a specific infection, disease, disorder, and / or condition; partially or completely delaying the onset of one or more symptoms, characteristics, or manifestations of a specific infection, disease, disorder, and / or condition; partially or completely delaying the progression of an infection, a specific disease, disorder, and / or condition; and / or reducing the risk of developing pathology associated with an infection, disease, disorder, and / or condition.

[0327] Prophylactic: As used herein, "prophylactic" refers to a treatment or course of action intended to prevent the spread of disease.

[0328] Prophylaxis: As used herein, "prophylaxis" refers to measures taken to maintain health and prevent the spread of disease.

[0329] Region: As used herein, the term "region" refers to a zone or general area. In some embodiments, when referring to a protein or protein module, a region may include a linear sequence of amino acids along the protein or protein module, or may include a three-dimensional region, an epitope and / or an epitope cluster. In some embodiments, a region includes a terminal region. As used herein, the term "terminal region" refers to a region located at the end or end of a given agent. When referring to a protein, a terminal region may include an N-terminus and / or a C-terminus.

[0330] In some embodiments, when referring to a polynucleotide, a region may include a linear sequence of nucleic acids along the polynucleotide, or may include a three-dimensional region, a secondary structure, or a tertiary structure. In some embodiments, a region includes a terminal region. As used herein, the term "terminal region" refers to a region located at the endpoint or end of a given agent. When referring to a polynucleotide, a terminal region may include a 5' and 3' end.

[0331] RNA or RNA molecule: As used herein, the terms "RNA" or "RNA molecule" or "ribonucleic acid molecule" refer to a polymer of ribonucleotides; the terms "DNA" or "DNA molecule" or "deoxyribonucleic acid molecule" refer to a polymer of deoxyribonucleotides. DNA and RNA can be synthesized naturally (e.g., by DNA replication and transcription of DNA, respectively) or chemically. DNA and RNA can be single-stranded (i.e., ssRNA or ssDNA, respectively) or multi-stranded (e.g., double-stranded, i.e., dsRNA and dsDNA, respectively). As used herein, the term "mRNA" or "messenger RNA" refers to a single-stranded RNA that encodes the amino acid sequence of one or more polypeptide chains.

[0332] RNA interference or RNAi: The term "RNA interference" or "RNAi" as used herein refers to a sequence-specific regulatory mechanism mediated by RNA molecules, which results in the inhibition or interference or "silencing" of the expression of the corresponding protein-coding gene. RNAi has been observed in many types of organisms, including plants, animals and fungi. RNAi occurs naturally in cells to remove foreign RNA (e.g., viral RNA). Natural RNAi is carried out via fragments cut from free dsRNA, which directs the degradation mechanism to other similar RNA sequences. RNAi is controlled by the RNA-induced silencing complex (RISC) and is initiated by short / small dsRNA molecules in the cytoplasm, where they interact with the catalytic RISC component argonaute. dsRNA molecules can be introduced exogenously into cells. Exogenous dsRNA initiates RNAi by activating the ribonuclease protein Dicer, which binds and cuts dsRNA to produce double-stranded fragments of 21-25 base pairs with several unpaired protruding bases at each end. These short double-stranded fragments are called small interfering RNA (siRNA).

[0333] RNAi agent: As used herein, the term "RNAi agent" refers to an RNA molecule or derivative thereof that can induce inhibition, interference, or "silencing" of expression of a target gene and / or its protein product. RNAi agents can knock out (actually eliminate or eliminate) expression, or knock out (reduce or reduce) expression. RNAi agents can be, but are not limited to, dsRNA, siRNA, shRNA, pre-miRNA, pri-miRNA, miRNA, stRNA, lncRNA, piRNA, or snoRNA.

[0334] Sample: As used herein, the term "sample" or "biological sample" refers to a subset of its tissues, cells or components (e.g., body fluids, including but not limited to blood, serum, mucus, lymph, synovial fluid, cerebrospinal fluid, saliva, amniotic fluid, amniotic cord blood, urine, vaginal fluid, and semen). A sample may also include a homogenate, lysate, or extract prepared from a whole organism or a subset of its tissues, cells or components, or a portion or part thereof, including but not limited to, for example, plasma, serum, cerebrospinal fluid, lymph, skin, external areas of the respiratory, intestinal and urogenital tracts, tears, saliva, milk, blood cells, tumors, organs. A sample also refers to a culture medium, such as a nutrient broth or gelatin, that may contain cellular components (e.g., proteins or nucleic acid molecules).

[0335] Self-complementary viral particle: As used herein, a "self-complementary viral particle" is a particle composed of at least two components, a protein capsid and a self-complementary viral genome encapsulated within the capsid.

[0336] Sense strand: As used herein, the term "sense strand" or "second strand" or "passenger strand" of an siRNA molecule refers to a strand that is complementary to the antisense strand or first strand. The antisense strand and the sense strand of the siRNA molecule hybridize to form a duplex structure. As used herein, "siRNA duplex" includes an siRNA strand that has sufficient complementarity to a stretch of about 10-50 nucleotides of the mRNA of a gene targeted for silencing and an siRNA strand that has sufficient complementarity to form a duplex with another siRNA strand.

[0337] Similarity: As used herein, the term "similarity" refers to the overall relatedness between polymer molecules, such as between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Calculation of the percentage of similarity between polymer molecules can be performed in the same manner as calculating the percentage of identity, except that the calculation of the percentage of similarity takes into account conservative substitutions known in the art.

[0338] Short interfering RNA or siRNA: The term "short interfering RNA", "small interfering RNA" or "siRNA" as used herein refers to an RNA molecule (or RNA analog) comprising about 5-60 nucleotides (or nucleotide analogs) that is capable of directing or mediating RNAi. Preferably, the siRNA molecule comprises about 15-30 nucleotides or nucleotide analogs, such as about 16-25 nucleotides (or nucleotide analogs), about 18-23 nucleotides (or nucleotide analogs), about 19-22 nucleotides (or nucleotide analogs) (e.g., 19, 20, 21 or 22 nucleotides or nucleotide analogs), about 19-25 nucleotides (or nucleotide analogs), and about 19-24 nucleotides (or nucleotide analogs). The term "short" siRNA refers to an siRNA comprising 5-23 nucleotides, preferably 21 nucleotides (or nucleotide analogs) (e.g., 19, 20, 21 or 22 nucleotides). The term "long" siRNA refers to an siRNA comprising 24-60 nucleotides, preferably about 24-25 nucleotides (e.g., 23, 24, 25 or 26 nucleotides). In some cases, short siRNA may comprise less than 19 nucleotides, e.g., 16, 17 or 18 nucleotides, or as few as 5 nucleotides, provided that shorter siRNA retains the ability to mediate RNAi. Similarly, in some cases, long siRNA may comprise more than 26 nucleotides, e.g., 27, 28, 29, 30, 35, 40, 45, 50, 55 or even 60 nucleotides, provided that longer siRNA retains the ability to mediate RNAi or translation inhibition without further processing (e.g., enzymatic processing) into short siRNA. siRNA may be a single-stranded RNA molecule (ss-siRNA) or a double-stranded RNA molecule (ds-siRNA) comprising a sense strand and an antisense strand, which hybridizes to form a duplex structure referred to as a siRNA duplex.

[0339] Subject: As used herein, the term "subject" or "patient" refers to any organism to which a composition according to the present disclosure can be administered, e.g., for experimental, diagnostic, preventive and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans) and / or plants.

[0340] Substantially: As used herein, the term "substantially" refers to the qualitative condition of exhibiting a full or nearly full extent or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will appreciate that biological and chemical phenomena are rarely, if ever, fully completed and / or proceed to perfection or to achieve or avoid an absolute result. Thus, the term "substantially" is used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

[0341] Targeting peptide: As used herein, "targeting peptide" refers to a peptide of 3-20 amino acids in length. These targeting peptides can be inserted into or connected to the parent amino acid sequence to change the characteristics (e.g., tropism) of the parent protein. As a non-limiting example, the targeting peptide can be inserted into the AAV capsid sequence to enhance the targeting of the desired cell type, tissue, organ, or organism. It should be understood that the targeting peptide is encoded by a targeting polynucleotide that can be similarly inserted into the parent polynucleotide sequence. Therefore, a "targeting sequence" refers to a peptide or polynucleotide sequence for inserting a suitable parent sequence (amino acid or polynucleotide, respectively).

[0342] Target cell: As used herein, "target cell" or "target tissue" refers to any one or more cells of interest. Cells can be found in vitro, in vivo, in situ, or in a tissue or organ of an organism. The organism can be an animal, preferably a mammal, more preferably a human, and most preferably a patient.

[0343] Therapeutic agent: The term "therapeutic agent" refers to any agent that has a therapeutic, diagnostic, and / or prophylactic effect and / or elicits a desired biological and / or pharmacological effect when administered to a subject.

[0344] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" refers to an amount of an agent (e.g., a nucleic acid, a drug, a therapeutic agent, a diagnostic agent, a prophylactic agent, etc.) to be delivered, which, when administered to a subject suffering from or susceptible to an infection, disease, disorder, and / or condition, is sufficient to treat, diagnose, prevent, ameliorate symptoms of, and / or delay the onset of the infection, disease, disorder, and / or condition. In some embodiments, the therapeutically effective amount is provided in a single dose.

[0345] Therapeutically effective outcome: As used herein, the term "therapeutically effective outcome" refers to an outcome sufficient to treat, diagnose, prevent, ameliorate symptoms of, and / or delay the onset of an infection, disease, disorder, and / or condition in a subject suffering from or susceptible to the infection, disease, disorder, and / or condition.

[0346] Treat: As used herein, the term "treat" refers to partially or completely alleviating, ameliorating, improving, relieving, delaying the onset of, inhibiting the progression of, reducing the severity of, and / or reducing the incidence of one or more symptoms or features of a particular infection, disease, disorder, and / or condition. For example, "treating" cancer may refer to inhibiting the survival, growth, and / or spread of a tumor. Treatment may be administered to subjects who do not exhibit signs of a disease, disorder, and / or condition and / or to subjects who exhibit only early signs of a disease, disorder, and / or condition in order to reduce the risk of developing pathology associated with the disease, disorder, and / or condition.

[0347] Vector: As used herein, the term "vector" refers to any molecule or moiety that transports, transduces, or otherwise acts as a carrier for a heterologous molecule. In some embodiments, the vector can be a plasmid. In some embodiments, the vector can be a virus. AAV particles are an example of a vector. The vectors of the present disclosure can be recombinantly produced and can be based on and / or can comprise an adeno-associated virus (AAV) parent or reference sequence. The heterologous molecule can be a polynucleotide and / or a polypeptide.

[0348] Viral genome: As used herein, the term "viral genome" or "vector genome" refers to the nucleic acid sequence packaged in the AAV particle. The viral genome comprises a nucleic acid sequence having at least one payload region encoding a payload and at least one ITR.

[0349] Equivalence and scope

[0350] Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation numerous equivalents to the specific embodiments of the disclosure described herein.The scope of the present disclosure is not intended to be limited to the above description, but rather is set forth in the appended claims.

[0351] In the claims, articles such as "a", "an", and "the" may refer to one or more than one, unless indicated to the contrary or otherwise obvious from the context. A claim or description including "or" between one or more members of a group is deemed to be satisfied if one, more than one, or all of the members of the group are present in, used in, or otherwise related to a specified product or process, unless indicated to the contrary or otherwise obvious from the context. The present disclosure includes embodiments in which exactly one member of the group is present in, used in, or otherwise related to a given product or method. The present disclosure includes embodiments in which more than one or all of the members of the group are present in, used in, or otherwise related to a given product or method.

[0352] It should also be noted that the term "comprising" is intended to be open ended and allows but does not require the inclusion of additional elements or steps. Therefore, when the term "comprising" is used herein, the term "consisting of" is also included and disclosed.

[0353] In the case of giving a range, the endpoints are included. In addition, it should be understood that unless otherwise indicated or otherwise obvious from the context and the understanding of a person of ordinary skill in the art, the numerical values ​​expressed in ranges may present any specific numerical value or sub-range within the range in different embodiments of the present disclosure, which is accurate to one tenth of the lower limit unit of the range, unless the context clearly indicates otherwise.

[0354] In addition, it should be understood that any specific embodiment of the present disclosure that falls within the prior art can be explicitly excluded from any one or more claims. Because such embodiments are considered to be known to those of ordinary skill in the art, they can be excluded, even if the exclusion is not explicitly set forth herein. Any specific embodiment of the composition of the present disclosure (e.g., any antibiotic, therapeutic agent or active ingredient; any production method; any method of use, etc.) can be excluded from any one or more claims for any reason, whether or not related to the existence of the prior art.

[0355] It is to be understood that the words which have been used are words of description rather than limitation and that changes may be made within the purview of the appended claims without departing from the true scope and spirit of the disclosure in its broader aspects.

[0356] Although the present disclosure has been described with considerable detail and with considerable particularity with respect to several described embodiments, it is not intended that the present invention be limited to any such detail or embodiment or to any particular embodiment, but rather the present invention should be construed with reference to the appended claims, thereby providing the broadest possible interpretation of such claims in view of the prior art and thereby effectively encompassing the intended scope of the present disclosure.

[0357] The present disclosure is further illustrated by the following non-limiting examples. Example

[0358] Example 1. TRACER Proof of Concept: Promoter Selection

[0359] Proof-of-concept experiments were performed by placing the gene encoding the AAV9 peptide display capsid library under the control of the neuron-specific synaptobrevin promoter (SYN) or the astrocyte-specific GFAP promoter. After intravenous administration to C57BL / 6 mice, RNA was recovered from brain tissue and used for further library evolution. After only two rounds of selection, next-generation sequencing (NGS) showed sequence convergence between animals. Interestingly, several variants highly similar to the PHP.eB capsid were recovered, indicating that our method allows for rapid selection of high-performance capsids. A subset of capsids with high CNS-enriched peptide sequences was selected for further study. It should be understood that any promoter can be selected according to the desired tropism. Examples of such promoters are shown in Table 3.

[0360] Table 3 Promoters, tissues and cell types

[0361]

[0362]

[0363]

[0364]

[0365] The capsid pools were injected into three rodent species, followed by RNA enrichment analysis to characterize transduction efficiency of neurons or astrocytes and cross-species performance. The top-ranked capsids were then tested separately, and several variants showed similar or higher CNS transduction than the PHP.eB benchmark. These results show that the TRACER platform allows for rapid in vivo evolution of AAV capsids in non-transgenic animals with a high degree of tropism improvement. The following examples illustrate this finding in more detail.

[0366] Example 2. Generation of AAV vectors capable of capsid mRNA expression in the absence of a helper virus

[0367] To perform in vivo evolution of cell type-restricted and transduction-restricted AAV capsid libraries, a capsid library system was engineered in which the capsid mutant genes can be transcribed in a specific cell type in the absence of a helper virus. In wild-type AAV viruses, mRNAs encoding capsid proteins VP1, VP2, and VP3 and the AAP accessory protein are expressed from the P40 promoter located in the 3' region of the REP gene ( Figure 1A ), which is only active in the presence of REP protein as well as helper virus function (Berns et al., 1996). In order for capsid mRNA to be expressed in animal tissues or cultured cells, another promoter must be inserted upstream or downstream of the CAP gene. Due to the limited packaging capacity of the AAV capsid, a portion of the REP gene must be deleted to accommodate the additional promoter insertion, and the REP gene must be provided in trans by another plasmid to produce virus. The minimal viral sequence required for high-titer AAV production was determined by introducing the CMV promoter at various positions upstream of the CAP gene of AAV9 ( Figure 1B). The REP protein is provided in trans by the pREP2 plasmid, which is obtained by deleting the CAP gene from the REP2-CAP2 packaging vector using EcoNI and ClaI (SEQ.ID NO:4). For small-scale virus production testing, HEK-293T cells grown in DMEM supplemented with 5% FBS and 1X pen / strep were plated in 15 cm culture dishes and co-transfected with 15ug pHelper (pFdelta6) plasmid, 10ug pREP2 plasmid and 1ug ITR-CMV-CAP plasmid using calcium phosphate transfection. After 72 hours, cells were collected by scraping, pelleted by brief centrifugation, and suspended in 1 ml of buffer containing 10mM Tris and 2mM MgCl2. Cells were lysed by adding Triton X-100 to a final concentration of 0.1% and treated with 50U of benzonase for 1 hour. Viruses from the supernatant were precipitated with 8% polyethylene glycol and 0.5 M NaCl, suspended in 1 ml 10 mM TRIS-2 mM MgCl2, and combined with the cell lysate. The combined virus was adjusted to 0.5 M NaCl, clarified by centrifugation at 4,000 x g for 15 min, and fractionated at 40,000 prm for 3 h with a gradient of 15%, 25%, 40%, and 60% iodixanol (Zolotukhin et al., 1999). The 40% fraction containing purified AAV particles was harvested and viral titers were measured by real-time PCR using a Taqman primer / probe mix shared by all constructs (specific for the 3' end of all REPs). Viral yields were significantly lower than those of the fully wild-type ITR-REP2-CAP9-ITR used as a reference (1.7% to 8.8%), but the CMV-BstEII construct allowed the highest yield of all three CMV constructs. See Figure 2A-2B The CMV-HindIII construct, in which most of the P40 promoter sequence was deleted, produced the lowest yield (1.7% of wtAAV9), indicating that even the potent CMV promoter cannot replace the P40 promoter without severely reducing the virus yield. Based on these observations, the BstEII construct (SEQ. ID NO: 5) that retains the minimal P40 sequence and the CAP mRNA splice donor was used in all further experiments.

[0368] The REP expression plasmid was then improved by retaining the AAP reading frame as well as most of the capsid gene from the REP2-CAP9 helper vector, which may contain sequences necessary for regulating CAP transcription and / or splicing. To eliminate the capsid encoding potential of the vector, the C-terminal fragment of the capsid gene was deleted by triple cleavage with the MscI restriction endonuclease followed by self-ligation to obtain the pREP-AAP plasmid ( Figure 3A , SEQ.ID NO:6).

[0369] Iterations of this construct were designed by introducing premature stop codons immediately after the start codons of VP1, VP2, and VP3 without disturbing the amino acid sequence of the syntenic AAP reading frame ( Figure 3A ). The construct was named pREP-3stop (SEQ. ID NO: 7). The neuron-specific syn-CAP9 vector (SEQ. ID NO: 8) was derived from the CMV9-BstEII plasmid by exchanging the CMV promoter with the neuron-specific human synapsin 1 promoter.

[0370] The production efficiency of Syn-CAP9 was tested using pREP, pREP-AAP or pREP-3stop plasmids to provide REP in trans as described previously. Figure 3B As shown, REP plasmids with longer capsid sequences and AAP increased virus yields by about 3-fold compared to pREP plasmids. Viral titers obtained with pREP-AAP or pREP-3stop vectors reached ∼30% of wild-type AAV9. An important issue with plasmids with long homology regions is the possibility of undesired recombination with ITR-CAP vectors, which could reconstitute the wild-type ITR-REP-CAP vector and contaminate the combinatorial library.

[0371] To assess the risk of wild-type virus reconstitution, Figure 3B The virus preparation obtained was subjected to real-time PCR using a Taqman probe located at the N-terminus of REP. The percentage of capsids containing detectable full-length REP was less than 0.03% of the wild-type virus ( Figure 3C ), which is even lower than the 0.1% abnormal REP-CAP packaging routinely detected in most recombinant AAV preparations obtained from 293T cell transfection ( Figure 3C , our unpublished observations). Because the premature stop codon of the pREP-3stop vector provides an additional layer of safety against potential recombination of wild-type capsids and prevents translation of truncated capsid proteins, the 3stop plasmid was used for all subsequent studies.

[0372] Subsequently, the feasibility of RNA-driven biopanning in C57BL / 6 mice using AAV9-packaged vectors was tested, in which the AAV9 capsid gene was driven by the CMV promoter, the synapsin promoter, or the astrocyte-specific GFabc1D promoter (SEQ. ID NO: 9), hereafter referred to as the GFAP promoter (Brenner et al., 2008) ( Figure 4A). The three vectors were produced in HEK-293T cells as previously described and analyzed by PAGE-silver staining. Figure 4B As shown, all vectors showed normal ratios of VP1, VP2, and VP3 capsid proteins, indicating that a specific promoter structure does not disrupt the balance of capsid protein expression. Six-week-old male C57BL / 6 mice were injected intravenously with le 12VG / mouse and sacrificed 28 days later. DNA biodistribution and capsid mRNA expression were tested in brain, liver, and heart tissues.

[0373] Total DNA was extracted from brain, liver, and heart tissues using Qiagen DNeasy blood and tissue columns, and viral DNA was quantified by real-time PCR using a Taqman probe located in the N-terminal region of VP3. DNA abundance was normalized using a pre-designed probe (Life Technologies No. 4458366) that detects a single copy of the transferrin receptor gene. Viral DNA was highly abundant in the liver and low in the heart. DNA distribution did not show any significant differences between the three vectors ( Figure 4C RNA was extracted using the Qiagen RNeasy plus universal kit according to the manufacturer's instructions, and then treated with ezDNAse (Qiagen) to remove residual DNA and reverse transcribed using Superscript IV (Life Technologies).

[0374] RNA expression was assessed using the same VP3 probe as used for quantification of viral DNA and normalized using TBP as reference RNA (Life Technologies Mm0277042_ml). In the brain, the GFAP promoter allowed the strongest expression levels, while the synapsin promoter allowed expression comparable to the potent CMV promoter. In the liver, all promoters resulted in similar expression levels, which may be the result of leaky expression from very high copy numbers ( Figure 4D In the heart, the cell type specificity of the Syn and GFAP promoters is evident as they allow only ∼3% and 10% of CMV expression, respectively, despite their similar DNA biodistribution.

[0375] Overall, this experiment demonstrates that mRNA from transduction-competent capsids can be recovered from various animal organs, including weakly transduced tissues such as the brain.

[0376] Example 3. AAV vector configuration

[0377] Various vector configurations were explored to increase RNA expression, thereby maximizing library recovery. The CMV promoter was replaced by a hybrid CMV enhancer / chicken β-actin promoter sequence (Niwa et al., 1991) and a potent cytomegalovirus-β-globin hybrid intron derived from an AAV-MCS cloning vector (Stratagene) was inserted between the promoter sequence and the capsid gene, because introns have been shown to enhance mRNA processing and stability (Powell et al., 2015). This produced constructs CAG9 (SEQ. ID NO: 10), SYNG9 (SEQ. ID NO: 11) and GFAPG (SEQ. ID NO: 12).

[0378] A reverse vector configuration was also tested, in which the helper-independent promoter was placed downstream of the capsid gene in a reverse orientation to avoid potential interference with the P40 promoter ( Figure 5A ). This configuration allows the expression of antisense capsid transcripts in animal tissues. Since most polyadenylation signals (AATAAA) are orientation-dependent, it can be assumed that transcription will not be prematurely terminated when the native AAV capsid polyA is placed in the reverse orientation. All constructs were co-transfected with pHelper and pREP-3stop plasmids to generate AAV9-packaged virions, which were used to transduce HEK-293T cells at an MOI of 1e4 VG / cell. RNA was extracted 48 hours after transfection and reverse transcribed using the Quantitect kit (Qiagen).

[0379] PCR was performed using primers that allowed amplification of the full-length capsid or a partial sequence located near the C-terminus ( Figure 5B ). Overall, the presence of the intron had little effect on the expression of the low-activity promoters Syn and GFAP, suggesting that mRNA splicing does not relieve the repression of the promoters in non-permissive cells. The combination of the CMV enhancer with the chicken β-actin promoter and the hybrid intron resulted in significantly higher mRNA expression (>10-fold) compared to the CMV promoter alone ( Figure 5B , 5C ).

[0380] When comparing endpoint PCR amplifications between the forward and reverse intron vectors, clear differences were observed between full-length and partial capsid amplicons ( Figure 5B , right lane), which made us question the integrity of the capsid RNA. When cDNA from the iCAG9 genome in the reverse orientation was amplified using primers flanking the full-length capsid, multiple low molecular weight bands were detected, whereas the forward directional vector allowed amplification of a single product with the expected length ( Figure 5D ). Sanger sequencing of low molecular weight amplicons showed that each band corresponded to an abnormal splicing product from the antisense capsid RNA.

[0381] Based on these results, the forward tandem promoter construct was used for subsequent experiments.

[0382] Splice-specific PCR amplification was tested to avoid amplification of residual DNA present in RNA preparations. Two candidate PCR primers were designed that overlapped the CMV / globin exon-exon junction and tested for amplification of either cDNA (spliced) or plasmid DNA (still containing intronic sequences). Figure 5E As shown in , the GloSpliceF6 primer (SEQ ID NO: 13) allows completely specific amplification from cDNA without producing detectable amplicons from plasmid DNA sequences. This primer was used in subsequent assays to determine the absence of amplification from contaminating DNA.

[0383] The tandem constructs were then tested for potential interference of the P40 promoter with a cell-specific promoter located upstream. To this end, two series of AAV genomes were tested for transgene mRNA expression in HEK-293T cells. A series of transgenes in which the GFP gene was placed immediately downstream of the CAG, SYNG, or GFAPG promoters without the P40 sequence were tested and compared to library constructs in which the AAV9 capsid was placed downstream of the P40 promoter ( Figure 6 ). All genomes were packaged into AAV9 capsids and used to infect HEK-293T at an MOI of 1e4 VG / cell. RNA was extracted 48 hours after infection and transgenic RNA was quantified using a Taqman primer / probe mix specific for spliced ​​globin exon-exon junctions. Figure 6 As shown, expression from the CAG promoter was similar between the GFP and p40-CAP9 constructs (within the error of the AAV titration and 2-fold lower in p40-CAP9). Expression from the synapsin promoter was significantly reduced for both constructs, and expression from the GFAP-driven mRNA was even lower ( Figure 6 ). This was expected because HEK-293T cells do not allow expression of the synapsin or GFAP promoters. Overall, this experiment confirmed that the presence of the P40 sequence did not alter the cell type specificity of the synapsin or GFAP promoters.

[0384] This novel platform is called TRACER (AAV tropism redirection through cell-type-specific expression of RNA, T ropism R edirection of A AV by C ell type-specific E xpression ofR NA). The TRACER platform addresses issues with standard approaches, including transduction and cell type limitations. ( Figure 7 ). The use of the TRACER system is well suited for capsid discovery using targeted peptide libraries. Figure 8 Screening of this library was performed as outlined in .

[0385] Although several variations of AAV vectors are taught herein that encode the capsid as a payload, Fig. 9 , Fig. 12A and Figure 12 shows a standard design.

[0386] Other advantages of the TRACER platform are related to the nature of the viral library and the recovery of RNA only from fully transduced cells ( Fig.10 Thus, capsid discovery can be accelerated in a manner that results in cell- and / or tissue-specific tropism ( Fig.11 ).

[0387] Example 4. Generation and clonal-free amplification of peptide display libraries

[0388] By inserting seven consecutive random amino acids into the AAV5, AAV6 or AAV-DJ8 capsid ( Fig.13 and Fig.39 ) and AAV9( Fig.13 ) were used to generate several peptide display capsid libraries. For the AAV9 library, two additional libraries were generated by modifying the residues at positions −2, −1, and +1 of the insert to match the flanking sequences of the highly neutrophilic PHP.eB vector (Chan et al., 2018). To facilitate insertion of the various loops and prevent contamination with wild-type capsids, defective shuffled vectors were generated in which the C-terminal region of the capsid gene contained between loop VIII and the stop codon was deleted and replaced with a unique BsrGI restriction site ( Fig.15A , 15B). Degenerate primers containing random NNK (K=T or G) sequences capable of encoding all amino acids were synthesized by IDT, and gBlock (IDT) double-stranded linear DNA was used as a template to amplify the missing capsid fragments (SEQ.ID NO 14, SEQ ID NO: 14, 15, 16, 17). Linear PCR templates are more preferred than plasmids to completely prevent the possibility of plasmid carryover in the PCR reaction. Within 30 minutes at 50°C, 100ul NEBuilder HiFi DNA assembly premix (NEB) was used to insert the amplicon (500ng) containing the random library sequence into the shuffled plasmid (2ug) linearized by BsrGI. Unassembled linear templates were eliminated by adding 5ul T5 exonuclease to the reaction and digested at 37°C for 30 minutes. The entire reaction was purified with DNA Clean and Concentrator-5 and quantified with nanodrop to estimate the assembly efficiency. This method can usually recover 0.5-1ug of assembly material.

[0389] gBlock templates were designed by introducing silent mutations to remove unique restriction sites to allow for the selective elimination of wild-type viral contaminants from the library by restriction enzyme treatment. For example, the AAV9 gBlock was engineered to remove the BamHI and AfeI sites present in the parental sequence (SEQ. ID NO 17).

[0390] Example 5. No clonal expansion

[0391] Transformation of assembled library DNA into competent bacteria represents a major bottleneck for library diversity, as even highly competent strains rarely yield more than 1e7-1e8 colonies per transformation. In contrast, 100 ng of a 6-kilobase plasmid contains 1.50e10 DNA molecules. Thus, bacterial transformation can arbitrarily eliminate more than 99% of the DNA species in a given pool. A cloning-free method was therefore created that allows for >100-fold amplification of DNA from Gibson assembly while bypassing the bacterial transformation bottleneck ( Fig.16). A protocol based on rolling circle amplification has been optimized that allows unbiased exponential amplification of circular DNA templates with very low error rates (Hutchinson et al., 2005). One problem with rolling circle amplification is that it produces very large (on average about 70 kilobases) heavily branched concatemers that must be cleaved into monomers for efficient cell transfection. This process can be accomplished in a variety of ways, for example, by using restriction enzymes to generate open linear templates (Hutchinson et al., 2005; Huovinen, 2012), or by CRE-Lox recombination to generate self-ligated circular templates (Huovinen et al., 2011). However, open DNA is sensitive to degradation by cytoplasmic exonucleases, and the CRE recombination method shows relatively low efficiency (our unpublished observations). Therefore, an alternative monomer resolution method was chosen based on the use of TelN telomerase (Rybchin et al., 1999), which catalyzes the formation of closed linear "dogbone" DNA monomers that are well suited for mammalian cell transfection (Heinrich et al., 2002).

[0392] To this end, the telomerase recognition sequence TATCAGCACACAATTGCCCATTATA CGC*GCGTATAATGGACTATTGTGTGCTGATA (SEQ ID NO: 176) was introduced outside the two ITRs of all BsrGI shuffling vectors used for capsid library insertion (the asterisk indicates the position where the two complementary chains are covalently linked to each other) to obtain the following plasmids: TelN-Syn9-BsrGI (SEQ ID NO 18), TelN-GFAP9-BsrGI (SEQ ID NO 19), TelN-Syn5-BsrGI (SEQ ID NO 20), TelN-GFAP5-BsrGI (SEQ ID NO 21), TelN-Syn6-BsrGI (SEQ ID NO 22), TelN-GFAP6-BsrGI (SEQ ID NO 23), TelN-SynDJ8-BsrGI (SEQ ID NO 24), TelN-GFAPDJ8-BsrGI (SEQ ID NO 25). 25). Several rolling circle amplification methods were tested, and the best results (high yield and low nonspecific amplification) were obtained using TruePrime technology (Expedeon), which relies on primer-free amplification (Picher et al., 2016).

[0393] Briefly, the entire column-purified assembly reaction was used in a 900ul TruePrime reaction and incubated overnight at 30°C, following the manufacturer's instructions. The next day, the rolling circle reaction product was incubated at 65°C for 10 minutes to inactivate the enzyme and diluted 5-fold in 1X ThermoPol buffer with 50μl telomerase (NEB) in a 4.5ml reaction. After 1 hour at 30°C, the reaction was heat treated at 70°C for 10 minutes to inactivate telomerase, and a 4.5ul aliquot was run on an agarose gel. The entire reaction was then purified on multiple (10-12) Qiagen QiaPrep 2.0 columns, following the manufacturer's instructions. The typical yield obtained with this method is DNA, which showed >100-fold amplification of starting material (typically 0.5 μg) and provided enough DNA to transfect 200 cell culture dishes ( Fig.16 ).

[0394] The composition of all libraries was tested by next-generation sequencing on the Illumina NextSeq sequencing platform to assess the number of variants and the extent of eventual contamination with wild-type virus. Amplicons were generated by PCR with Q5 polymerase (NEB) using primers containing Illumina TruSeq aptamers and index barcodes. Amplicons were obtained by low-cycle PCR amplification (15 cycles), run on 3% agarose gels and purified using Zymo gel extraction reagents. Libraries were quantified using nanodrop, pooled into equimolar mixtures, and re-quantified using the KAPA library quantification kit according to the manufacturer's instructions. Libraries were mixed with 20-40% of a PhiX control library to increase sequence diversity.

[0395] All DNA libraries generated by rolling circles showed high sequence diversity (typically >1e8 unique variants, beyond the range of NextSeq sequencing). In contrast, plasmid libraries generated by bacterial transformation rarely exceeded 1-2e7 variants.

[0396] Example 6. Prevention and / or reduction of pollution

[0397] In another embodiment, a primer / vector system was created that was designed to completely prevent contamination of the AAV9 library with wild-type virus that might be recovered from environmental contamination or from naturally infected primate tissue. This was achieved by introducing a maximum number of silent mutations in the sequence surrounding the library insertion site and just before the CAP stop codon used for PCR amplification ( Fig.17These libraries showed very low amounts of wild-type AAV9 detected by NGS (less than 2 AAV9 reads per 5e7 total reads), suggesting that altering the codons surrounding the library amplification and cloning sites is a very effective way to protect the library from environmental or experimental contamination.

[0398] Libraries were produced by calcium phosphate transfection of HEK-293T cells, double iodixanol gradient fractionation, and membrane ultrafiltration using a 100,000Da MWCO Amicon-15 membrane (Millipore) as described previously, and quantified by real-time PCR, with aliquots used for NGS amplicon generation and NextSeq sequencing. The diversity of the viral library was significantly lower than that of the DNA library (typically ~1-2e7 unique variants), and showed very strong counterselection of variants containing stop codons (from 20% in the DNA library to 10% in the viral library). ), indicating a very high cis-packaging rate, as observed in previous studies ( Nonnenmacher et al., 2014 ).

[0399] Example 7. In vivo selection of AAV9 libraries for mouse brain transduction

[0400] An RNA-driven library selection for increasing brain transduction in a murine model was then developed. The AAV9 libraries generated as described above were injected intravenously into male C57BL / 6 mice at a dose of 2e12 VG / mouse. Two groups of mice were injected with individual SYN-driven or GFAP-driven libraries derived from wild-type AAV9 flanking sequences, and the other two groups received a pooled library containing wild-type and PHP.eB-derived flanking sequences ( Fig.18 One month later, RNA was extracted from 200 mg of brain tissue corresponding to the entire hemisphere using the RNeasy Universal Plus procedure (Qiagen). To minimize the possibility of undersampling RNA, the entire RNA preparation was quantified using Obgotex beads (Qiagen) according to the manufacturer's recommendations. mRNA enrichment was performed. The entire preparation of enriched mRNA (~5ug, equivalent to 2% of total RNA) was then reverse transcribed in a 40ul SuperscriptIV reaction (Life Technologies) using a library-specific primer with the following sequence: 5'-GAAACGAATTAAACGGTTTATTGATTAACAATCGA TTA -3' (SEQ ID NO:415) (CAP stop codon is underlined) Fig.19The entire cDNA pool was then subjected to 30 cycles of 55°C annealing temperature and 2 min extension in a 500 ul PCR reaction assembled with Q5 master mix, GloSpliceF6 forward primer, and CAP9 specific reverse primer: 5'-CGGTTTATTGATTAACA ATCGA TTA CAGATTACGAGTCAGGTATC-3' (SEQ ID NO: 416) (CAP stop codon is underlined). This method allowed the recovery of abundant amplicons from all brain samples ( Fig. 20 ).

[0401] The full-length capsid amplicons were then used as templates for NGS library generation and cloning into P1 DNA libraries for the next round of bio-panning using exactly the same assembly and cloning-free procedures. NGS analysis of PCR amplicons showed that library diversity decreased by ~25-fold (from 1e7 to 4e5) after the first round of bio-panning for both Syn-driven and GFAP-driven libraries ( Figures 21A-21C ). The number of first-round variants recovered (P1) was too high to show any significant sequence convergence at this time, and there was little overlap between the composition of pools recovered from individual animals. Therefore, a second round of selection was performed. After the second bio-panning (P2), the total number of unique variants dropped further by 4-5 fold to <1e5 peptides. Importantly, some libraries recovered after the first round of bio-panning showed significant counts of wild-type AAV9 and AAV-PHP.eB sequences, likely due to environmental contamination. These later became useful benchmarks in the second round of enrichment.

[0402] After RNA recovery and PCR amplification, systematic enrichment analysis was performed by NGS by calculating the ratio of P2 / P1 reads and comparing it to the ratio of AAV9 or PHP.eB P2 / P1. Fig. 22 , Table 4, Fig.23 As shown in Table 5 , multiple capsids showed higher enrichment rates than the benchmark PHP.eB in both Syn-driven and GFAP-driven libraries, and sequence convergence was evident, as represented by consensus sequence generation.

[0403] Table 4. Capsid analysis results

[0404]

[0405]

[0406]

[0407] Table 5. Capsid analysis results

[0408]

[0409]

[0410]

[0411] Importantly, there was also strong sequence convergence between different animals, suggesting that effective selection can occur after only two passages. Fig.24 and Fig.25 An assessment of brain / liver specificity among GFAP-AAV9 peptide library candidates is provided.

[0412] Example 8. Multiple selection

[0413] For the final multiplex in vivo screening by pooling of individual variants in equimolar libraries, e.g. Fig.26 As shown, a subset of variants with promising properties (such as, but not limited to, enrichment factors, liver off-target, high counts in more than one mouse, etc.) may be selected, and then an equimolar pool of primers encoding all 7-mers can be synthesized (microchip solid phase synthesis, up to 3,800 primers per chip). Limited diversity libraries can be generated that include internal controls, such as, but not limited to, PHP.N, PHP.B, wild-type AAV9 (wtAAV9), and / or any other serotype, including those taught herein. Mice are injected and RNA enrichment is then compared to internal controls in a manner similar to barcoding studies, which are known in the art and described herein.

[0414] Example 9. Codon Optimization

[0415] When using a synthetic library, codon variants can be used to improve data strength. Table 6 provides a list of NNK codons, NNM codons, and optimal NNM codons for various amino acids in mammals. In Table 6, * indicates that no NNM codons are available, and ** indicates "avoid homopolymer segments if possible."

[0416] Table 6. Codon variants

[0417]

[0418] In order to have a balanced library, it is recommended to create a list of potential candidates. Then, by using Table 6, the combined primer library contains each peptide variant encoded by NNK codons (original codons from the library) and non-NNK codons (maximum variation). If similar behavior is seen between two variants of the same peptide, this will strengthen the analysis of the peptide. In addition, it is recommended to select the best NNM codon (M = A or C).

[0419] Example 10. Library Generation

[0420] The top 330 peptide variants that showed enhanced performance relative to the parental AAV9 were selected from the SYN-driven and GFAP-driven libraries. A nascent library was generated by primer synthesis of all 330 peptide sequences and AAV9, AAV-PHP.B and AAV-PHP.eB controls (Table 7). In order to exclude potential artifacts due to DNA sequence and improve the robustness of the assay, each peptide variant was encoded by two different DNA sequences, one with all amino acids encoded by NNK codons (same as the original library), and the other with NNM codons (M=C or A, Table 6) as much as possible.

[0421] Table 7. Peptide variants selected after 2 rounds of RNA-driven mouse brain biopanning

[0422]

[0423]

[0424]

[0425]

[0426]

[0427]

[0428]

[0429]

[0430]

[0431]

[0432]

[0433]

[0434]

[0435]

[0436]

[0437]

[0438]

[0439]

[0440]

[0441]

[0442]

[0443]

[0444]

[0445]

[0446]

[0447] The primer pool was generated by Twist biosciences using solid phase synthesis and used to generate a balanced library of 666 nucleotide variants by PCR amplification of the CAP C terminus and Gibson assembly, as Fig. 27 As shown. 666 primers were provided, each at 1 fmole, resulting in 0.6 pmoles (conventional PCR requires ~25 pmoles of primers). Primer-free amplification of the capsid gBlock template was performed for 10 cycles. Forward and reverse primers were added, followed by another 10, 15, or 20 PCR cycles. The construct was then cloned into the AAV9 backbone plasmid by Gibson / RCA (similar to conventional libraries).

[0448] NGS analysis of SYN- and GFAP-driven AAV libraries generated with the combined DNA showed good correlation between codon variants for each peptide, suggesting that the DNA sequence itself has little effect on virus production ( Fig.28 and Fig.29 The combined synthetic library was injected intravenously into C57BL / 6 mice (5e11 VG / mouse, N=9), BALB / C mice (5e11 VG / mouse, N=6), and rats (5e12 VG / rat, N=6), and one month later, in-life RNA was extracted from brain and spinal cord, and DNA was extracted from liver and heart tissue samples for biodistribution analysis ( Fig.30 ). Because the synapsin and GFAP promoters are not fully active in non-CNS tissues, DNA rather than RNA was analyzed from peripheral organs. The initial focus was on C57BL / 6 mouse analysis, as this is the mouse strain in which the library evolution was performed.

[0449] The enrichment score for each capsid was determined by NGS analysis and was defined as the ratio of reads per million (RPM) in the target tissue to the RPM in the inoculum. Fig.31A An example of the analysis performed on control capsids is shown in . As expected from the published data, PHP.B and PHP.eB (aka PHP.N) capsids allowed significantly higher RNA expression in neurons (8-fold and 25-fold, respectively) compared to the AAV9 parental capsid. There was a very high correlation between the codon variants for each peptide class in each animal (r=0.92, 0.93, and 0.95), confirming the robustness of the NGS assay ( Figure 31B-Figure 31D ).

[0450] Examples of enrichment analysis are given in Fig.32A – Fig.36 . The 333 capsid variants are ranked by the average brain enrichment score across all animals, with individual enrichment values ​​indicated by a color scale. As indicated by the position of the reference capsid, a set of novel variants showed higher enrichment scores than the PHP.eB benchmark capsid in both neurons (Syn driven) and astrocytes (GFAP driven). Interestingly, many variants showed different enrichment scores in neurons vs. astrocytes, as indicated by the moderate level of correlation between Syn-driven and GFAP-driven RNAs. This suggests that some capsids show enhanced tropism for neurons, while others show enhanced tropism for astrocytes ( Fig.33 ).

[0451] A panel of 38 capsids exhibited properties of potential interest based on their tropism for neurons, astrocytes, or both (Tables 8A and 8B) ( Fig.38 ) and showed strong consensus peptide sequence similarity, with differences between neuron-targeted and astrocyte-targeted variants ( Figure 45A-Figure 45C and Figure 46A-46B ).

[0452] Table 8A Top 38 candidates from C57BL / 6 screen #1 (N=3)

[0453]

[0454]

[0455] Table 8B. Variant 9-mers and coding sequences

[0456]

[0457]

[0458]

[0459] Example 11. Phylogenetic grouping

[0460] Phylogenetic grouping of peptide sequences showed clear correlation between clusters of sequence homology and capsid phenotype ( Figures 37A-37B ). For example, the 9-mer variant with the sequence DGTxxxPFK / R (SEQ ID NO: 1181) exhibited similar behavior to the PHP.eB capsid (high transduction of both neurons and astrocytes), while the variant with the sequence DGTxxxYDS / A (SEQ ID NO: 1182) showed a preference for neuronal transduction. In contrast, peptides with the consensus DGTxxxxGW (SEQ ID NO: 1183) or CGTxxxPPR / K (SEQ ID NO: 1184) had a higher tropism for astrocytes.

[0461] Example 12. Capsid test

[0462] Capsid variants representing different sequence clusters were selected (in Fig.37B Each capsid was generated as a recombinant AAV packaged with a self-complementary EGFP transgene driven by a ubiquitous promoter ( Fig.49A , 49B Groups of mice (N=3) were injected intravenously with 6e10 VG, and transduction efficiency was assessed 1 month later by quantification of EGFP mRNA in brain, spinal cord, and liver tissues. EGFP mRNA expression was normalized using mouse TBP as a housekeeping gene, and DNA biodistribution was normalized to the single copy mouse TfR gene ( Figure 50A-Figure 50C ). Reverse transcription was performed using the Quantitect kit and included DNA removal. All capsid variants showed significant improvements in brain and spinal cord mRNA expression compared to the parental AAV9 capsid, and three of the seven variants (9P16, 9P31, and 9P35) showed similar or higher transduction than the PHP.eB benchmark capsid ( Fig.49C , Table 10). The biodistribution of viral DNA showed that 9P31 and 9P35 had very strong tropism for the brain and spinal cord, but all variants showed a 40-260-fold increase in biodistribution compared to AAV9 ( Fig.49D , Table 10).

[0463] Use NGS screening to test expected cell tropism by labeling for the neuronal NeuN marker ( Fig.51). Within the cortex, the top capsids in the GFAP screen showed GFP expression mostly in NeuN-negative cells with glial cell morphology. In contrast, the top capsids in the SYN screen showed very high transduction of NeuN-positive cells, while the bispecific capsids 9P08 and 9P16 (ranked highly in both assays) showed a mixed cell preference with multiple NeuN+ cells and glial cells.

[0464] Cell tropism was also tested using mouse brain microvascular EC (mBMVEC) binding relative to AAV9. The results are shown in Table 9.

[0465] Table 9. mBMVEC binding results

[0466]

[0467] Fluorescent EGFP expression in whole brain, cerebellum, cortex, and hippocampus tissue revealed transduction patterns across aspectrum and demonstrated identification of tissue-specific capsids ( Figure 52-Figure 56 ).

[0468] Hepatic transduction, as measured by mRNA expression and whole tissue GFP expression, showed that several variants outperformed AAV9, which was unexpected given the NGS results. Some variants (e.g., 9P08 or 9P23) showed relative liver off-targeting ( Figure 57A-Figure 57B ).

[0469] Table 10. Brain and spinal cord tropism

[0470]

[0471]

[0472] *EGFP mRNA expression was normalized to TBP as a housekeeping marker

[0473] **GFP DNA normalized to single copy TfR DNA

[0474] ***N=1

[0475] Example 13. Multi-rodent testing (cross-species)

[0476] 333 capsid variants were tested for their efficacy in transducing the CNS in other rodent strains or species ( Fig.47 ). A side-by-side comparison of neuronal and astroglial transduction in C57BL / 6 mice, BALB / C mice, and rats revealed major differences in enrichment scores for multiple variants between the two mouse strains, with even more pronounced differences between mice and rats ( Figure 48A-48C). Strikingly, the most efficient capsid for rat brain transduction was the parental AAV9, suggesting that directed evolution is “stuck” with capsid variants that excel in a given species, distinct from the diversity of wild-type AAV capsids.

[0477] Correlation analysis showed that some capsids shared high CNS transduction between C57BL / 6 and BALB / C mice, whereas others were restricted to one strain ( Fig.48B ).

[0478] Interestingly, PHP.B and PHP.eB capsids showed poor brain transduction in BALB / C mice, which is consistent with a recent publication (Hordeaux et al., 2018). When focusing on capsids that showed more than 10-fold increase in brain transduction, only 62 variants were improved in C57BL / 6 mice, 28 variants were improved in BALB / C mice, and 30 variants showed improvement in brain transduction in both strains (Table 11). Consensus sequence analysis showed that the "C57BL / 6 signature" was very similar to the PHP.eB peptide (DGTxxxPFR (SEQ ID NO: 1185)), while the BALB / C signature showed a different consensus sequence (DGTxxxxGW (SEQ ID NO: 1183)), suggesting the use of different cellular receptors ( Fig.48C ).

[0479] Table 11. Top 30 candidates from C57BL / 6 and BALB / C mouse screening

[0480]

[0481]

[0482]

[0483]

[0484]

[0485] The efficacy of 333 capsid variants from C57BL / 6 mouse BMVEC and human BMVEC in transducing the CNS was also compared ( Fig.58A and Fig.58B ).

[0486] Example 14. Engineering of an NGS-driven full-length capsid variant selection system

[0487] Engineering a barcoding system to allow enrichment studies of full-length capsid modifications. Although the TRACER platform described here was originally developed for use with peptide display libraries, where random peptide sequences are inherently amenable to Illumina NGS analysis due to their short length, Illumina sequencing technology does not typically allow sequencing of more than 300 contiguous bases, and therefore our platform cannot be used for NGS analysis of full-length capsid variants, such as those generated by DNA shuffling techniques or error-prone PCR.

[0488] Another RNA-driven platform was designed for full-length capsid libraries, where unique molecular identifiers (UMIs) were placed outside the capsid gene and can be used for NGS enrichment analysis ( Figure 59A-Figure 59C ). Once variants with desired properties are identified from animal tissues by UMI enrichment analysis, the UMI sequence must allow highly specific recovery of full-length capsids from the starting material with minimal error rates. The system should have one or more of the following properties to be effective: 1) the UMI should be transcribed under the control of a cell type-specific promoter; 2) the UMI should not interfere with capsid expression or splicing during viral production; 3) the UMI should be short enough for Illumina NGS sequencing (typically less than 60 nt for standard single-end 75 nt sequencing), and 4) the UMI should allow sequence-specific recovery of the target full-length capsid from the starting DNA / viral library with minimal error rates.

[0489] To address these characteristics: 1) the UMIs were placed in the transcribed region of the capsid library (i.e., anywhere between the transcription start site and the polyadenylation signal), 2) the UMIs were placed at various positions in AAV introns (which are largely unspliced ​​in the absence of helper functions) or between the capsid stop codon and the polyadenylation signal, 3) the UMI cassette consisted of two random 21-nt sequences separated by a 15-nt spacer, with a total length of 57 nt, which provided 18 additional nucleotides for primer annealing, and 4) the UMI random sequence was formed by NSW trimers (N = A, T, G, C; S = G, C; W = A, T) to prevent large changes in the annealing temperature of the amplification primers, avoid homopolymer segments, and prevent the formation of premature polyA signals (AATAAA).

[0490] Importantly, the UMI box contains two random sequences in tandem. The first sequence (outermost) is used to design matching capsid recovery primers, and the second sequence (innermost) is used to confirm the identity of the capsid amplicon after cloning. This approach should allow the elimination of all clones containing nonspecific amplification products. In another embodiment, the innermost sequence can also be used to design nested PCR primers to increase the specificity of amplification ( Figure 59A-Figure 59C ).

[0491] Several insertion sites for the tandem barcodes were explored to test the effects on viral viability and titer. A series of constructs were engineered with barcodes inserted into the AAV intron of the CAG9 plasmid ( Fig.60A ). Since AAV introns are spliced ​​during viral production, the presence of the barcode should have little effect on yield. In contrast, in the absence of helper functions, AAV splicing is very inefficient (Mouw et al., 2000), so the barcode sequence will be retained in RNA recovered from animal tissues. All intron barcode constructs were tested for their ability to produce high-titer AAV progeny by co-transfection with pHelper and pREP3stop plasmids. All constructs allowed high-titer AAV production, ranging from 50% to 80% of non-barcoded CAG9 virus ( Fig.60B ).

[0492] RNA splicing analysis from transfected cells showed that the rate of AAV intron splicing varied slightly between constructs and was more efficient when the intron barcode was inserted after a conserved insertion sequence downstream of the splice donor ( Fig.60C , above).

[0493] Globin intron splicing was 100% efficient in all conditions tested ( Fig.60C , lower panel). As expected, AAV intron splicing was barely detectable in the absence of helper functions.

[0494] An alternative platform was tested in which the tandem barcodes were placed between the capsid stop codon and the polyadenylation signal ( Fig.59B ). The titers generated by the 3' barcoded construct were the same as those of the non-barcoded CAG9 construct.

[0495] Overall, external barcoding of full-length capsids enables efficient AAV production, while the novel tandem barcoding platform allows NGS-driven sequence-specific recovery from library preparations with high confidence.

[0496] Table 12 Sequence

[0497]

[0498]

[0499]

[0500]

[0501]

[0502]

[0503]

[0504]

[0505]

[0506]

[0507]

[0508]

[0509]

[0510]

[0511]

[0512]

[0513]

[0514]

[0515]

[0516]

[0517]

[0518]

[0519]

[0520]

[0521]

[0522]

[0523]

[0524]

[0525] References

[0526] Berns KI, Giraud C. Biology of adeno-associated virus. Curr TopMicrobiol Immunol. 1996; 218:1-23.

[0527] Chan KY,Jang MJ,Yoo BB,Greenbaum A,Ravi N,Wu WL,Sánchez-Guardado L,Lois C,Mazmanian SK,Deverman BE,Gradinaru V.Engineered AAVs for efficientnoninvasive gene delivery to the central and peripheral nervous systems.NatNeurosci.2017Aug;20(8):1172-1179.

[0528] Heinrich J,Schultz J,Bosse M,Ziegelin G,Lanka E,Moelling K.Linearclosed mini DNA generated by the prokaryotic cleaving-joining enzyme TelN isfunctional in mammalian cells.JMol Med(Berl).2002Oct;80(10):648-54.

[0529] Hordeaux J,Wang Q,Katz N,Buza EL,Bell P,Wilson JM.The NeurotropicProperties of AAV-PHP.B Are Limited to C57BL / 6J Mice.Mol Ther.2018Mar 7;26(3):664-668.

[0530] Huovinen T,Brockmann EC,Akter S,Perez-Gamarra S, J,Liu Y, U.Primer extension mutagenesis powered by selective rolling circleamplification.PLoS One.2012;7(2):e31817.

[0531] Huovinen T,Julin M,Sanmark H, U.Enhanced error-prone RCAmutagenesis by concatemer resolution.Plasmid.2011Oct;66(1):47-51.

[0532] Hutchison CA 3rd,Smith HO,Pfannkoch C,Venter JC.Cell-free cloningusing phi29DNA polymerase.Proc Natl Acad Sci U S A.2005Nov 29;102(48):17332-6.

[0533] Miyazaki J,Takaki S,Araki K,Tashiro F,Tominaga A,Takatsu K,YamamuraK.Expression vector system based on the chicken beta-actin promoter directsefficient production of interleukin-5.Gene.1989Jul 15;79(2):269-77.

[0534] Mouw MB,Pintel DJ.Adeno-associated virus RNAs appear in a temporalorder and their splicing is stimulated during coinfection with adenovirus.JVirol.2000Nov;74(21):9878-88.

[0535] Niwa H,Yamamura K,Miyazaki J.Efficient selection for high-expressiontransfectants with a novel eukaryotic vector.Gene.1991Dec 15;108(2):193-9.

[0536] Nonnenmacher M,van Bakel H,Hajjar RJ,Weber T.High capsid-genomecorrelationfacilitates creation of AAV libraries for directed evolution.MolTher.2015 Apr;23(4):675-82.

[0537] Picher Budeus B,Wafzig O,Krüger C,García-Gómez S,Martínez-JiménezMI,Díaz-Talavera A,Weber D,Blanco L,Schneider A.TruePrime is a novel methodforwhole-genome amplification from single cells based on TthPrimPol.NatCommun.2016 Nov29;7:13296.

[0538] Powell SK,Rivera-Soto R,Gray SJ.Viral expression cassette elements toenhancetransgene target specificity and expression in gene therapy.DiscovMed.2015Jan;19(102):49-57.

[0539] Rybchin VN,Svarchevsky AN.The plasmid prophage N15:a linear DNA withcovalentlyclosed ends.Mol Microbiol.1999 Sep;33(5):895-903.

[0540] Zolotukhin S,Byrne BJ,Mason E,Zolotukhin I,Potter M,Chesnut K,Summerford C,Samulski RJ,Muzyczka N.Recombinant adeno-associated viruspurification using novelmethods improves infectious titer and yield.GeneTher.1999 Jun;6(6):973-85.

Claims

1. A method for producing a variant AAV capsid polypeptide, wherein the variant AAV capsid polypeptide exhibits at least one of improved transduction or increased cell or tissue specificity relative to a parent AAV capsid polypeptide, the method comprising: a) generating a library of variant AAV capsid polypeptides, wherein the library comprises i) a plurality of capsid polypeptides having a randomized sequence region of 2, 3, 4, 5, 6, 7, 8 or 9 consecutive amino acids, or ii) multiple capsid polypeptides derived from more than one parent AAV capsid polypeptide; b) generating an AAV vector library by cloning the capsid polypeptides of library (i) or (ii) into an AAV vector, wherein the AAV vector comprises a first promoter and a second promoter, wherein the second promoter drives capsid mRNA expression in the absence of helper virus co-infection.

2. The method of claim 1, wherein the first promoter is AAV2 P40 and the second promoter is a ubiquitous promoter.

3. The method of claim 1, wherein the first promoter is AAV2 P40 and the second promoter is a cell type specific promoter.

4. The method of claim 2 or claim 3, wherein the promoter is selected from any promoter listed in Table 3.

5. The method of claim 4, wherein a ubiquitous promoter or a cell-specific promoter allows expression of RNA encoding the capsid polypeptide.

6. The method of claim 5, further comprising recovering the RNA encoding the capsid polypeptide and determining the sequence of the capsid polypeptide.

7. The method of claim 6, wherein the recovered capsid polypeptide exhibits increased target cell transduction or target cell specificity (tropism) compared to the parent capsid polypeptide.

8. The method of claim 7, wherein the target cell is a neuron, a neural stem cell, an astrocyte, an oligodendrocyte, a microglia, a retinal cell, a tumor cell, a hematopoietic stem cell, an insulin-producing beta cell, a lung epithelial cell, an endothelial cell, a hepatocyte, a skeletal muscle cell, a muscle stem cell, a muscle satellite cell, or a cardiomyocyte.

9. The method of claim 1, wherein the AAV vector comprises a first promoter and a second promoter, wherein the second promoter is located downstream of the capsid gene and drives its antisense RNA expression in the absence of helper virus co-infection.

10. The method of claim 9, wherein the first promoter is AAV2 P40 and the second promoter is a ubiquitous promoter.

11. The method of claim 9, wherein the first promoter is AAV2 P40 and the second promoter is a cell-specific promoter.

12. The method of claim 10 or claim 11, wherein the ubiquitous promoter or the cell-specific promoter allows expression of the gene encoding the capsid polypeptide of the variant AAV in the antisense orientation, thereby producing antisense RNA.

13. The method of claim 12, wherein the method further comprises recovering the antisense RNA, which can be converted into RNA encoding the variant AAV capsid polypeptide for determining the sequence of the variant AAV capsid polypeptide.

14. The method of claim 13, wherein the variant capsid polypeptide exhibits increased target cell transduction or target cell specificity (tropism) compared to the parent capsid polypeptide.

15. The method of claim 14, wherein the target cell is a neuron, a neural stem cell, an astrocyte, an oligodendrocyte, a microglia, a retinal cell, a tumor cell, a hematopoietic stem cell, an insulin-producing beta cell, a lung epithelial cell, an endothelial cell, a hepatocyte, a skeletal muscle cell, a muscle stem cell, a muscle satellite cell, or a cardiomyocyte.

Images