Preparation method of stem cell exosomes and their application in medicine and cosmetology

Abstract

The present invention provides a method for preparing stem cell exosomes and their application in medicine and cosmetology. Specifically, the exosomes prepared by separation from bone marrow mesenchymal stem cells and the polypeptide RANA-B-5 separated and identified from forest frog skin that is good at promoting skin wound repair both have a good effect of promoting the proliferation of skin fibroblasts, and can also increase the expression activity of collagen in cells. The two can significantly improve the repair of skin damage when used alone or in combination, and have good application prospects.

Description

Technical Field

[0001] The present application relates to the biological field, and specifically to a method for preparing stem cell exosomes and their application in medicine and cosmetology. Background Art

[0002] Wounds are damage to normal skin (tissue) caused by external factors such as surgery, external force, heat, electric current, chemicals, low temperature, and internal factors such as local blood supply disorders. It is often accompanied by the destruction of skin integrity and the loss of a certain amount of normal tissue. At the same time, the normal function of the skin is impaired. It is also called wound or trauma. Wound repair is a complex and regular biological process, which mainly includes inflammatory response, cell proliferation and tissue remodeling stages. It is highly orderly, coordinated, complete and networked under the regulation of the body. The inflammatory response is not limited to the inflammatory response period, but runs through the entire process of wound repair. Its effect is too strong or too weak, which is not conducive to wound repair. Therefore, the immune state of the body is very critical to the results and quality of wound repair. The immune cells involved in wound repair are mainly neutrophils, macrophages and lymphocytes, which appear and aggregate in a certain time sequence. After injury, neutrophils arrive at the wound first, and by producing a large number of oxygen free radicals and a variety of proteases, they play a role in phagocytizing bacteria and clearing necrotic tissue in the interstitial space. In addition, neutrophils can also release certain inflammatory mediators and cytokines to promote the migration of inflammatory cells, endothelial cells and fibroblasts. However, neutrophils are not directly involved in cell proliferation and wound repair. Their main function is to prevent and treat wound infection and provide a good repair environment for the wound. Monocytes in the blood are affected by a variety of chemokines. They quickly enter the tissue after neutrophils and transform into macrophages. Macrophages are key immune cells in the wound healing process. On the one hand, macrophages phagocytize necrotic tissue, bacteria and foreign matter to clean the wound; on the other hand, they secrete bioactive substances such as growth factors and cytokines, chemotactic repair cells, stimulate cell division and proliferation, promote neovascularization and granulation, etc., directly or indirectly regulating the wound healing process.

[0003] The development of biotechnology and its application in the field of gene pharmaceuticals have accelerated the process of wound repair and treatment, and are also an important milestone in the transformation of wound repair from passive to active intervention. A variety of polypeptide substances, including basic fibroblast growth factor, epidermal growth factor, platelet growth factor, granulocyte-macrophage colony stimulating factor (CM-CSF) and growth hormone, have been successfully developed and gradually applied to the treatment of burns and trauma, and have achieved good results. Growth factors act on repair cells, affect the cell proliferation cycle and directly promote the proliferation and differentiation of repair cells. At the same time, some growth factors also have some strong non-mitogenic hormone-like activities, such as regulating vasoconstriction and releasing certain hormones. These biological characteristics are the basis for growth factors to promote wound repair and tissue regeneration.

[0004] MSC-Exo is a homogeneous extracellular vesicle with a diameter of 30-150nm secreted by MSC. MSC-Exo can fuse with target cells, deliver bioactive factors such as lipids, proteins, and nucleic acids, and promote tissue repair and regeneration. Studies have shown that MSC-Exo is the main effective paracrine component of MSC, and its biological effect is almost equivalent to that of parent MSC. MSC-Exo plays an important role in the three stages of wound repair. In the inflammatory stage, MSC-Exo can downregulate the levels of inducible NOS and cyclooxygenase in tissues, and upregulate anti-inflammatory factors such as IL-10, IL-4, and TGF-β to reduce wound inflammation. MSC-Exo can also promote the transformation of macrophages to the anti-inflammatory M2 phenotype, and regulate the activities of B cells, T cells, and natural killer cells, playing an immunomodulatory role. In the proliferation stage, MSC-Exo can release a variety of angiogenic factors and microRNAs (miRs) to promote angiogenesis. In addition, MSC-Exo can also promote angiogenesis by activating signaling pathways such as Wnt / β-catenin, phosphatidylinositol-3-kinase (PI3K) / protein kinase B (Akt) and MAPK / extracellular signal-regulated kinase. In the remodeling stage, MSC-Exo inhibits scar hyperplasia by preventing Fb differentiation into myofb and regulating the ratio of matrix metalloproteinase 3 and matrix metalloproteinase inhibitor 1 to improve ECM remodeling.

[0005] Although exosomes have great potential for wound treatment, the exosomes applied to the wound will be quickly cleared by the body. The low retention rate of exosomes in the body increases the cost of treatment and limits the clinical application of exosome therapy. The exosome delivery and retention system based on biological scaffold materials can prolong the action time of exosomes in the wound without affecting the biological function of exosomes. The development of safe and stable exosome delivery biological scaffold systems has become a current research hotspot. In recent years, hydrogel systems have been widely favored by scholars due to their non-stickiness, ductility, similarity to living tissues, and the ability to provide cells with a continuous moist environment. Studies have shown that human adipose MSC-Exo loaded in hydrogel systems can maintain biological activity for a longer period of time and have better efficacy in healing wounds than using exosomes or hydrogels alone. In recent years, hydrogels used to load MSC-Exo to help wound repair include the following categories: PluronicF-127 (PF-127), methylcellulose chitosan, alginate, etc. PF-127 is a thermosensitive hydrogel that has been approved by the US Food and Drug Administration for use in humans. The use of MSC-Exo in PF-127 can improve the efficiency of exosome delivery, maintain the biological activity of MSC-Exo, and optimize the performance of MSC-Exo. Studies have shown that PF-127 hydrogel loaded with human MSC-Exo can accelerate skin wound repair by promoting re-epithelialization, stimulating angiogenesis, regulating collagen synthesis, and increasing the expression of skin barrier proteins. However, the hydrophilic nature of PF-127 makes it easily eroded by body fluids and difficult to peel off from the wound, increasing the risk of infection, and appropriate excipients need to be added to improve its performance. Some scholars have developed an injectable polypeptide-based antibacterial hydrogel composed of PF-127, oxidized hyaluronic acid and poly-ε-L-lysine, and proved that this antibacterial hydrogel loaded with human adipose MSC-Exo can improve the wound healing rate of diabetic mice, and its sustained-release properties help to protect the integrity of skin appendages and improve the quality of wound healing.

[0006] In addition, active peptide substances are also effective substances for treating skin injuries. Deer antler peptide is a natural repair substance that has a significant effect on repair. Deer antler peptide can accelerate wound healing. It can promote cell regeneration and tissue repair, improve blood circulation around the wound, and increase the supply of oxygen and nutrients, thereby accelerating the healing of wounds. Deer antler peptide can promote bone repair. It can stimulate the proliferation and differentiation of bone cells and promote the regeneration and repair of bone tissue. In the treatment of fractures or bone injuries, deer antler peptide can promote fracture healing. Deer antler peptide also has anti-inflammatory effects. Studies have shown that it can inhibit inflammatory reactions and reduce the release of various inflammatory mediators, thereby reducing damage caused by inflammation. This is very beneficial for the treatment of various inflammatory diseases. In short, deer antler peptide has a variety of repair effects such as promoting wound healing, promoting bone repair and anti-inflammatory effects. It is widely used in the medical field and has achieved certain therapeutic effects. In addition, active peptides from amphibians provide new ideas for clinical solutions to chronic and difficult-to-heal wound repair, not only because they are good candidate drug lead molecules, but also because they play an important and positive role in analyzing new molecular mechanisms and discovering drug targets as molecular probes. Therefore, using highly active peptides as probe molecules to analyze their mechanisms of action at the cellular and animal levels will provide new therapeutic strategies and drug targets for the treatment of skin trauma and provide a basis for the research and development of peptide drugs.

[0007] However, at present, there are not enough types of drugs that are effective in treating skin injuries, especially drugs with better effects and fewer side effects are an important research direction. Summary of the invention

[0008] The present invention prepares exosomes from bone marrow mesenchymal stem cells, and the exosomes have a good effect of promoting the proliferation of human skin fibroblasts.

[0009] The present invention further provides a medicine for promoting skin damage repair, which contains the bone marrow mesenchymal stem cell exosomes.

[0010] Furthermore, the inventors obtained a polypeptide RANA-B-5 having good performance in promoting skin wound repair from Rana sylvatica skin by alkali extraction, bromelain hydrolysis and column chromatography separation, and then mass spectrometry identification. The amino acid sequence of the polypeptide is shown in SEQ ID NO: 1.

[0011] Certain common amino acids in the polypeptides of the present invention, which may not be genetically encoded and may be present or replaced by an amino acid, include, but are not limited to, β-alanine (b-Ala) and other ω-amino acids such as 3-aminopropionic acid (Dap), 2,3-diaminopropionic acid (Dpr), 4-aminobutyric acid, etc.; α-aminoisobutyric acid (Aib); ε-aminocaproic acid (Aha); δ-aminovaleric acid (Ava); methylglycine (MeGly); ornithine (Orn); citrulline (Cit); tert-butylalanine (t-BuA); tert-butylglycine (t-BuG); N-methylisoleucine (MeIle); phenylglycine (Phg); cyclohexylalanine (Cha); norleucine (Nle); 2-naphthylalanine ( 2-Nal); 4-chlorophenylalanine (Phe(4-Cl)); 2-fluorophenylalanine (Phe(2-F)); 3-fluorophenylalanine (Phe(3-F)); 4-fluorophenylalanine (Phe(4-F)); penicillamine (Pen); 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid (Tic); β-2-thienylalanine (Thi); methionine sulfoxide (MSO); homoarginine (hArg); N-acetyl lysine (AcLys); 2,3-diaminobutyric acid (Dab); 2,3-diaminobutyric acid (Dbu); p-aminophenylalanine (Phe(pNH2)); N-methylvaline (MeVal); homocysteine ​​(hCys) and homoserine (hSer). These amino acids all fall into the categories defined above.

[0012] The polypeptide of the present invention can be used for wound healing, and is particularly useful for chronic wound healing. Single polypeptides, polypeptide variants, polypeptide derivatives and mixtures thereof (such as those with different sequences) can be combined in a preparation to promote wound healing and prevent or treat skin problems. Optimal healing and skin regeneration may require some matrix metalloproteinase activity. Therefore, the compositions and preparations of the present invention do not necessarily promote the maximum inhibition of matrix metalloproteinases. On the contrary, due to the need to optimize healing and promote healthy skin development, the activity of the polypeptide preparation can be changed. Lower or higher levels of inhibition can be obtained by changing the type, content and amount of the polypeptide, thereby promoting healing and healthy skin development.

[0013] A therapeutically effective amount of a polypeptide of the present invention is an amount of the polypeptide that promotes healthy skin development and / or wound healing to the extent required. For example, when present in a therapeutic or pharmaceutical composition, the amount of the polypeptide of the present invention ranges from about 0.001% to about 30% by weight of the composition. The polypeptide may constitute about 0.5% to about 20% by weight of the composition. Alternatively, the polypeptide constitutes about 1.0% to about 10% by weight of the composition. The therapeutically effective amount of the polypeptide may necessarily vary with the route of administration. For example, a therapeutic amount of 30 to 112,000 μg per kg of body weight may be effective for intravenous administration or surface application. However, the amount of polypeptide required for healthy skin development or wound treatment varies not only with the route of administration, but also with the nature of the condition being treated and the age and condition of the patient, and is ultimately determined by the attending physician or clinician.

[0014] More specifically, the present invention further provides a pharmaceutical composition for promoting skin damage repair, which contains the polypeptide RANA-B-5 of the present invention that has good performance in promoting skin wound repair, and its amino acid sequence is shown in SEQ ID NO:1.

[0015] In some examples, polypeptides can also be orally administered in combination with pharmaceutically acceptable carriers such as inert diluents or assimilable edible carriers. They can be loaded into hard or soft shell gelatin capsules, can be compressed into tablets, or can be directly integrated with the food of the patient's diet. For oral therapeutic administration, polypeptides can be combined with one or more excipients and can be used in the form of absorbable tablets, buccal tablets, lozenges, capsules, elixirs, suspensions, syrups, wafers, etc. These compositions and preparations should contain at least 0.1% by weight of active compound. The percentage of compositions and preparations can, of course, be different, and can conveniently be about 2 to about 60% of the weight of a given unit dosage form. The amount of active compound in such therapeutically useful compositions is the amount that can obtain an effective dosage level.

[0016] Specifically, tablets, lozenges, pills, capsules, etc. may also contain the following ingredients: binders such as tragacanth, gum arabic, corn starch or gelatin; excipients such as dicalcium phosphate; disintegrants such as corn starch, potato starch, alginic acid, etc.; lubricant magnesium stearate; and sweeteners such as sucrose, fructose, lactose or aspartame or flavoring agents such as peppermint, wintergreen oil or cherry flavoring may be added. When the unit dosage form is a capsule, it may contain a liquid carrier such as a vegetable oil or polyethylene glycol in addition to the above-mentioned types of materials. Various other materials may also be present as a coating, or otherwise used to modify the physical shape of the solid unit dosage form. For example, tablets, pills or capsules may also be coated with gelatin, wax, shellac or sugar, etc. Syrups or elixirs may also contain the active composition, sucrose or fructose as a sweetener, methyl and propylparabens as preservatives, dyes and flavorings such as cherry or citrus flavors. Of course, any material used in preparing any unit dosage form must be pharmaceutically acceptable and substantially non-toxic in the amounts employed. Additionally, the polypeptides can be incorporated into sustained-release preparations and devices.

[0017] Preferably, the present invention further provides a medicine kit for promoting skin damage repair, which contains bone marrow mesenchymal stem cell exosomes and the polypeptide RANA-B-5 of the present invention that has good ability to promote skin wound repair, and its amino acid sequence is shown in SEQ ID NO: 1.

[0018] More specifically, the present invention further provides the use of bone marrow mesenchymal stem cell exosomes and polypeptide RANA-B-5 in preparing a drug kit for promoting skin damage repair, wherein the amino acid sequence of the polypeptide is shown in SEQ ID NO: 1.

[0019] More specifically, the present invention further provides the use of bone marrow mesenchymal stem cell exosomes and polypeptide RANA-B-5 in the preparation of cosmetics for promoting skin beauty, wherein the amino acid sequence of the polypeptide is shown in SEQ ID NO: 1.

[0020] More specifically, in addition to polypeptides and exosomes, the cosmetics of the present invention in some embodiments contain one or more other ingredients commonly used in cosmetics. Representative traditional cosmetic ingredients that are easily formulated into the cosmetics of the present invention include, for example, deionized water, which can constitute the majority of the weight of the cosmetics of the present invention; solids and waxes such as petroleum, lanolin, ceresin, microcrystalline wax, carnuba wax, C10-C30 fatty acids, C10-C30 alcohols; oils such as olive oil, jojoba oil, castor oil, sunflower oil, hazelnut oil, shea butter, and safflower oil; guar gum, xanthan gum, carrageenan, hydroxyethyl cellulose, and hydroxyethyl cellulose; cellulose), sclerotium gum, carbomers, polyacrylates and acrylate-C10-C30 alkyl acrylate copolymers; hydrophilic humectants such as glycerin, propanediol, sodium lactate, sodium PCA; emollients such as dicaprylyl ether, myristyl myristate, C10-C30 caprates, C10-C30 triglycerides containing caprylic and / or capric acid, and C10-C30 glycerides; and emollients such as cetyl alcohol, stearyl alcohol, glyceryl sterate, stearic acid, and glyceryl stearate. Auxiliary emulsifiers such as glyceryl sterate, glyceryl distearate;emulsifiers such as nonionic surfactants and anionic surfactants, such as salts of lauroyl lactylate, caproyl lactylate, cocoyl lactylate, stearoyl lactylate, cetearyl olive oil ester, sorbitan olivate or glyceryl oleate citrate, typical cations of these salts include sodium ion, potassium ion, ammonium ion, calcium ion and magnesium ion; silicone oil substances; inorganic auxiliary ingredients (such as inorganic auxiliary ingredients); colorants, such as colorants, accompaniments, and inorganic dyes; metal saponified or siliconized inorganic or organic pigments and organic dyes; nonionic surfactants; polysiloxanes; water preservatives; pH adjusters; vitamins and vitamin metabolites such as vitamin E, vitamin K or B vitamin complex; essential oils; ultraviolet light absorbing compounds; fragrances; humectants; blood flow enhancing agents; agents inducing a cold sensation; antiperspirants; actives and antimicrobial agents.

[0021] Furthermore, the present invention also provides the use of bone marrow mesenchymal stem cell exosomes and polypeptide RANA-B-5 in the preparation of anti-aging cosmetics by promoting skin collagen secretion, wherein the amino acid sequence of the polypeptide is shown in SEQ ID NO: 1.

[0022] Beneficial Effects

[0023] The present invention provides a method for preparing stem cell exosomes and their application in medicine and cosmetology. Specifically, the exosomes prepared by separation from bone marrow mesenchymal stem cells and the polypeptide RANA-B-5 separated and identified from forest frog skin that is good at promoting skin wound repair both have a good effect of promoting the proliferation of skin fibroblasts, and can also increase the expression activity of collagen in cells. The two can significantly improve the repair of skin damage when used alone or in combination, and have good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The effects of exosomes on the expression of type I collagen in cells.

[0025] Figure 2 Effects of each group on wound healing rate. DETAILED DESCRIPTION

[0026] Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve. It is particularly important to point out that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described by preferred embodiments, and relevant personnel can obviously change or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to achieve and apply the technology of the present invention. The methods, equipment, and materials in the following implementation cases, if not specifically stated, are all conventional methods, equipment, and materials in the art, and can be purchased from the market.

[0027] Example 1 Preparation of bone marrow mesenchymal stem cell exosomes

[0028] Bone marrow was removed from the femur of male SD rats, and the bone marrow cells were washed with basal medium and inoculated in DMEM:F12 medium supplemented with 10% fetal bovine serum, penicillin (100 U / mL), and streptomycin (100 μg / mL). The cells were incubated in 5% CO 2 The cells were incubated at 37°C in a humidified atmosphere. After 48 h, the culture dishes were washed with fresh medium to remove non-adherent cells. The cells were harvested with 0.25% trypsin-EDTA and plated at 5 × 10 3 / cm 2 . 3rd generation MSCs were identified by flow cytometry using antibodies against CD90-APC, CD45-PE-Cy7, and CD11b-FITC. Flow cytometric analysis showed that MSCs were CD90 positive, but CD45 and CD11b negative, and were spindle-shaped under an optical microscope, indicating that bone marrow mesenchymal stem cells were successfully isolated and prepared.

[0029] The 4th generation bone marrow mesenchymal stem cells were cultured in DMEM-F12 containing 10% fetal bovine serum, and the culture medium was collected and centrifuged at 2000×g for 10 minutes to remove cell debris. The supernatant was aspirated and centrifuged at 100000×g for 70 minutes, repeated twice, and the resulting precipitate was the exosome. The precipitate was resuspended in PBS, and the protein concentration of the exosomes was determined to be 8.2 mg / mL using the BCA protein detection kit. Transmission electron microscopy showed that the morphology of MSC-Exo was small round particles with a typical cup-shaped morphology; at the same time, flow cytometric analysis of the phenotype of MSC-Exo showed that 93.5% of the positive rate expressed CD63 protein, which is a specific marker for exosomes, indicating that relatively pure exosomes were obtained.

[0030] Example 2: Exosomes' activity in promoting skin cell proliferation and verification

[0031] Human skin fibroblasts (HSF) were purchased from Zeye Biotechnology, catalog number: ZY-H075. After routine digestion and counting, HSF cells were counted at 2×10 3 / well inoculated in a 96-well plate, with 3 replicates in each group. The experiment was divided into 4 groups: the blank control group was high-glucose DMEM medium, the negative control group was high-glucose DMEM medium for conventional culture of HSF, and the low-dose exosome group, the medium-dose exosome group, and the high-dose exosome group were incubated with high-glucose DMEM medium of the exosomes prepared in Example 1 with a final concentration of 10μg / ml, 100μg / ml, and 200μg / ml, respectively. After 24h, 10μl of CCK8 solvent was added to each well. After incubation for 2h, the absorbance (A) value of each group was measured at a wavelength of 450nm using an ELISA reader. The relative viability of each group of cells = (experimental group A value - blank control group A value) / (control group A value - blank control group A value). The results are shown in Table 1.

[0032] Table 1 Relative cell viability results of each group

[0033] Group Relative cell viability of each group Negative control group 0.69±0.05 Low dose exosome group 1.23±0.08# Medium dose exosome group 1.46±0.12# High-dose exosome group 1.79±0.15#

[0034] As can be seen from Table 1, the low-dose exosome group, medium-dose exosome group and high-dose exosome group were significantly higher than the negative control group, P < 0.05, and promoted the improvement of relative cell viability in a dose-dependent manner.

[0035] Example 3 Activity detection of polypeptide RANA-B-5

[0036] Human skin fibroblasts (HSF) were purchased from Zeye Biotechnology, catalog number: ZY-H075. After routine digestion and counting, HSF cells were counted at 2×10 3 / well inoculated in a 96-well plate, with 3 replicates in each group. The experiment was divided into 4 groups: the blank control group was high-glucose DMEM medium, the negative control group was high-glucose DMEM medium for conventional culture of HSF, the low-dose polypeptide RANA-B-5 group, the medium-dose polypeptide RANA-B-5 group and the high-dose polypeptide RANA-B-5 group were incubated with high-glucose DMEM medium with a final concentration of 1μg / ml, 10μg / ml and 50μg / ml polypeptide, respectively. After 24h, 10μl of CCK8 solvent was added to each well. After incubation for 2h, the absorbance (A) value of each group was measured at a wavelength of 450nm using an enzyme marker. The relative viability of each group of cells = (experimental group A value - blank control group A value) / (control group A value - blank control group A value). The results are shown in Table 2.

[0037] Table 2 Relative cell viability results of each group

[0038] Group Relative cell viability of each group Negative control group 0.67±0.03 Low-dose peptide group 1.49±0.08# Medium dose peptide group 1.83±0.10# High-dose peptide group 2.23±0.11#

[0039] As can be seen from Table 2, the low-dose peptide group, the medium-dose peptide group and the high-dose peptide group were significantly higher than the negative control group, P < 0.05, and promoted the improvement of relative cell viability in a dose-dependent manner.

[0040] In addition, fluorescence quantitative PCR was used to detect the expression of type I collagen in each group of cells. The amplification primers used were CCTCAGGGTATTGCTGGACAAC,

[0041] CAGAAGGACCTTGTTTGCCAGG; β-actin was used as the internal reference, and the primers were GGACTGTTACTGAGCTGCGTT, CGCCTTCACCGTTCCAGTT; 2 -ΔΔCt The expression level of gene mRNA was quantitatively analyzed by the method. The results are as follows Figure 1 shown.

[0042] from Figure 1 It can be seen that the polypeptide of the present invention can promote the expression of type I collagen in cells in a dose-dependent manner, especially in the high-dose polypeptide group, the relative expression of mRNA reached (2.31±0.08), which was significantly improved compared with the negative control group (0.52±0.09). Since type I collagen is an essential protein for skin damage repair, this protein can shorten the wound healing time. Figure 1 The results suggest that the peptide may promote wound healing by promoting the expression of type Ⅰ collagen in wound tissue.

[0043] Example 4 Experiments on Peptides and Exosomes in Wound Repair in Mice

[0044] Kunming mice (22-25g) were provided with necessary food and water, and given 12h light and 12h darkness. After 7 days of adaptation, a full-thickness skin trauma model was made. The specific steps were as follows: 1% sodium pentobarbital (0.1ml / 20g) was used to anesthetize the mice by intraperitoneal injection. The hair on the back of the mouse to be modeled was shaved with an electric razor, and then disinfected with 75% alcohol. A sterilized special hollow round steel pipe was used to punch holes on the left and right sides of the mouse's back to cause symmetrical and equal-sized full-thickness skin trauma. After the operation, the mouse was placed alone in a clean, dust-free mouse cage until it recovered from anesthesia.

[0045] The skin wound model mice were randomly divided into 3 groups:

[0046] Exosome group: Immediately after surgery, 1 mg / ml of exosomes prepared in Example 1 and 300 μl (dissolved in saline) were injected at 4 points around the right wound surface of the mice; the left wound control group was injected with an equal amount of saline.

[0047] Peptide group: The right wound was smeared with 50μg / ml peptide RANA-B-5 solution, with a smear volume of 300μl. The left wound control group was smeared with an equal amount of normal saline.

[0048] Peptide combined with exosome group: Immediately after surgery, 1 mg / ml of exosomes prepared in Example 1 and 300 μl (dissolved in saline) were injected at 4 points around the right wound surface of the mouse, and at the same time, 50 μg / ml peptide RANA-B-5 solution was applied to the wound surface, with an application volume of 300 μl. The left wound control group was injected with an equal amount of saline, and the wound surface was then smeared with an equal amount of saline.

[0049] Positive control group: In the last group, 300 μl Kangfuxin solution (Good Doctor, Panxi Pharmaceutical) was applied to the right wound surface; an equal amount of normal saline was applied to the left wound surface.

[0050] The above wounds were treated with drugs twice a day, and photos were taken once on the first day of drug administration and again on the sixth day of drug administration. The wound area was estimated using ImageJ software, and the percentage of the residual wound area to the initial wound area was calculated. Wound healing rate (%) = [[R(0)-R(6)] / R(0)] x 100%, where R(0) and R(6) represent the wound areas on the day of modeling and the sixth day after surgery, respectively. The results are shown in Figure 2 shown.

[0051] from Figure 2It can be seen that the exosome group, peptide group, peptide combined with exosome group and positive control group can significantly improve the wound healing rate compared with the control group. The wound healing rate of the peptide group reached (83.03±0.94)%, the wound healing rate of the exosome group reached (64.14±2.13)%, and the wound healing rate of the peptide combined with exosome group reached (96.14±1.48)%. The therapeutic effect after combined use was significantly improved.

[0052] Example 5 Safety Experiment of Peptides and Exosomes

[0053] The present invention simultaneously conducted acute toxicity experiments on polypeptides and exosomes. The mice were divided into 4 groups, each with 5 mice. Experimental group 1 was given 1g / kg of polypeptide; experimental group 2 was intraperitoneally injected with 1g / kg of exosomes; experimental group 3 was intraperitoneally injected with 1g / kg of exosomes and 1g / kg of polypeptide; the safety of each group was observed. The control group was intraperitoneally injected with normal saline and observed for two consecutive weeks. The results showed that no death and other abnormal behaviors, such as tremor, dullness, irritability, frenzy and tail stiffness, were found in each group within two weeks. The mice in experimental groups 1-3 were dissected, and there was no obvious organ damage to the heart, liver, and kidney compared with the control group. The above results show that the polypeptides and exosomes of the present invention are potentially safe in treatment.

[0054] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. Although embodiments of the present invention have been shown and described, those skilled in the art will appreciate that various changes, modifications, substitutions and variations may be made to these embodiments without departing from the principles and purpose of the present invention, and that the scope of the present invention is defined by the claims and their equivalents.

Claims

1. A polypeptide RANA-B-5 isolated from the skin of Rana sylvatica having the function of promoting skin wound repair, characterized in that The amino acid sequence is shown in SEQ ID NO:

1.

2. Use of the polypeptide RANA-B-5 as claimed in claim 1 in the preparation of a medicament for treating skin damage.

3. A medicine kit for promoting skin damage repair, comprising bone marrow mesenchymal stem cell exosomes and a polypeptide RANA-B-5 for promoting skin wound repair, wherein the amino acid sequence is shown in SEQ ID NO:

1.

4. Use of bone marrow mesenchymal stem cell exosomes and polypeptide RANA-B-5 in the preparation of a drug kit for promoting skin damage repair, wherein the amino acid sequence of the polypeptide is shown in SEQ ID NO:

1.

5. Use of bone marrow mesenchymal stem cell exosomes and polypeptide RANA-B-5 in the preparation of anti-aging cosmetics by promoting skin collagen secretion, wherein the amino acid sequence of the polypeptide is shown in SEQ ID NO: 1.

Images