Primer probe group and kit for quantitatively detecting BCR-ABL (P210) fusion gene and application

Abstract

The invention relates to the technical field of gene detection, in particular to a primer probe set for quantitatively detecting a BCR-ABL (P210) fusion gene, a kit and application. The primer probe set comprises a P210 primer probe set and an ABL primer probe set. The kit provided by the invention comprises the primer probe set, a PCR buffer set, a PCR reaction enzyme system, a quality control product and a standard product set. According to the kit, a real-time fluorescent quantitative PCR technology is adopted, RNA is extracted from a peripheral blood or bone marrow blood sample, quantitative detection of the BCR-ABL P210 fusion gene is conducted on the RNA, sensitivity is high, stability is good, meanwhile, the P210 fusion gene and the ABL gene are detected at the same time through a one-step method, and the kit is simpler and more time-saving.

Description

Technical Field

[0001] The present application belongs to the field of gene detection technology, and specifically relates to a primer probe set, a kit and an application for quantitatively detecting the BCR-ABL (P210) fusion gene. Background Art

[0002] Chronic myeloid leukemia (CML) is a malignant disease of hematopoietic stem cells characterized by myeloid proliferation. It is characterized by the production of a large number of immature white blood cells that accumulate in the bone marrow, inhibiting normal hematopoiesis of the bone marrow; and it can spread throughout the body through the blood, causing anemia, bleeding, infection and organ infiltration in patients.

[0003] CML is manifested at the molecular level as the ectopic fusion of the break cluster locus gene (BCR) on chromosome 22 and the proto-oncogene (ABL) on chromosome 9, forming the BCR-ABL fusion gene. According to the different breakpoints of the BCR gene, it can be divided into three types: M-BCR (p210), m-BCR (p190) and u-BCR (p230). Clinically, about 98% of CML cases have P210 mutations.

[0004] BCR-ABL (P210) fusion gene is the most important molecular marker of CML. Monitoring BCR-ABL fusion gene quantitative analysis during CML treatment is of great significance for the diagnosis of CML patients, drug selection and efficacy monitoring. Imatinib is the first tyrosine kinase inhibitor (TKI) developed for the key target molecule BCR-ABL fusion protein. At present, the molecular response of TKI drug treatment for 3, 6, 12 months and any time point thereafter has been included in the TKI response evaluation criteria of CML diagnosis and treatment recommendations or guidelines at home and abroad, and CML patients after treatment need to undergo regular BCR-ABL fusion gene monitoring. According to the "Chinese Diagnosis and Treatment Guidelines for Chronic Myeloid Leukemia" (2020 Edition), obtaining a sustained MR of more than 4.0 and lasting for more than 2 years is a prerequisite for the current treatment-free remission (TFR) discontinuation trial, and clinical applications require that at least MR 4.0 should be detectable.

[0005] Standardized BCR-ABL fusion gene detection is a prerequisite for accurately guiding clinical treatment. In order to achieve comparability of BCR-ABL fusion gene detection results, experts have proposed the concept of international standards, that is, to convert the BCR-ABL detection values ​​of each laboratory into international standard values ​​through CF. Therefore, there are higher requirements for the accuracy and sensitivity of monitoring the BCR ABL P210 transcript levels in CML patients. The molecular response is defined as the ratio of BCR ABL transcripts to ABL transcripts. The detection systems in various regions can obtain the correction coefficient after quantification through the international reference plate, and convert the results into international standardized units. The reference formula is

[0006] However, the commonly used BCR ABL fusion gene detection kits on the market have problems such as low sensitivity, poor stability, and non-specific amplification. Therefore, it is urgent to develop a kit with high sensitivity and good stability for quantitative detection of BCR-ABL (P210) fusion gene. Summary of the invention

[0007] In view of the above problems, the present application provides a primer probe set, a kit and an application for quantitatively detecting the BCR-ABL (P210) fusion gene. The kit of the present application uses a one-step method to simultaneously detect the P210 fusion gene and the ABL gene, thereby improving the specificity and sensitivity of the detection.

[0008] On the one hand, the present application provides a primer probe set for quantitatively detecting the BCR-ABL (P210) fusion gene, wherein the primer probe set includes a P210 primer probe set and an ABL primer probe set, wherein the P210 primer probe set includes primers and probes of the following nucleotide sequences, P210-F4:TCCGCTGACCATCAATAAGGA(SEQ ID NO.4) P210-R2:ACGAGCGGCTTCACTCAGAC(SEQ ID NO.6) P210-P3:CCCTTCAGCGGCCAGTAGCATCTGA(SEQ ID NO.9) The ABL primer-probe set includes primers and probes with the following nucleotide sequences: ABL-F3:CCAGAAGGCTGCCCAGAG(SEQ ID NO.12) ABL-R4:TGTTTCAAAGGCTTGGTGGATT(SEQ ID NO.16) ABL-P2:ACTCATGCGAGCATGTTGGCAGTGG (SEQ ID NO. 19).

[0009] By adopting the above technical solution, the present application simultaneously detects the BCR-ABL (P210) fusion gene and the ABL gene. Since the expression of the internal reference gene ABL in cells is relatively constant, it can not only be used to determine the proportion of the patient's fusion gene, but also be used for the quality control of the entire nucleic acid extraction and reaction system. Secondly, the present application improves the specificity and sensitivity of the detection by optimizing the nucleotide sequence of the primer probe group. The sensitivity BCR-ABL / ABL% (IS) is 0.01%, and the minimum detection limit is 5 copies / μL, and it can be stably detected, which fully meets clinical requirements.

[0010] In certain embodiments, the 5' end of the probes P210-P3 is labeled with a fluorescent emission group FAM, the 5' end of the probe ABL-P2 is labeled with a fluorescent emission group VIC, and the 3' ends of both probes are labeled with a non-fluorescent quenching group BHQ1.

[0011] By adopting the above technical solution, the present application realizes accurate quantification of P210 through fluorescent quantitative PCR, thereby further improving the accuracy of detection.

[0012] On the other hand, the present application also provides a kit for quantitatively detecting the BCR-ABL (P210) fusion gene, the kit comprising the primer probe set, PCR buffer set, PCR reaction enzyme system, quality control products and standard products.

[0013] In certain embodiments, the PCR reaction buffer comprises dNTP, magnesium ions, glycerol, Tris HCl and NaOH, and the PCR reaction enzyme system comprises Taq enzyme, RT enzyme and UNG enzyme.

[0014] By adopting the above technical scheme, in the detection qPCR system of the present application, the detection primer probe sets for P210 and ABL are added at the same time, so that all reactions are carried out in the same qPCR reaction system, the operation is relatively simple, the detection time is shorter, and there is no mutual interference, and the detection results are stable and accurate. At the same time, the reaction system introduces a dUTP / UNG enzyme anti-pollution system to eliminate the influence of the amplification product on the qPCR reaction.

[0015] In certain embodiments, the quality control products include a mixture of high-fusion ABL wild-type Armored RNA and BCR-ABL (P210) fusion Armored RNA (MR1.0), a mixture of low-fusion ABL wild-type Armored RNA and BCR-ABL (P210) fusion Armored RNA (MR3.0), and the concentrations of both are 10 4 copies / μL.

[0016] In certain embodiments, the sequence of the ABL wild-type Armored RNA is shown in SEQ ID NO.21, and the concentration is 1.74×10 12 copies / mL, the sequence of the BCR-ABL fusion Armored RNA is shown in SEQ ID NO.22, and the concentration is 1.95×10 12 copies / mL.

[0017] In certain embodiments, the ABL wild-type Armored RNA and the BCR-ABL (P210) fusion Armored RNA are serially diluted using a virus protection diluent to a final concentration of 2×10 6 copies / μL, 2×10 5 copies / μL, 2×10 4 copies / μL, 2×10 3 The calibrator was prepared by mixing ABL wild-type Armored RNA and BCR-ABL (P210) fusion Armored RNA in a 1:1 ratio.

[0018] The ABL wild-type Armored RNA calibrator and the BCR-ABL (P210) fusion Armored RNA calibrator were mixed at concentration ratios of 10:1, 100:1, 1000:1 and 10000:1 to obtain a standard.

[0019] By adopting the above technical scheme, the calibrators and quality control products contained in the kit of the present application are in the form of Armored RNA, which can be consistent with the standard product (RNA) of the China Inspection and Quarantine Institute at the nucleic acid level. By adding a protective diluent, the stability of the RNA can be improved and its amplification efficiency can be ensured.

[0020] On the other hand, the present application also provides a method for quantitatively detecting the BCR-ABL (P210) fusion gene for non-disease treatment and diagnosis purposes, wherein the method uses the primer probe set or the kit to detect the sample to be tested.

[0021] In some embodiments, the method comprises the following steps, Step S1, extracting RNA as a sample to be tested; Step S2, mixing the sample to be tested with the primer probe set, PCR reaction buffer, PCR reaction enzyme system and sterile water to perform PCR amplification; Step S3, judging the PCR amplification result.

[0022] In some embodiments, step S3 includes the following steps: Step S31, determine the baseline and threshold: select the section of the fluorescence curve with less fluctuation and more stability as the baseline. The threshold is set at the inflection point of the amplification curve and covers the highest point of the non-amplification curve and the negative control is not detected; Step S32, result positive and negative determination: first determine the negative quality control product: BCR-ABL (P210) and ABL have no fluorescence signal growth, no obvious S-shaped amplification curve; then determine the positive quality control product and calibration product: BCR-ABL (P210) and ABL have fluorescence signal growth, the curve is an S-shaped curve, the Ct value is ≤36, and the calibration product R 2 ≥0.97; judge the positive or negative of the sample under the above conditions; under the condition that the ABL channel VIC signal is between 22-24, if the FAM signal of the mutant detection well of the sample is ≤38, it is judged as positive; if the FAM signal is greater than 38, or "Undet" is displayed, it is judged as negative.

[0023] Step S33, fusion ratio determination: Use the standard curve generated by the detection calibrator to determine the copy numbers of the sample's fusion gene BCR-ABL (P210) and the internal reference gene ABL, and calculate the fusion ratio. The formula is: Where CF = 0.4792.

[0024] In summary, this application has the following technical effects: 1) First, the primer probe set designed in this application can simultaneously detect the BCR-ABL (P210) fusion gene and the ABL gene. Since the expression of the internal reference gene ABL in cells is relatively constant, it can not only be used to determine the proportion of the patient's fusion gene, but also for the quality control of the entire nucleic acid extraction and reaction system. Secondly, this application improves the specificity and sensitivity of the detection by optimizing the nucleotide sequence of the primer probe set. The sensitivity BCR-ABL / ABL% (IS) is 0.01%, and the minimum detection limit is 5 copies / μL, and it can be stably detected, which fully meets clinical requirements.

[0025] 2) The detection kit of the present application realizes the simultaneous addition of the detection primer probe set for P210 and ABL in the same qPCR reaction system. The operation is relatively simple, the detection time is shorter, and there is no mutual interference, and the detection results are stable and accurate. At the same time, the reaction system introduces a dUTP / UNG enzyme anti-pollution system to eliminate the influence of the amplification product on the qPCR reaction. The calibration and quality control products are in the form of Armored RNA. By adding a protective diluent, the stability of RNA can be improved and its amplification efficiency can be ensured.

[0026] 3) The kit of this application can be traced back to the standard product of the China National Institute for Inspection and Quarantine. Using the kit of this application, the fusion ratio of BCR-ABL (P210) can be directly calculated through the calculated CF value, without the need to purchase commercially available kits or China National Institute for Inspection and Quarantine standards for conversion. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 is the standard curve of BCR-ABL (P210) calibrator.

[0028] Figure 2 is the standard curve of ABL calibrator.

[0029] Figure 3 This is a linear relationship diagram between the actual value and theoretical value of the standard product of China National Institute for Inspection and Quarantine.

[0030] Figure 4 These are the results of fluorescence quantitative PCR testing of three positive samples in the kit accuracy test, where A, B, and C are positive samples 1-3, respectively.

[0031] Figure 5 This is the amplification graph of the detection results of negative samples of different concentrations in the kit-specific detection.

[0032] Figure 6 This is the amplification graph of the repeated detection of IS=0.01% reference sample in the kit sensitivity test. DETAILED DESCRIPTION

[0033] The present application is further described in detail below in conjunction with the accompanying drawings and examples. It is particularly noted that if no specific conditions are specified in the following examples, the experiments are carried out under conventional conditions or conditions recommended by the manufacturer. Unless otherwise specified, the raw materials used in the following examples can all be sourced from common commercial sources.

[0034] Example 1 Primer probe set design and screening The reference sequences of ABL and BCR-ABL fusion genes were retrieved and downloaded from the GeneBank database, and primer probes were designed around the appropriate positions of ABL and the break sites of the BCR-ABL gene. Multiple suitable primer probes were screened using software such as oligo 7 (as shown in Table 1). Fluorescence quantitative detection was performed on different primer probe pairs, and primer probe combinations with better amplification curves, high amplification efficiency, and sensitivity specificity were selected.

[0035] Table 1 Primer and probe sequences after design and screening Analysis of the results of the primers and probes designed by P210: The primers and probes designed by P210 were combined in pairs to construct the same fluorescence quantitative amplification system, and the amplification efficiency and non-specific amplification of different primer-probe combinations were investigated. The results showed that the amplification efficiency of the P210-F1,1,P1 combination, the P210-F2,R1,P1 combination, and the P210-F4,R2,P3 combination was between 95% and 102%, with the best amplification effect and an S-shaped amplification curve. The amplification efficiency of other primer-probe combinations was <90% or >105%, with low amplification efficiency, or the amplification curve did not show a standard S-shaped. The P210-F1,R1,P1 group and the P210-F2,R1,P1 group detected non-specific amplification in negative samples, so the P210 primer-probe group selected the P210-F4,R2,P3 combination, and its nucleotide sequences are shown in SEQ ID NO.4, SEQ ID NO.6, and SEQ ID NO.9, respectively.

[0036] Analysis of the results of the primers and probes designed by ABL: The primers and probes designed by ABL were combined in pairs to construct the same fluorescent quantitative amplification system, and the amplification efficiency and non-specific amplification of different primer-probe combinations were investigated. The results showed that the ABL-F3, R4, P2 combination had high amplification efficiency and good amplification effect. Therefore, the ABL primer-probe group selected the ABL-F3, R4, P2 combination, and its nucleotide sequences are shown in SEQ ID NO.12, SEQ ID NO.16 and SEQ ID NO.19, respectively.

[0037] This kit uses TaqMan fluorescent probe technology. The 5' end of the fusion gene BCR-ABL (P210) is labeled with the fluorescent emission group FAM, and the 5' end of the internal reference gene ABL is labeled with the fluorescent emission group VIC; the 3' end is labeled with the non-fluorescent quenching group BHQ1.

[0038] Example 2 Preparation of quality control products, calibrators and standard product sets (1) Positive quality control: Synthesis of Armored RNA: The BCR-ABL and ABL synthetic sequences were determined, and ABL wild-type Armored RNA and BCR ABL (P210) fusion Armored RNA were prepared by Sangon Biotechnology Co., Ltd.

[0039] The sequence of ABL wild-type Armored RNA is ABL-8-9 (243 bp), as shown in SEQ ID NO.21; the sequence of BCR-ABL fusion Armored RNA is e14a2 (502 bp), as shown in SEQ ID NO.22.

[0040] The quantitative results were: ABL wild-type Armored RNA was 1.95×10 12 copies / mL, BCR-ABL fusion Armored RNA was 1.74×10 12 copies / mL.

[0041] At the same time, the quality control products include a mixture of high-fusion ABL wild-type Armored RNA and BCR-ABL (P210) fusion Armored RNA (MR1.0), and a mixture of low-fusion ABL wild-type Armored RNA and BCR-ABL (P210) fusion Armored RNA (MR3.0), with a concentration of 10 4 copies / μL.

[0042] (2) Calibrators and standards: ABL wild-type Armored RNA and BCR-ABL (P210) fusion Armored RNA were diluted in a gradient manner using virus protection diluent to a final concentration of 2×10 6 copies / μL, 2×10 5 copies / μL, 2×10 4 copies / μL, 2×10 3 The calibrator was prepared by mixing ABL wild-type Armored RNA and BCR-ABL (P210) fusion Armored RNA in a 1:1 ratio.

[0043] The ABL wild-type Armored RNA calibrator and the BCR-ABL (P210) fusion Armored RNA calibrator were mixed at concentration ratios of 10:1, 100:1, 1000:1 and 10000:1 to obtain a standard.

[0044] (3) Preparation of standard product traceability and CF value calculation The calibrators, prepared standards and CNIC standard were amplified to construct a standard curve of the cycle number and copy number of the calibrators. Then, a linear relationship curve between the actual detection value and the theoretical value of the CNIC standard and the prepared standard was established. The CF value was calculated based on the curve parameters. The process is as follows.

[0045] Take out the standard product of the China National Institute for Inspection and Quarantine (National Standard Product for BCR-ABL fusion gene detection, No.: 360071, Batch No.: 360071-202301) for RNA extraction, detect and record the concentration of RNA (ng / μL). Divide the RNA into two tubes, one tube for detection on the same day, and the other tube for detection on the second day. During the detection, each sample was tested three times, and the copy number of the BCR-ABL1 fusion gene and the ABL1 reference gene was recorded and the fusion ratio (BCR-ABL1 / ABL1%) was calculated. According to the average detection value concentration of the standard product of the China National Institute for Inspection and Quarantine and the given labeled concentration, a linear regression analysis was performed to obtain the conversion factor CF. The specific calculation method is as follows: Log 10 (% of the labeled concentration of the standard product of the China National Institute of Inspection and Quarantine) is the horizontal axis, and the log 10 The linear regression analysis was performed with (the average detection value concentration of the standard product of the China Inspection Institute in %) as the ordinate, and the linear regression formula y=ax+b and R 2 The value satisfies the 95% confidence interval of slope a in the range of [0.83,1.20], R 2 >0.97, the conversion factor CF=10 -b , and finally assign a value to the prepared standard, which is the theoretical value * CF value.

[0046] The standard curve of BCR-ABL (P210) calibrator is as follows Figure 1 The standard curve of ABL calibrator is shown in Figure 2 As shown in the figure, it can be seen that the standard curve has a good linear relationship (R 2 The amplification efficiencies were high (Eff% were 100.231 and 102.296, respectively), and could be used for precise quantification.

[0047] At the same time, the linear relationship between the actual value and theoretical value of the standard product of the China Inspection Institute is as follows Figure 3 As shown in the figure, it can be seen that R 2 =0.9915, slope =0.9926, intercept =0.3195, good linear relationship, linear formula conversion factor (CF) =0.4792.

[0048] (4) Calculation of the actual fusion ratio of the prepared standard product, as shown in Table 2.

[0049] Table 2 Calculation results of actual fusion ratio of prepared standard products The actual fusion ratios of the prepared standards calculated according to the CF values ​​detected by this kit were 8.0666%, 3.9625%, 0.3731%, 0.0309% and 0.0060%, respectively.

[0050] Example 3 P210 quantitative detection kit A P210 quantitative detection kit was prepared using the primer probe set screened and obtained in Example 1 and the quality control product and calibrator set prepared in Example 2. The kit includes the following components.

[0051] 1) Primer and probe set obtained in Example 1 The specific primers and probes of this kit are as follows (5'-3'): P210-F4:TCCGCTGACCATCAATAAGGA(SEQ ID NO.4) P210-R2:ACGAGCGGCTTCACTCAGAC(SEQ ID NO.6) P210-P3-FAM:CCCTTCAGCGGCCAGTAGCATCTGA(SEQ ID NO.9) ABL-F3:CCAGAAGGCTGCCCAGAG(SEQ ID NO.12) ABL-R4:TGTTTCAAAGGCTTGGTGGATT(SEQ ID NO.16) ABL-P2-VIC:ACTCATGCGAGCATGTTGGCAGTGG (SEQ ID NO. 19).

[0052] This kit uses TaqMan fluorescent probe technology. The 5' end of the fusion gene BCR-ABL (P210) probe is labeled with the fluorescent emission group FAM, and the 5' end of the internal reference gene ABL probe is labeled with the fluorescent emission group VIC. At the same time, the 3' ends of both probes are labeled with the non-fluorescent quenching group BHQ1. The concentration of each primer is 10μM.

[0053] 2) PCR reaction buffer and PCR reaction enzyme system This kit contains PCR reaction buffer and reaction enzyme system. The PCR reaction buffer contains dNTP 2.5mM, magnesium ion 3mM, glycerol 5%, Tris HCl 40mM, etc.; the PCR reaction enzyme system contains Taq enzyme, RT enzyme and UNG enzyme, with a concentration of 1U / 25uL.

[0054] 1. Quality control products and calibration products obtained in Example 2 The quality control products included in this kit are: a mixture of high-fusion ABL wild-type Armored RNA and BCR-ABL (P210) fusion Armored RNA (MR1.0), and a mixture of low-fusion ABL wild-type Armored RNA and BCR-ABL (P210) fusion Armored RNA (MR3.0), both at a concentration of 104 copies / μL.

[0055] Calibrators included in this kit: ABL wild-type Armored RNA and BCR-ABL (P210) fusion Armored RNA gradient dilution mixture, the concentrations of which are 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL.

[0056] Example 4 Method for quantitative detection of P210 by kit 1. Sample processing (1) Sample collection, transportation and storage Sample collection: Draw 10 mL of peripheral blood or bone marrow blood from patients or healthy people, inject it into a blood collection tube containing EDTA anticoagulant, immediately invert gently for 5 to 10 times to mix, and seal it.

[0057] (2) Sample storage and transportation: It is best to extract the samples immediately and store them at 2-8°C for no more than 5 days. Alternatively, use red blood cell lysis buffer to obtain nucleated cell pellets and add 1 mL of RNA extraction solution or cell preservation solution. Vortex to mix and store at -70±10°C for 1 month. Avoid repeated freezing and thawing.

[0058] (3) Sample transportation: around 4°C.

[0059] (4) Extraction of sample RNA: Whole blood RNA extraction kit (Tiangen) was used to extract human peripheral blood or bone marrow blood RNA, and the nucleic acid concentration and purity were detected by micro-spectrophotometer (OD260 / OD280 ratio was between 1.8-2.0), and then the RNA template for the experiment was diluted to 50ng / μL. The details are as follows: 1) Add 5 mL of 1x RBC Lysis Buffer to 1 mL of blood and mix by inversion 5-10 times. Place on ice for 10-15 minutes, inverting and mixing twice, and observe whether the blood is clear and transparent.

[0060] 2) Centrifuge at 4°C, 2100 rpm for 10 min and carefully discard the supernatant.

[0061] 3) Add 3 mL of 1x RBC Lysis Buffer and vortex briefly to resuspend the cells.

[0062] 4) Centrifuge at 2100 rpm for 10 min at 4°C.

[0063] 5) Discard the supernatant and add 600 μL of lysis buffer RL, pipetting repeatedly.

[0064] 6) Add one volume of isopropanol and 40 μL of magnetic bead suspension W, and mix on an oscillator for 5 minutes to allow the magnetic beads to adsorb RNA.

[0065] 7) Place the centrifuge tube on the magnetic rack and let it stand for 3 minutes. After the magnetic beads are completely adsorbed, carefully aspirate and discard the liquid.

[0066] 8) Remove the centrifuge tube from the magnetic rack, add 900 μL of deproteinization solution RD, and shake to mix for 2 minutes.

[0067] 9) Place the centrifuge tube on the magnetic rack and let it stand for 3 minutes. After the magnetic beads are completely adsorbed, carefully aspirate and discard the liquid. Dry at room temperature for 5 minutes and then digest with DNase I for 15 minutes.

[0068] 10) Add 700 μL of deproteinized solution RD and mix on an oscillator for 5 min.

[0069] 11) Place the centrifuge tube on the magnetic rack and let it stand for 3 minutes. After the magnetic beads are completely adsorbed, carefully aspirate and discard the liquid.

[0070] 12) Remove the centrifuge tube from the magnetic rack, add 700 μL of rinse solution RW, and mix on an oscillator for 2 minutes.

[0071] 13) Place the centrifuge tube on the magnetic rack and let it stand for 3 minutes. After the magnetic beads are completely adsorbed, carefully aspirate and discard the liquid.

[0072] 14) Repeat steps 12) and 13) once.

[0073] 15) Briefly centrifuge to collect the residual solution at the bottom of the tube, place the centrifuge tube on a magnetic rack, aspirate all the liquid and discard it, and let it air dry at room temperature for 5 minutes.

[0074] 16) Remove the centrifuge tube from the magnetic stand and add 50 μL RNase-Free dd H 2 O, and heated and eluted on a 60°C magnetic rack for 5 min.

[0075] 17) Place the centrifuge tube on the magnetic rack and let it stand for 3 minutes. After the magnetic beads are completely adsorbed, carefully transfer the RNA solution to a clean centrifuge tube.

[0076] 18) Determine the sample concentration and purity (OD260 / OD280 ratio between 1.8-2.0) using a micro-spectrophotometer and dilute it to 50 ng / μL.

[0077] 2. Configure the reaction system The concentration of primer probe was determined by micro-ultraviolet spectrophotometer, and the concentration used in the system was 10 μM. When testing samples, the calibrators and quality control products in the kit were tested at the same time. The system preparation is shown in Table 3.

[0078] Table 3 Reaction system 3. Amplification Procedure After preparing multiple reaction systems, the tubes were capped, mixed and centrifuged, and the systems were amplified using the ABI 7500 real-time fluorescence quantitative PCR system. The amplification program is shown in Table 4.

[0079] Table 4 Amplification procedures 4. Interpretation of results 1) Determine baseline and threshold: The section of the fluorescence curve with less fluctuation and more stability was selected as the baseline. The threshold was set at the inflection point of the amplification curve and covered the highest point of the non-amplification curve and the negative control was not detected.

[0080] 2) Determination of positive and negative results First determine the negative control product: BCR-ABL (P210) and ABL have no fluorescence signal growth, and no obvious S-shaped amplification curve.

[0081] Then judge the positive quality control and calibration products: BCR-ABL (P210) and ABL have increased fluorescence signals, the curve is an S-shaped curve, the Ct value is ≤36, and the calibration product R2≧0.97.

[0082] The positive and negative of the sample is determined under the above conditions. Under the condition that the VIC signal of the ABL channel is between 22-24, if the FAM signal of the mutant detection well of the sample is ≤38, it is judged as positive; if the FAM signal is greater than 38, or "Undet" is displayed, it is judged as negative.

[0083] 3) Determination of fusion ratio The standard curve generated by the detection calibrator was used to determine the copy number of the sample's fusion gene BCR-ABL (P210) and the internal reference gene ABL, and the fusion ratio was calculated using the formula: Where CF = 0.4792.

[0084] Performance testing Effect Example 1 Kit Accuracy Test Three positive samples with known fusion ratios verified by the hospital were selected, and the negative samples were diluted to fusion ratios of 10%, 1%, 0.1% and 0.01%, respectively. Two replicates were set for each concentration, and the fluorescence quantitative PCR test was performed using the method of Example 3. The accuracy was determined by the positive coincidence rate. The sample loading was 250 ng. The fluorescence test results are shown in Table 3. Figure 1 .

[0085] As can be seen from the figure, the four fusion ratios of different sample gradient dilutions can be effectively detected, and the results are all positive (Ct value ≤ 38), and the positive coincidence rate is 100%.

[0086] Effect Example 2 Kit Specificity Detection Fluorescence quantitative PCR was performed on samples that were confirmed to be negative by clinical testing. Eight negative samples with different concentrations were selected, and the specificity of the kit was determined by the negative coincidence rate. The fluorescence test results are shown in Figure 2 .

[0087] As can be seen from the figure, the results of measuring negative samples of different concentrations were all negative (Ct value>38), and the negative coincidence rate was 100%.

[0088] Effect Example 3 Kit Sensitivity Test According to the "Chinese Diagnosis and Treatment Guidelines for Chronic Myeloid Leukemia" (2020 edition), obtaining a sustained MR of 4.0 (ie, IS = 0.01%) or more for more than 2 years is a prerequisite for the current Treatment Free Remission (TFR) withdrawal trial. Clinical applications require that at least MR 4.0 (IS = 0.01%) should be detectable. This experiment tested reference materials traced back to the standards of the China National Institute for Inspection and Quarantine, and could stably detect reference materials with IS = 0.01%. The minimum detection limit was 5 copies / μL, and it could be stably detected, fully meeting clinical requirements.

[0089] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make modifications to the present embodiment without any creative contribution as needed, but such modifications are protected by the patent law as long as they are within the scope of the claims of the present application.

Claims

1. A primer probe set for quantitative detection of BCR-ABL (P210) fusion gene, characterized in that: The primer probe set includes a P210 primer probe set and an ABL primer probe set, and the P210 primer probe set includes primers and probes of the following nucleotide sequences: P210-F4:TCCGCTGACCATCAATAAGGA(SEQ ID NO.4) P210-R2:ACGAGCGGCTTCACTCAGAC(SEQ ID NO.6) P210-P3:CCCTTCAGCGGCCAGTAGCATCTGA(SEQ ID NO.9) The ABL primer-probe set includes primers and probes with the following nucleotide sequences: ABL-F3:CCAGAAGGCTGCCCAGAG(SEQ ID NO.12) ABL-R4:TGTTTCAAAGGCTTGGTGGATT(SEQ ID NO.16) ABL-P2:ACTCATGCGAGCATGTTGGCAGTGG (SEQ ID NO. 19).

2. The primer probe set according to claim 1, characterized in that: The 5' end of the probe P210-P3 is labeled with a fluorescent emission group FAM, the 5' end of the probe ABL-P2 is labeled with a fluorescent emission group VIC, and the 3' ends of the two probes are both labeled with a non-fluorescent quenching group BHQ1.

3. A kit for quantitatively detecting BCR-ABL (P210) fusion gene, characterized in that: The kit comprises the primer probe set according to claim 1 or 2, a PCR reaction buffer, a PCR reaction enzyme system, a quality control product and a standard product set.

4. The kit according to claim 3, characterized in that The PCR reaction buffer comprises dNTP, magnesium ions, glycerol, Tris HCl and NaOH, and the PCR reaction enzyme system comprises Taq enzyme, RT enzyme and UNG enzyme.

5. The kit according to claim 3, characterized in that The quality control products include a mixture of high-fusion ABL wild-type Armored RNA and BCR-ABL (P210) fusion Armored RNA (MR1.0), and a mixture of low-fusion ABL wild-type Armored RNA and BCR-ABL (P210) fusion Armored RNA (MR3.0), with a concentration of 10 4 copies / μL.

6. The kit according to claim 3, characterized in that The sequence of the ABL wild-type Armored RNA is shown in SEQ ID NO.21, and the concentration is 1.95×10 12 copies / mL, the sequence of the BCR-ABL fusion Armored RNA is shown in SEQ ID NO.22, and the concentration is 1.74×10 12 copies / mL.

7. A method for quantitatively detecting BCR-ABL (P210) fusion gene for non-disease diagnosis and treatment purposes, characterized in that: The method uses the primer probe set described in any one of claims 1-2 or the kit described in any one of claims 3-6 to detect the sample to be tested.

8. The method according to claim 7, characterized in that The method comprises the following steps, Step S1, extracting RNA as a sample to be tested; Step S2, mixing the sample to be tested with the primer probe set, PCR reaction buffer, PCR reaction enzyme system and sterile water to perform PCR amplification; Step S3, judging the PCR amplification result.

9. The method according to claim 8, characterized in that The step S3 comprises the following steps: Step S31, determine the baseline and threshold: select the section of the fluorescence curve with less fluctuation and more stability as the baseline. The threshold is set at the inflection point of the amplification curve and covers the highest point of the non-amplification curve and the negative control is not detected; Step S32, result positive or negative determination: First, determine the negative quality control: BCR-ABL (P210) and ABL have no fluorescence signal growth, and no obvious S-shaped amplification curve; then determine the positive quality control and calibration: BCR-ABL (P210) and ABL have fluorescence signal growth, the curve is S-shaped, the Ct value is ≤36, and the calibration product R 2 ≥0.97; judge the positive or negative of the sample under the above conditions; under the condition that the VIC signal of the ABL channel is between 22-24, if the FAM signal of the mutant detection well of the sample is ≤38, it is judged as positive; if the FAM signal is greater than 38, or "Undet" is displayed, it is judged as negative; Step S33, fusion ratio determination: Use the standard curve generated by the detection calibrator to determine the copy numbers of the sample's fusion gene BCR-ABL (P210) and the internal reference gene ABL, and calculate the fusion ratio. The formula is: Where CF = 0.4792.

Images