Protease mutant with wide pH application range and application of protease mutant in preparation of collagen peptide

Abstract

The invention belongs to the technical field of enzyme engineering, and particularly relates to a protease mutant with a wide pH application range and application of the protease mutant to preparation of collagen peptide. The protease mutant disclosed by the invention is obtained by mutation on the basis of an original sequence of serine protease. The optimal degradation activity of the protease mutant to collagen is equivalent to that before mutation, and the protease mutant has a wider application range to pH conditions in reaction. The protease mutant can enhance the collagen extraction rate, simplify the process and reduce the process cost, and has a very good application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of enzyme engineering, and particularly relates to a protease mutant with a wide pH applicable range and use thereof in preparing collagen peptides. Background Art

[0002] Aquaculture and fishery chains are booming, and the output of fish products is rising year by year, resulting in a considerable amount of by-products such as fish skin. Fish skin is rich in collagen and is a high-quality raw material for the preparation of collagen peptides. As people's desire for collagen and collagen peptides increases day by day, efficient preparation methods have become a research hotspot.

[0003] Serine proteases, named after the key site serine in their catalytic activity center, are widely distributed in the plant and microbial world. This type of enzyme has good enzymatic activity under neutral or alkaline conditions and can convert fish skin collagen into small molecular weight peptides. Compared with the chemical method, which relies on acid or alkali to break peptide bonds, the enzymatic preparation method has a milder reaction, has a higher recognition and binding ability for the substrate, and can maintain the biological activity of collagen peptides to a greater extent, bringing new opportunities for the development of related industries.

[0004] In the process of utilizing serine protease to degrade fish skin collagen, the pH of the reaction solution continues to decrease with the increase of small molecular weight peptides or amino acid content. The activity of existing serine proteases will significantly decrease with the decrease of pH. Therefore, in the process, it is necessary to continuously add alkaline solution to the reaction system to keep the pH constant, which not only makes the preparation process cumbersome, causes a certain degree of environmental pollution problems, but also increases the cost of the process. Therefore, developing a serine protease with a wider pH application range is an important technical problem in this field. Summary of the invention

[0005] In view of the problems of the prior art, the present invention provides a protease mutant with a wide pH applicable range and use thereof in preparing collagen peptides.

[0006] A serine protease mutant, the amino acid sequence of the serine protease mutant is shown in SEQ ID NO: 2, or has at least 90% identity with SEQ ID NO: 2.

[0007] Preferably, the amino acid sequence of the serine protease mutant is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 2;

[0008] Alternatively, the amino acid sequence of the serine protease mutant is at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identical to SEQ ID NO:2.

[0009] The present invention also provides a nucleic acid molecule for encoding the serine protease mutant. The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO: 4. The nucleic acid molecule is a chimera of DNA, RNA or both.

[0010] The present invention also provides a vector for expressing the serine protease mutant, which comprises the nucleotide sequence shown in SEQ ID NO: 4 and a basic plasmid.

[0011] Preferably, the basic plasmid is selected from the group consisting of pET series, pQE series, pGEX series, pBAD series, pRS series, pBluescript series, pUC series, pBR series, pKT series, and pACYC series; preferably pKT101.

[0012] The present invention also provides a genetic engineering bacterium for preparing serine protease mutants, which is a chassis cell carrying the above-mentioned vector.

[0013] Preferably, the chassis cells are selected from Bacillus subtilis, Bacillus licheniformis or Bacillus amyloliquefaciens; preferably Bacillus subtilis WB600.

[0014] The present invention also provides a method for preparing a serine protease mutant, comprising the following steps: using the above-mentioned genetically engineered bacteria for fermentation, and collecting the fermentation liquid containing the serine protease mutant product.

[0015] The serine protease mutant, nucleic acid molecule, vector and genetically engineered bacteria are used to prepare collagen peptides.

[0016] The present invention also provides a method for preparing collagen peptide, comprising the following steps: mixing the serine protease mutant with raw materials, and performing degradation reaction to obtain collagen peptide.

[0017] Preferably, the conditions of the degradation reaction include: pH controlled at 6.0-12.0;

[0018] And / or, the raw material is selected from collagen;

[0019] And / or, the conditions of the degradation reaction include: a temperature of 50°C.

[0020] The present invention mutates the existing serine protease to obtain a serine protease mutant. The mutant has the best degradation activity of collagen comparable to that before mutation and has a wider application range for the pH conditions in the reaction. The serine protease mutant of the present invention is used to degrade collagen to produce collagen peptides, which can enhance the collagen extraction rate over a long period of time; and can reduce the amount of alkaline solution used to adjust the pH in the process, making the enzymatic hydrolysis process simple, reducing the production cost of collagen peptides, having good economic and social benefits, and facilitating subsequent industrial application and promotion.

[0021] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0022] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the SDS-PAGE image of the fermentation broth of protease KT102 and protease mutant KT124.

[0024] Figure 2 pH curves of protease KT102 and protease mutant KT124.

[0025] Figure 3 The gelatinase activity curves of protease KT102 and protease mutant KT124 under different pH conditions.

[0026] Figure 4 This is the enzymatic extraction rate curve of tilapia skin collagen by protease KT102 and protease mutant KT124. DETAILED DESCRIPTION

[0027] In the following examples and experimental examples, reagents and raw materials not specifically described are all commercially available products.

[0028] Example 1 Protease mutants and their preparation

[0029] The protease mutant of this embodiment is obtained by mutating 9 sites on the basis of the original sequence of serine protease (amino acid sequence as shown in SEQ ID NO: 1, encoding gene as shown in SEQ ID NO: 3), and its amino acid sequence is shown in SEQ ID NO: 2, and the encoding gene is shown in SEQ ID NO: 4. It can enzymolyze collagen at pH 10.0 and has high activity. At the same time, there is no need to constantly regulate the pH of the reaction solution to maintain 10.0 during the enzymolysis process. The enzyme can maintain good degradation activity for collagen under the wide range of application conditions of pH 6.0-12.0.

[0030] The preparation method of the protease mutant KT124 (and the original sequence serine protease KT102 as a comparative experimental sample) is as follows:

[0031] 1. Gene cloning and expression plasmid construction

[0032] The sequence of the plasmid pKT101 used in this example is a sequential connection of SEQ ID NOs: 5, 6, and 7. The example provides a preparation process of the basic plasmid pKT101, including: chemically synthesizing a sequence fragment containing a Bacillus replicon, as shown in SEQ ID NO: 5; chemically synthesizing a sequence fragment containing a kanamycin resistance gene, a promoter, a signal peptide, a multiple cloning site, and a terminator, as shown in SEQ ID NO: 6; chemically synthesizing a sequence fragment containing an Escherichia coli replicon and an ampicillin resistance gene, as shown in SEQ ID NO: 7; seamlessly cloning the above three DNA fragments and transforming Escherichia coli DH5α; extracting plasmids from positive clones, and sequencing to obtain a completely correct plasmid pKT101.

[0033] The embodiment provides an expression plasmid pKT102 carrying the nucleotide sequence shown in SEQ ID NO: 3. The preparation process of the expression plasmid includes: connecting the DNA fragment shown in SEQ ID NO: 3 with the vector pKT101 linearized by the restriction enzyme BamHI; transforming Escherichia coli DH5α with the ligation product; extracting plasmids from positive clones, and sequencing to obtain a completely correct plasmid pKT102.

[0034] The embodiment provides a DNA as shown in SEQ ID NO: 4 as a target amplification sequence. The target sequence can be obtained by PCR amplification and chemical synthesis, and the embodiment is not limited thereto.

[0035] The embodiment also provides an expression plasmid carrying the nucleotide sequence shown in SEQ ID NO:4

[0036] pKT124. The preparation process of the expression vector includes: cloning the DNA fragment shown in SEQ ID NO: 4 into the vector pKT101 linearized by the restriction enzyme BamHI, transforming Escherichia coli DH5α; extracting plasmids from positive clones, and sequencing to obtain completely correct plasmid pKT124.

[0037] 2. Creation of expression strains

[0038] The embodiment provides an expression strain carrying the above expression plasmid. The preparation method of the expression strain comprises: respectively transferring the expression plasmids pKT102 and pKT124 provided in the above embodiment into Bacillus subtilis WB600 (Hubei University); screening positive colonies on a skim milk plate containing kanamycin at a final concentration of 10 μg / mL, and the transformant with the largest hydrolysis circle is the corresponding recombinant expression strain Bacillus subtilis T102 and Bacillus subtilis T124.

[0039] The expression plasmid was transferred into Bacillus subtilis WB600 according to the Spizizen chemical method, including:

[0040] Use LB solid plate to activate strain Bacillus subtilis WB600, and culture at 37℃ for 12h. Pick 2-3 single colonies and inoculate into 9ml GMI solution, and culture at 30℃, 125r / min for 12h; take 1ml culture solution and transfer to 9ml GMI solution, and culture at 37℃, 220r / min for 3.5h; take 1ml of the culture solution in the previous step into 9ml GMⅡ solution, and continue to culture at 37℃, 125r / min for 1.5h, and collect the bacteria by centrifugation at 5000g for 10min; gently suspend the bacteria with 5ml GMⅡ solution, which is the competent cell. Mix 5μg plasmid into 0.1ml competent cells, and culture at 37℃, 220r / min for 1h, then apply to skim milk solid plate containing kanamycin with a concentration of 10μg / ml, and culture at 37℃ for 10h, and compare the hydrolysis transparent zone on the transformation plate.

[0041] Among them, screening positive colonies from transformants includes:

[0042] The colony with the largest casein hydrolysis circle on the transformation plate was picked, and streaked and purified on a skim milk plate containing 10 μg / mL kanamycin. The colony with the best hydrolysis activity was picked as the corresponding target expression strain, which was named Bacillus subtilis T102 and Bacillus subtilis T124.

[0043] 3. Preparation of collagenase

[0044] The embodiment provides a method for preparing collagenase KT102 and mutant KT124. The method comprises: obtaining the expression strain provided in the above embodiment; fermenting the expression strain; and collecting the fermentation broth containing the target protease by centrifugation.

[0045] In some embodiments, 2-3 single colonies of freshly activated expression strains Bacillus subtilis T102 and Bacillus subtilis T124 were picked and inoculated into 5 mL of LB solution containing 10 μg / mL kanamycin, and cultured at 37°C, 220 r / min, until the cell density OD 600 1 mL of seed solution was transferred to 50 mL of fermentation medium (2 wt.% maltodextrin, 2 wt.% yeast powder, 2 wt.% soybean meal powder, 0.2 wt.% sodium chloride, 0.5 wt.% potassium dihydrogen phosphate, pH 7.0), cultured at 37°C, 220 r / min for 60 h, and centrifuged at 8000 g for 10 min to collect the supernatant, which was the fermentation enzyme solution containing protease KT102 and mutant KT124.

[0046] SDS-PAGE of the fermentation enzyme broth of protease KT102 and mutant KT124. Figure 1 As shown, it was shown that in this example, proteinase KT102 and mutant KT124 were successfully expressed.

[0047] In the above examples, the protein and gene sequences involved are as follows:

[0048] SEQ ID NO:1

[0049] mkkkalgaallsmtmglsvfaagafakgpeanesyrviiqgpaaeranvkaqikerwdfgkdgltaevnekqyqallknknikiekvsevtldtarteasskkdgvsleaagypsdqtpwgiesiynnssisstsggsgikvavldtgvytnhidlqgsaeqckdftqstplvngsctdrqghgthvagtvlahggydglgiygvapqaklwaykvlgdngsgysddiagairhvadeavrtgskvvinmslgssgkdsliasavdyayskgvlivaaagnsgysantigypgalvnaiavaalenvqqngtyrvanfssrgnpntdgdyyiqerdievsapgasiestwynggyntisgtsmatphvaglaakvwsanpgmshtqlrtelrnraklydikggygaatgddyasgfgyprvr

[0050] SEQ ID NO:2

[0051] mkkkalgaallsmtmglsvfaagafakgpeanesyrviiqgpaaeranvkaqikerwdfgkdgltaevnSkqyqallknkniTiekvsevtldtarteassskNdgvsleaagypsdqtpwgiesiynnssisstsggsgikvavldtgvytnhidlqgsaeqckdftqstplvngsctdrqghgthvagtvlahggydglgiygvapqaklwaykvlgdngsgysddiagairhvadeavrtgskvvinmslgssgkdsliasavdyayskgvlivaaagnsgysantigypgalTnaiavaalenvqqngtyrvanfssrgnpntdgdyyiquerdVevsapgasiestwynggyntisgtsmatphvaglaakIwsSnpYmshtqlrtelrnrakQydikggygaatgddyasgfgyprvr

[0052] SEQ ID NO:3

[0053]

[0054] SEQ ID NO:4

[0055]

[0056] SEQ ID NO:5

[0057]

[0058] SEQ ID NO:6

[0059] aattatctgaaaagggaatgagaatagtgaatggaccaataataatgacaagagaagaacgcatgaaaatcgtccacgaaatcaaagaacggatcctggataaatatggcgacgatgttaaagcaattggcgtttatggctcactgggcagacagacagatggaccgtattcagatattgaaatgatgtgcgttatgagcacagaagaggcagaattttcacatgaatggacaacaggcgaatggaaagtcgaagttaattttgacagcgaagaaatcctgctggattatgcatcacaagttgaatcagattggccgttaacacatggccaatttttctcaattctgccgatttatgatagcggaggctatctggaaaaagtctatcaaacagcaaaaagcgttgaagcgcagacatttcatgatgcaa tttgcgcactgattcgaagaactgtttgaatatgcaggcaaatggcgcaatattagagttcaaggaccgacaacatttctgccgtcactgacagttcaagttgcaatggcaggcgcaatgctgattggcctgcatcatagaatttgctatacaacatcagcaagcgttctgacagaagcagttaaacaatcagatcttccgtcaggctatga tcatctgtgccaatttgttatgtcaggccaactgtcagattcagaaaaactgctggaaagcctggaaaacttttggaatggcattcaagaatggacagaacgccatggctatattgttgatgtctcaaaacgcatcccgttttaatagacgatgacctctaataattgttaatcatgttggttacgtatttattaacttctcctagtattagtaa

[0060] SEQ ID NO:7

[0061]

[0062] The technical solution of the present invention is further described below through experiments. The protease mutant KT124 and the original sequence serine protease KT102 used in the following experimental examples were prepared according to the method of Example 1.

[0063] Experimental Example 1 Comparison of serine protease activity between protease mutant and pre-mutation

[0064] 1. Enzyme properties-pH curve

[0065] Prepare 50mmol / L Britton-Robinson buffer solutions of pH 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, and 12.0, and dilute the KT102 and KT124 enzyme solutions prepared in Example 1 to 20U / mL with the buffer solutions of the above pH. Determine the enzyme activity of proteases KT102 and KT124 on substrate casein at 45°C and corresponding pH conditions. The highest enzyme activity is defined as 100%, and the corresponding pH is the optimal enzymatic hydrolysis pH of the enzyme on casein, and the relative enzyme activity under other pH conditions is calculated.

[0066] like Figure 2 As shown, protease KT102 has degradation activity in the pH range of 6.0-12.0, and the activity increases with the increase of pH, with the optimum pH being 11.0; in the pH range of 9.0-12.0, enzyme KT102 has a relative activity of more than 65.77%; while the enzyme can only maintain a relative enzyme activity of 20.71% under the condition of pH 7.0. The enzyme mutant KT124 has a wider pH range for substrate hydrolysis, and has degradation activity under the conditions of pH 4.0-12.0, with the optimum pH being 10.0. In the pH range of 6.0-12.0, enzyme mutant KT124 maintains a relative activity of more than 60.51%; especially in the pH range of 7.0-11.0, protease mutant KT124 has a relative enzyme activity of more than 82.23%. Under pH 6.0, 7.0 and 8.0 conditions, the relative enzyme activity of protease KT124 increased to 9.22, 3.97 and 2.24 times that of KT102, respectively.

[0067] 2. Gelatin degrading enzyme activity

[0068] Under high temperature conditions, tilapia skin collagen can be converted into soluble gelatin. The activity of enzymes KT102 and KT124 on substrate gelatin was determined by the ninhydrin colorimetric method. The enzyme activity unit is defined as the amount of enzyme required to degrade one milligram of gelatin to produce 1 μmol of leucine per hour at 50°C.

[0069] The gelatin degradation activities of enzymes KT102 and KT124 in the pH range of 6.0-12.0 were determined. The method for determining the enzyme activity at pH 12.0 is as follows: 1% gelatin (G7041, Merck) solution was prepared with 50mmol / L Tris-HCl (pH 12.0). 1mL of 1% gelatin solution (w / v), 4mmol / L CaCl2, was mixed with 1mL of KT102 and KT124 enzyme solutions diluted to 1mg protein with 50mmol / L Tris-HCl (pH 12.0), and the enzymes were hydrolyzed in a 50℃ water bath for 1h. 2mL of 1.25mol / L pre-cooled TCA solution was added to terminate the reaction. Centrifuge at 10000g for 10min, take 200μL of the hydrolyzed aqueous solution, mix with 1mL of ninhydrin-sodium citrate solution, and boil for 20min. After the reaction solution cools to room temperature, add 5 mL of 50% n-propanol solution, mix well, and measure the absorbance at 600 nm using a spectrophotometer. Set up a blank control group for the reaction of the background components of the solution. The blank control group is composed of 1 mL of boiled and inactivated diluted enzyme solution reacted with 1 mL of bovine bone insoluble collagen, and the other steps are synchronized with the experimental group. React 200 μL of leucine solution of different concentrations with ninhydrin-sodium citrate solution, and draw a standard curve with the absorbance at 600 nm. The method for determining gelatin degradation enzyme activity under pH 6.0-11.0 refers to the above process.

[0070] like Figure 3 The results show that the highest hydrolysis activity of enzymes KT124 and KT102 for gelatin is comparable, indicating that the 9-site mutation did not change the expression level of the enzyme. Enzyme KT102 hydrolyzes gelatin only under alkaline conditions. In the range of pH7.0-11.0, its degradation activity for gelatin increases with the increase of pH, reaching a maximum enzyme activity of 6822.56U / mL at pH11.0; while the degradation applicable conditions of enzyme mutant KT124 are expanded to pH6.0-12.0, reaching a maximum enzyme activity of 6786.56U / mL at pH10.0. In particular, at pH 6.0, enzyme mutant KT124 can still maintain a relative enzyme activity of 66.8%, which is 11.3 times that of the original enzyme KT102, indicating that the enzyme can degrade gelatin excellently under both neutral and alkaline conditions. At pH 7.0, pH 8.0, and pH 9.0, the enzyme activity of mutant KT124 increased to 4.17, 2.32, and 1.55 times that of KT102, respectively.

[0071] The above experimental results show that the protease mutant KT124 has a wider pH application range. During the degradation of collagen by protease, the pH of the reaction solution continues to decrease with the increase of the content of small molecular weight peptides or amino acids. In order to maintain a high degradation efficiency, the existing process requires the use of an alkaline solution to keep the pH constant, which not only makes the preparation process cumbersome, but also causes a certain degree of environmental pollution; the protease mutant KT124 of the present invention can degrade collagen under neutral and alkaline conditions at the same time, the amount of alkali used is greatly reduced, the enzymatic hydrolysis process is simple, and the production cost of collagen peptides is reduced. It has good economic and social benefits and is conducive to subsequent industrial application and promotion.

[0072] 3. Extraction rate of tilapia skin collagen

[0073] Crush the dried tilapia skin, add 2 times the volume of water, stir evenly, adjust the pH to 7.0-8.0, add 0.2‰ (w / w) lipase, stir and react at 30℃ for 1h to defat the fish skin. The reaction solution was heated to 100℃ and boiled for 20min to inactivate the lipase. After the reaction solution was cooled to 50-60℃, 2 times the volume of water was added and stirred evenly. Referring to the enzyme activity data of gelatin degradation, the initial pH of the reaction solution was adjusted to 12.0 with sodium hydroxide solution, 1‰ (w / w) of protease solution was added, and the reaction was stirred at 50℃ to obtain the collagen peptide aqueous solution prepared by enzyme KT102 and mutant KT124. During the enzymatic hydrolysis process, the pH of the reaction solution was maintained in the range of 6.0-12.0. Among them, the extraction rate of collagen in the enzymatic hydrolyzate was determined at 1h, 2h, 3h, 4h, and 5h of reaction, and the results are as follows Figure 4 shown.

[0074] 1) Protein content in tilapia skin

[0075] With reference to GB 5009.5-2016 “National Food Safety Standard Determination of Protein in Foods”, the total nitrogen content in tilapia skin collagen was determined by the Kjeldahl method.

[0076] 2) Hydroxyproline content in enzymatic hydrolysate

[0077] The hydroxyproline content in the enzymatic hydrolysate was determined by spectrophotometry.

[0078] Drawing of hydroxyproline standard curve: Accurately weigh L-hydroxyproline standard, dissolve in 0.01mol / L hydrochloric acid, dilute with distilled water to make a standard solution of 100mg / L. Take 1.0mL, 2.0mL, 2.5mL, 3.0mL, 3.5mL, 4.0mL, 4.5mL of hydroxyproline standard solution, and dilute to 100mL with distilled water respectively. Take 1mL of the above standard solution, add 1mL of citric acid buffer (pH 6.0) and 1mL of 0.05mol / L chloramine T solution respectively, and after oxidation reaction at room temperature (25℃) for 10min, add 1mL of perchloric acid solution and let stand for 10min. Add 1mL of p-dimethylaminobenzaldehyde colorimetric reagent, color in a 65℃ water bath for 10min, and cool to room temperature. Measure the absorbance at 560nm with a spectrophotometer. 1mL of distilled water is used as a blank control. The standard curve was drawn with the mass concentration of hydroxyproline as the horizontal axis and the absorbance as the vertical axis, and the regression equation was calculated as y = 0.5562x-0.0048 (R 2 =0.9996).

[0079] 3) Fish skin collagen extraction rate

[0080] The extraction rate of tilapia skin collagen is usually expressed on a dry basis and calculated from the hydroxyproline content in the enzymatic hydrolysate.

[0081] X% = A × dilution factor × 11.1 / m × 100

[0082] Wherein, X is the extraction rate of collagen from tilapia skin, %; A is the hydroxyproline content, g; 11.1 is the coefficient of converting hydroxyproline to collagen; and m is the total amount of protein from tilapia skin.

[0083] At 50℃, tilapia skin collagen will turn into soluble gelatin. Figure 4 It can be seen that as the enzymatic hydrolysis time increases, the extraction rate of collagen increases accordingly. After 3 hours of hydrolysis by enzyme KT102, the extraction rate of collagen was 75.17%; the extraction rate increased slowly after 3 hours, reaching 80.29% after 5 hours. After 3 hours of hydrolysis by enzyme KT124, the extraction rate of collagen was 84.07%, which was 20.36% higher than the original enzyme KT102; after 5 hours of enzymatic hydrolysis, the extraction rate reached 93.67%, which was 122.78% of the control enzyme KT102, and the preparation efficiency was significantly improved.

[0084] It can be seen from the above embodiments and experimental examples that the present invention mutates the existing serine protease to obtain a protease mutant, which has a wider pH applicable range, can enhance the collagen extraction rate, simplify the process, reduce the process cost, and has a good application prospect.

Claims

1. A serine protease mutant, characterized in that: The amino acid sequence of the serine protease mutant is shown in SEQ ID NO: 2, or has at least 90% identity with SEQ ID NO:

2.

2. A nucleic acid molecule encoding the serine protease mutant according to claim 1, characterized in that: The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO: 4, and the nucleic acid molecule is DNA, RNA or a chimera of the two.

3. A vector for expressing the serine protease mutant according to claim 1, characterized in that: It includes the nucleotide sequence shown in SEQ ID NO: 4 and a basic plasmid.

4. The carrier according to claim 3, characterized in that: The basic plasmid is selected from the group consisting of pET series, pQE series, pGEX series, pBAD series, pRS series, pBluescript series, pUC series, pBR series, pKT series, and pACYC series; preferably pKT101.

5. A genetically engineered bacterium for preparing a serine protease mutant, characterized in that: It is a chassis cell carrying the vector according to claim 3 or 4.

6. The genetically engineered bacterium according to claim 5, characterized in that: The chassis cells are selected from Bacillus subtilis, Bacillus licheniformis or Bacillus amyloliquefaciens; preferably Bacillus subtilis WB600.

7. A method for preparing a serine protease mutant, characterized in that: The method comprises the following steps: using the genetically engineered bacteria according to claim 5 or 6 to carry out fermentation, and collecting the fermentation liquid containing the serine protease mutant product.

8. Use of the serine protease mutant according to claim 1, the nucleic acid molecule according to claim 3, the vector according to claim 4 or 5, and the genetically engineered bacteria according to claim 6 or 7 for preparing collagen peptides.

9. A method for preparing collagen peptide, characterized in that: The method comprises the following steps: mixing the serine protease mutant according to claim 1 with raw materials, and performing degradation reaction to obtain the product.

10. The preparation method according to claim 9, characterized in that: The conditions of the degradation reaction include: pH is controlled at 6.0-12.0; And / or, the raw material is selected from collagen; And / or, the conditions of the degradation reaction include: a temperature of 50°C.

Images