Novel schizochytrium sp. Strain and method for producing omega-3-containing oil using same

Abstract

The Schizochytrium sp. Strain of the present invention is a high bio-oil-producing microalgae containing a high concentration of DHA, has high bio-oil productivity due to the high crude fat content in the produced biomass, and has the characteristic of containing a high content of docosahexaenoic acid in cells. Thus, the strain itself, biomass produced by culturing and fermenting the strain, and concentrates and extracts thereof can be advantageously used as a feed composition or a food composition.

Description

Technical Field

[0001] Cross - reference to related applications

[0002] This application claims the benefit of priority based on Korean Patent Application No. 10-2022-0175630, filed on December 15, 2022, and the entire contents disclosed in the corresponding Korean patent application are incorporated as part of this specification.

[0003] This application relates to a new Schizochytrium sp. strain containing high intracellular docosahexaenoic acid and a method for producing ω-3-containing oil using the same. Background Art

[0004] Thraustochytrids survive and distribute in various environments in nature. They attach to organisms and live symbiotically, or float in marine environments or fresh or brackish water environments, and are distributed and survive in various sedimentary strata. Such thraustochytrids belong to the lowest level of the marine ecological food chain and are also classified as organic heterotrophic protist microalgae as phytoplankton. Thraustochytrids play a role in the circulation and purification of natural cycle elements such as sulfur, nitrogen, phosphorus, potassium, etc. in the natural environment. In addition, they are a source of the marine ecosystem by containing high concentrations of polyunsaturated fatty acids (PUFAs) classified as ω-3 (including docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA)).

[0005] Most higher organisms (including humans) cannot synthesize polyunsaturated fatty acids including docosahexaenoic acid and eicosapentaenoic acid by themselves, so they should be ingested as essential nutrients. Docosahexaenoic acid and eicosapentaenoic acid in polyunsaturated fatty acids are essential fatty acids for the brain, eye tissues, and nervous system, and are particularly known to play important functions in the development of the nervous system (such as the visual and motor nerve functions of infants, etc.) and the prevention of cardiovascular diseases, and they are the most abundant components in the structural lipids of the brain.

[0006] So far, the main source of polyunsaturated fatty acids has been fish oil extracted from the oil of blue fish (such as mackerel, saury, tuna, jack mackerel, sardine, herring, etc.), which is also very useful as fish farming feed (such as initial feed for marine fish). The extraction and ingestion of polyunsaturated fatty acids from fish oil have been industrially developed, but there are also disadvantages. The quality of fish oil varies depending on the species of fish, season, and fishing location, and it is produced by fishing, so there are difficulties in continuous supply. In addition, due to problems such as pollution by heavy metals and organic chemicals contained in fish oil, the problem of double bond oxidation during the processing process, and the unique fishy smell of fish oil, there are limitations in the manufacturing process and production.

[0007] To solve such problems, methods for producing polyunsaturated fatty acids including docosahexaenoic acid and eicosapentaenoic acid by microbial culture have been studied recently. In particular, microalgae offer various advantages compared to fish oil in addition to the ability to newly synthesize fatty acids naturally. It can be stably supplied through industrial-scale cultivation and enables the production of biomass with a relatively constant biochemical composition. Unlike fish oil, the lipids produced by microalgae do not have any unpleasant odor. In addition, it has a simpler composition compared to fish oil, and this makes it easier to isolate the main fatty acids.

[0008] Based on these advantages, research on using microalgae to produce polyunsaturated fatty acids including ω-3 unsaturated fatty acids such as docosahexaenoic acid (DHA), eicosapentaenoic acid (EPA), arachidonic acid (ARA), docosapentaenoic acid (DPA), and α-linolenic acid has made very rapid progress recently, and it is mainly through Thraustochytrium sp. and Schizochytrium microorganisms (which are types of marine microalgae) to produce polyunsaturated fatty acids. For example, methods for producing ω-3 polyunsaturated fatty acids using Schizochytrium sp. ATCC20888 and Schizochytrium sp. PTA10208 (which are Schizochytrium microorganisms) have been disclosed (U.S. Patent No. 5,130,242), and additionally, methods for producing docosahexaenoic acid and eicosapentaenoic acid using Thraustochytrium sp. PTA10212 (which is a Thraustochytrium microorganism based on Thraustochytrium) have been disclosed.

[0009] Prior Art

[0010] Patent Literature

[0011] (Patent Literature 1) U.S. Patent Publication US 5130242 A Summary of the Invention

[0012] Technical Problem

[0013] One embodiment of the present application provides a new Schizochytrium microalgae. In a specific embodiment, the new Schizochytrium microalgae can be Schizochytrium sp. CD01-1003 strain, which is a microalgae deposited under the deposit number KCTC15201BP and produces bio-oil containing a high concentration of DHA (docosahexaenoic acid, 22:6).

[0014] Another embodiment of the present application provides a microbial product (preparation) for producing DHA (docosahexaenoic acid, 22:6), which contains the Schizochytrium strain or its culture solution as an active ingredient.

[0015] Other embodiments of the present application provide biomass derived from the Schizochytrium strain, including the Schizochytrium strain, the culture solution of the strain, the dry matter of the culture solution, or the lysate of the dry matter.

[0016] Other embodiments of the present application provide a feed composition or a food composition, which comprises biomass derived from the Schizochytrium strain or a concentrate, dry matter, or extract of the biomass.

[0017] Other embodiments of the present application provide a method for producing biomass or bio-oil derived from the Schizochytrium strain.

[0018] Technical solutions

[0019] Each description and embodiment disclosed in the present application can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in the present application fall within the scope of the present application. In addition, the scope of the present application should not be considered limited to the specific descriptions described below. In addition, those skilled in the art can identify or confirm many equivalents of the specific embodiments of the present application disclosed in the present application only by using ordinary experiments. In addition, these equivalents are intended to be included in the present application.

[0020] One embodiment of the present application provides a new Schizochytrium microalgae.

[0021] The term "Schizochytrium sp." used in this specification is a genus name belonging to the Thraustochytriaceae family of the Thraustochytriales order, and can be used interchangeably with the term "genus Schizochytrium". In addition, the term "microalgae" refers to an organism that is invisible to the naked eye and can only be seen with a microscope, and lives freely floating in water, belongs to plants that carry out photosynthesis with chlorophyll, and can also be called phytoplankton.

[0022] The new Schizochytrium strain can be a mutant strain obtained by mutating a Schizochytrium strain as a parent strain, and can be a strain with enhanced productivity of bio-oil and / or DHA compared to the parent strain.

[0023] The term "parent strain" used in this specification refers to the strain before mutagenesis, and can be used interchangeably with the "wild-type strain".

[0024] The parent strain can be a wild-type Schizochytrium strain, and specifically, can be the wild-type Schizochytrium CD01-1821 strain, but is not limited thereto.

[0025] The term "productivity" as used in this specification refers to the ability to produce bio-oil or DHA (docosahexaenoic acid, 22:6), and can be used interchangeably with "production capacity", and can be confirmed by measuring the content of bio-oil or DHA contained in the culture broth or the biomass derived from the strain after culturing the strain that produces bio-oil or DHA.

[0026] The method of mutation can be carried out by various means known in the art, and one method of physical or chemical mutagenesis can be used. For example, as a physical mutation method applicable to the present invention, a method for γ-ray or ultraviolet radiation can be used, but is not limited thereto. In addition, as a chemical mutation method, N-methyl-N'-nitro-N-nitrosoguanidine (NTG), diepoxybutane, ethyl methanesulfonate, mustard compounds, hydrazine, and nitrous acid can be used, but are not limited thereto.

[0027] The mutation for generating a mutant strain can be by a method for radiation.

[0028] The radiation for inducing mutation can be γ-ray or ultraviolet ray, and preferably γ-ray.

[0029] The radiation can be 6.0 kGy to 8.0 kGy, 6.5 kGy to 8.0 kGy, 6.7 kGy to 8.0 kGy, 6.9 kGy to 8.0 kGy, 6.5 kGy to 7.5 kGy, 6.7 kGy to 7.5 kGy, 6.9 kGy to 7.5 kGy, 6.5 kGy to 7.3 kGy, 6.7 kGy to 7.3 kGy, 6.9 kGy to 7.3 kGy, 6.5 kGy to 7.1 kGy, 6.7 kGy to 7.1 kGy, 6.9 kGy to 7.1 kGy, or 7.0 kGy per hour.

[0030] In this application, as an embodiment, the mutation is generated by γ-ray irradiation on the wild-type Schizochytrium sp. CD01-1821 strain, and among the mutant strains, there is a strain with enhanced productivity of oil containing polyunsaturated fatty acids, and it is named Schizochytrium sp. CD01-1003, and was deposited with the international depository authority Korea Research Institute of Bioscience and Biotechnology Korea Collection for Type Culture (KCTC) according to the Budapest Treaty on November 21, 2022, and was given the deposit number KCTC15201BP.

[0031] Therefore, in this specification, the new Schizochytrium microalgae can be the Schizochytrium sp. CD01-1003 strain, which is a microalgae deposited under the accession number KCTC15201BP.

[0032] In addition, the wild-type Schizochytrium strain may have the 18s rRNA nucleotide sequence of SEQ ID NO:1, but is not limited thereto. For example, the Schizochytrium microalgae may have 18S rRNA consisting of a nucleotide sequence having 80% or higher, 85% or higher, 90% or higher, 95% or higher, 98% or higher, or 99% or higher sequence identity with the nucleotide sequence of SEQ ID NO:1, but is not limited thereto.

[0033] The genomic DNA of the Schizochytrium sp. CD01-1003 strain can be genomic DNA that has 36 nucleotides deleted from the genomic DNA of the Schizochytrium sp. CD01-1821 strain (which is the parental strain).

[0034] The genomic DNA of the Schizochytrium sp. CD01-1003 strain may contain a nucleotide sequence having 36 nucleotides deleted from the nucleotide sequence of SEQ ID NO:4 of the Schizochytrium sp. CD01-1821 strain (which is the parental strain).

[0035] The nucleotide sequence having 36 nucleotides deleted from the nucleotide sequence of SEQ ID NO:4 may consist of SEQ ID NO:5.

[0036] The Schizochytrium sp. CD01-1003 strain can be identified using a primer set consisting of the nucleotide sequences of SEQ ID NO:6 and SEQ ID NO:7.

[0037] In a specific embodiment of the present invention, by comparing the complete genomic sequences of the new Schizochytrium mutant strain and the parental strain of the present invention, it was confirmed that the Schizochytrium sp. CD01-1003 strain has a portion in which 36 bp of nucleotides are deleted from the genome of the wild-type CD01-1821 strain (which is the parental strain), and by PCR using a primer set capable of amplifying a DNA fragment containing the corresponding portion, it was confirmed that the parental strain, the wild-type strain, and the Schizochytrium sp. CD01-1003 strain can be identified (distinguished).

[0038] Therefore, a primer set consisting of the nucleotide sequences of SEQ ID NO:6 and SEQ ID NO:7 and capable of amplifying a DNA fragment containing a nucleotide sequence having 36 nucleotides deleted from the nucleotide sequence of SEQ ID NO:4 can be used for the purpose of selecting the Schizochytrium sp. CD01-1003 strain.

[0039] The term "docosahexaenoic acid (DHA)" used in this specification is a polyunsaturated fatty acid that has a chemical formula of C 22 H 32 O 2 , corresponds to omega-3 fatty acids together with alpha-linolenic acid (ALA) and eicosapentaenoic acid (EPA), has the common name cervonic acid, and can be represented by the abbreviation 22:6n-3.

[0040] This new Schizochytrium strain can produce a bio-oil containing a high concentration of DHA (docosahexaenoic acid, 22:6).

[0041] This Schizochytrium microalgae can produce and / or contain 25 wt% or more, 28 wt% or more, 30 wt% or more of DHA based on the total weight of fatty acids. For example, this Schizochytrium microalgae can produce and / or contain 25 to 50 wt%, 25 to 45 wt%, 25 to 40 wt%, 25 to 35 wt%, 28 to 50 wt%, 28 to 45 wt%, 28 to 40 wt%, 28 to 35 wt%, 28 to 34 wt%, 28 to 33 wt%, 28 to 32 wt%, 28 to 31 wt%, 30 to 50 wt%, 30 to 45 wt%, 30 to 40 wt%, 30 to 35 wt%, 30 to 34 wt%, 30 to 33 wt%, 30 to 32 wt% or 30 to 31 wt% of DHA.

[0042] The productivity of the bio-oil of this Schizochytrium microalgae can be 44 to 54 g / L / day, 45 to 54 g / L / day, 46 to 54 g / L / day, 47 to 54 g / L / day, 44 to 53 g / L / day, 45 to 53 g / L / day, 46 to 53 g / L / day, 47 to 53 g / L / day, 44 to 52 g / L / day, 45 to 52 g / L / day, 46 to 52 g / L / day, 47 to 52 g / L / day, 44 to 51 g / L / day, 45 to 51 g / L / day, 46 to 51 g / L / day, 47 to 51 g / L / day, 44 to 50 g / L / day, 45 to 50 g / L / day, 46 to 50 g / L / day, 47 to 50 g / L / day, 44 to 49 g / L / day, 45 to 49 g / L / day, 46 to 49 g / L / day, 47 to 49 g / L / day, 44 to 48 g / L / day, 45 to 48 g / L / day, 46 to 48 g / L / day or 47 to 48 g / L / day.

[0043] The productivity of DHA of the Schizochytrium microalgae can be 12.5 to 16.5 g / L / day, 13 to 16.5 g / L / day, 13.5 to 16.5 g / L / day, 14 to 16.5 g / L / day, 14.5 to 16.5 g / L / day, 12.5 to 16 g / L / day, 13 to 16 g / L / day, 13.5 to 16 g / L / day, 14 to 16 g / L / day, 14.5 to 16 g / L / day, 12.5 to 15.5 g / L / day, 13 to 15.5 g / L / day, 13.5 to 15.5 g / L / day, 14 to 15.5 g / L / day, 14.5 to 15.5 g / L / day, 12.5 to 15 g / L / day, 13 to 15 g / L / day, 13.5 to 15 g / L / day, 14 to 15 g / L / day or 14.5 to 15 g / L / day.

[0044] Another aspect of the present application provides a microbial product (preparation) for producing DHA (docosahexaenoic acid, 22:6), which contains the Schizochytrium strain or its culture solution as an active ingredient.

[0045] The microbial product (preparation) may contain the Schizochytrium sp. CD01-1003 strain as an active ingredient and can be effectively used for producing DHA.

[0046] Other aspects of the present application provide biomass or bio-oil derived from Schizochytrium strains, which contain the Schizochytrium strain, the culture of the strain, the dry matter of the culture, or the lysate of the dry matter.

[0047] The essence of the Schizochytrium strain is the same as described above.

[0048] The term "biomass" used in this specification refers to an organism, such as a plant, an animal, a microorganism, etc., which can be used as an energy source of chemical energy, i.e., bioenergy, and ecologically also represents the weight or energy amount of a specific organism existing in a unit time and space. In addition, biomass includes compounds secreted by cells, but is not limited thereto, and may contain cells and / or intracellular inclusions and extracellular substances. In the present application, the biomass may be a product produced by culturing or fermenting the Schizochytrium strain itself, its culture, its dry matter, its lysate, or microalgae, or may be a concentrate or dry matter of biomass, but is not limited thereto.

[0049] The "culture" of Schizochytrium microalgae refers to the product produced by culturing the microalgae, and specifically, it can be the culture solution containing the microalgae or the culture filtrate from which the microalgae are removed from the culture solution, but is not limited thereto. The "dry matter" of the Schizochytrium microalgae culture can be the culture from which water is removed from the microalgae culture, and for example, it can be in the form of dry microbial cells of the microalgae, but is not limited thereto. In addition, "lysate" collectively refers to the result of lysing the dry matter from which water is removed from the microalgae culture, and for example, it can be dry microbial cell powder, but is not limited thereto. The culture of Schizochytrium microalgae can be produced by inoculating the microalgae in a microalgae culture medium according to the culture methods known in the art, and the dry matter of the culture and its lysate can also be produced according to the processing or drying methods of microalgae or culture solutions known in the art.

[0050] The biomass derived from Schizochytrium microalgae may contain 61 to 85% by weight, 61 to 80% by weight, 61 to 75% by weight, 61 to 72% by weight, 65 to 85% by weight, 65 to 80% by weight, 65 to 75% by weight, 65 to 72% by weight, 68 to 85% by weight, 68 to 80% by weight, 68 to 75% by weight, 68 to 72% by weight, 70 to 85% by weight, 70 to 80% by weight, 70 to 75% by weight or 70 to 72% by weight of crude fat based on the total weight of the biomass.

[0051] The term "crude fat content" used in this specification may refer to the content of oil in the cells and may be used interchangeably with "crude fat amount" or "total lipid" or "total fatty acid" or "TFA" or "oil content".

[0052] In a specific embodiment of the present invention, the Schizochytrium sp. CD01-1003 strain or the biomass derived from the Schizochytrium sp. CD01-1003 strain has a high crude fat content, so they are suitable for oil production, and therefore the Schizochytrium sp. CD01-1003 strain may have a high oil productivity.

[0053] Biomass derived from the Schizochytrium sp. strain CD01-1003 may contain 25% by weight or more, 28% by weight or more, 30% by weight or more of DHA based on the total weight of fatty acids. For example, the Schizochytrium sp. microalgae may contain 25 to 50% by weight, 25 to 45% by weight, 25 to 40% by weight, 25 to 35% by weight, 28 to 50% by weight, 28 to 45% by weight, 28 to 40% by weight, 28 to 35% by weight, 28 to 34% by weight, 28 to 33% by weight, 28 to 32% by weight, 28 to 31% by weight, 30 to 50% by weight, 30 to 45% by weight, 30 to 40% by weight, 30 to 35% by weight, 30 to 34% by weight, 30 to 33% by weight, 30 to 32% by weight, or 30 to 31% by weight of DHA based on the total weight of fatty acids.

[0054] Other aspects of the present application provide a composition comprising the Schizochytrium sp. strain CD01-1003, a culture of the strain, dry matter of the culture, or a lysate of the dry matter.

[0055] The composition may comprise biomass, bio-oil, or a combination thereof derived from the Schizochytrium sp. strain.

[0056] Other aspects of the present application provide a feed composition comprising biomass derived from the Schizochytrium sp. strain CD01-1003, or a concentrate or dry matter of the biomass.

[0057] The Schizochytrium sp. strain CD01-1003, biomass, a culture of the strain, dry matter of the culture, and a lysate of the dry matter are as described above.

[0058] The concentrate or dry matter of the biomass can be produced according to methods for treating, concentrating, or drying microbial biomass known in the art.

[0059] The term "bio-oil" as used in this specification refers to an oil obtained from biomass through biological, thermochemical, and physicochemical extraction processes, and the bio-oil produced in the present application may contain polyunsaturated fatty acids, and specifically, it may contain DHA, but is not limited thereto.

[0060] In this specification, the bio-oil may comprise an extract of the biomass.

[0061] As a method for producing a bio-oil extract, methods such as those for lysing or dissolving cell membrane or cell wall components, methods for using enzymes (such as proteases, cellulases, pectinases, or chitinases, etc.), methods for physically lysing cell membrane or cell wall components using a homogenizer, ultrasonic processor, bead treatment, etc., methods for extraction by directly adding a solvent and infiltrating into the cells, solvent-free extraction methods for separation by a centrifugation process after various lysis processes, etc. may be used, but are not limited thereto.

[0062] The composition may be in the form of a solution, powder or suspension, but is not limited thereto. The composition may be, for example, a food composition, a feed composition or a feed additive composition.

[0063] The term "feed composition" as used in this specification refers to a feed for animals. The feed composition refers to a substance that provides organic or inorganic nutrients required to maintain the life of animals or to produce meat, milk, etc. The feed composition may further contain nutritional components required to maintain the life of animals or to produce meat, milk, etc. The feed composition may be produced in the form of various feeds known in the art, and specifically, it may contain concentrated feeds, roughages and / or special feeds.

[0064] The term "feed additive" as used in this specification includes substances to be added to feeds for the purpose of achieving various effects such as supplementing nutrients and preventing weight loss, improving the digestibility of fibers in feeds, improving milk quality, preventing reproductive failure and increasing fertility, preventing summer heat stress, etc. The feed additive of the present application corresponds to supplementary feeds specified by the Control of Livestock and Fish Feed Act, and may further contain mineral preparations such as sodium bicarbonate, bentonite, magnesium oxide, compound minerals, etc., mineral preparations containing trace substances such as zinc, copper, cobalt, selenium, etc., vitamin preparations such as carotene, vitamin E, vitamin A, D, E, niacin, compound vitamin B, etc., protective amino acid preparations such as methionine, lysine, etc., protective fatty acid preparations such as calcium salts of fatty acids, live cells and yeast preparations such as probiotics (lactic acid bacteria preparations), yeast cultures, fungal fermentates, etc.

[0065] The term "food composition" as used in this specification includes all forms, such as functional foods, nutritional supplements, health foods and food additives, etc., and the food compositions in the above forms can be produced in various forms according to common methods known in the art.

[0066] The composition of the present application may further contain grains, such as crushed or ground wheat, oats, barley, corn and rice; plant protein feeds, such as feeds containing soybeans and sunflowers as main components; animal protein feeds, such as blood meal, meat meal, bone meal and fish meal; sugars and dairy products, such as dry components composed of various milk powders and whey powders, etc., and in addition to them, it may further contain dietary supplements, digestion and absorption enhancers, growth promoters, etc.

[0067] The compositions of the present application can be administered alone or in combination with other feed additives among edible carriers to animals. In addition, the compositions can be easily administered to animals in the form of top dressing, directly mixed in the feed, or in the form of an oral preparation separate from the feed. When the compositions are administered separately from the feed, they can be combined with pharmaceutically acceptable edible carriers well-known in the art and produced in the form of immediate-release or sustained-release preparations. Such edible carriers can be solid or liquid, such as corn starch, lactose, sucrose, soybean flakes, peanut oil, olive oil, sesame oil, and propylene glycol. When using a solid carrier, the compositions can be tablets, capsules, troches, or lozenges in a microdispersible form or top dressing. When using a liquid carrier, the compositions can be preparations in gelatin soft capsules, syrups, suspensions, emulsions, or solutions.

[0068] The compositions of the present application can contain, for example, preservatives, stabilizers, wetting agents or emulsifiers, cryoprotectants, or excipients, etc. The cryoprotectant can be at least one selected from the group consisting of glycerol, trehalose, maltodextrin, skim milk powder, and starch.

[0069] The preservatives, stabilizers, or excipients can be contained in the compositions in a dose sufficient to effectively reduce the deterioration of Schizochytrium microalgae contained in the compositions. In addition, when the compositions are in dry conditions, the cryoprotectant can be contained in a dose sufficient to effectively reduce the deterioration of Schizochytrium microalgae contained in the compositions.

[0070] The compositions can be used by adding them to animal feed via immersion, spraying, or mixing.

[0071] The compositions of the present application can be applied to many animal feeds, including mammals, birds, fish, crustaceans, cephalopods, reptiles, and amphibians, but not limited thereto. For example, mammals can include pigs, cows, sheep, goats, laboratory rodents, or pets, and birds can include poultry, and poultry can include chickens, turkeys, ducks, geese, pheasants, or quails, etc., but not limited thereto. In addition, fish can include commercially farmed fish and their fry, ornamental fish, etc., and crustaceans can include shrimp, barnacles, etc., but not limited thereto. In addition, the compositions can also be applied to the feed of rotifers (which are zooplankton).

[0072] Other aspects of the present application provide a method for producing biomass derived from Schizochytrium strains, which includes culturing Schizochytrium sp. CD01-1003 strain; and recovering biomass from the strain, the culture of the strain, the dry matter of the culture, or the lysate of the dry matter.

[0073] The Schizochytrium strain, biomass, culture of the strain, dry matter of the culture, and lysate of the dry matter are the same as described above.

[0074] As used in this specification, the term "cultivation" refers to growing the strain under appropriately controlled environmental conditions. The cultivation process of this application can be carried out according to suitable culture media and culture conditions known in the art. Such a cultivation process can be easily adjusted and used by those skilled in the art based on the strain to be selected.

[0075] Specifically, the cultivation of the Schizochytrium strain of this application can be carried out under heterotrophic conditions, but is not limited thereto.

[0076] As used in this specification, the term "heterotroph" is a method of nutrition that depends on obtaining organic substances as an energy source or nutrient source from outside the body, and is a term corresponding to autotrophs, and can be used interchangeably with the term "dark culture".

[0077] The Schizochytrium strain can be cultivated by known batch cultivation methods, continuous cultivation methods, fed-batch cultivation methods, etc., but is not particularly limited thereto. For the culture medium and other culture conditions for cultivating the microalgae of this application, any one can be used without particular limitation as long as it is a common culture medium for cultivating microalgae. Specifically, the microalgae of this application can be cultivated in a common culture medium containing suitable carbon sources, nitrogen sources, phosphorus sources, inorganic compounds, amino acids, and / or vitamins, etc., by adjusting the temperature, pH, etc.

[0078] Specifically, a suitable pH (for example, pH 5 to 9, specifically pH 6 to 8, most specifically pH 6.8) can be adjusted using alkaline compounds (such as sodium hydroxide, potassium hydroxide, or ammonia) or acidic compounds (such as phosphoric acid or sulfuric acid), but is not limited thereto.

[0079] In addition, oxygen or an oxygen-containing gas can be injected into the culture to maintain aerobic conditions of the culture, or no gas can be injected, or nitrogen, hydrogen, or carbon dioxide gas can be injected into the culture to achieve anaerobic and non-aerobic conditions, but is not limited thereto.

[0080] In addition, the cultivation temperature can be maintained at 20 to 45 °C or 25 to 40 °C, and the cultivation can be carried out for about 10 to 160 hours, but is not limited thereto. In addition, during cultivation, an antifoaming agent (such as fatty acid polyethylene glycol ester) can be used to inhibit bubble generation, but is not limited thereto.

[0081] The carbon source contained in the culture medium used for culturing the Schizochytrium microalgae can be at least one selected from the group consisting of glucose, fructose, maltose, galactose, mannose, sucrose, arabinose, xylose, and glycerol, but is not limited thereto, as long as it is a carbon source for culturing microalgae.

[0082] The nitrogen source contained in the culture medium used for culturing the Schizochytrium microalgae can be i) at least one organic nitrogen source selected from the group consisting of yeast extract, beef extract, peptone, and tryptone, or ii) at least one inorganic nitrogen source selected from the group consisting of ammonium acetate, ammonium nitrate, ammonium chloride, ammonium sulfate, sodium nitrate, urea, and MSG (monosodium glutamate), but is not limited thereto, as long as it is a nitrogen source for culturing microalgae.

[0083] The culture medium used for culturing the Schizochytrium microalgae can contain, alone or in combination, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, their corresponding sodium salts, etc. as a phosphorus source, but is not limited thereto.

[0084] Desired biomass can be collected from the biomass recovered from the microalgae, the culture of the microalgae, the dry matter of the culture, or the lysate of the dry matter using suitable methods known in the art. For example, centrifugation, filtration, anion exchange chromatography, crystallization, and HPLC, etc. can be used, and it can further include a purification process.

[0085] Other aspects of the present application provide a method for producing bio-oil derived from Schizochytrium microalgae, which includes culturing Schizochytrium CD01-1003 microalgae; and recovering lipids from the microalgae, the culture of the microalgae, the dry matter of the culture, or the lysate of the dry matter.

[0086] The culturing of the Schizochytrium microalgae, bio-oil, the culture of the microalgae, the dry matter of the culture, and the lysate of the dry matter is the same as the above.

[0087] Desired lipids can be collected from the lipids recovered from the microalgae, the culture of the microalgae, the dry matter of the culture, or the lysate of the dry matter using suitable methods known in the art. For example, centrifugation, filtration, anion exchange chromatography, crystallization, and HPLC, etc. can be used, and it can further include a purification process.

[0088] For example, lipids and lipid derivatives such as fatty aldehydes, fatty alcohols, and carbohydrates (such as alkanes) can be extracted with a hydrophobic solvent. Liquefaction, oil liquefaction, and supercritical CO 2Methods such as extraction are used to extract lipids and lipid derivatives. In addition, known methods for recovering microalgal lipids include, for example, the following methods: i) collecting cells by centrifugation, washing them with distilled water, and then drying them by freeze-drying, and ii) pulverizing the obtained cell powder and then extracting lipids with n-hexane (Miao, X and Wu, Q, Biosource Technology (2006) 97: 841-846).

[0089] Advantageous effects

[0090] The Schizochytrium strain of the present invention is a high-yielding bio-oil microalgae containing a high concentration of DHA, which has a high crude fat content in the produced biomass, so the productivity of bio-oil is high, and it is characterized by containing a high content of intracellular docosahexaenoic acid. Therefore, the strain itself, or the biomass produced by culturing and fermenting the strain, and its concentrates and extracts can be effectively used as feed compositions or food compositions. Brief description of the drawings

[0091] Figure 1 It is a figure demonstrating the sizes of the amplified DNA fragments of the wild-type CD01-1821 strain and the mutant CD01-1003 strain after PCR using a primer set that amplifies a DNA fragment containing a base sequence mutated by deleting 36 bp from the mutant CD01-1003 strain compared to the wild-type CD01-1821 strain. Detailed description of the invention

[0092] The present invention will be described in more detail below through examples. However, these examples are intended to descriptively illustrate one or more specific embodiments, but the scope of the present invention is not limited to these examples.

[0093] Example 1. Isolation of Thraustochytrium-based microalgae

[0094] To isolate Thraustochytrium-based microalgae, environmental samples in the form of seawater, leaves, and sediments were collected from a total of 40 locations in the west coast area of Korea (such as the areas of Sunchang, Gunsan, Buan, and Iksan coasts). Sampling was focused on specific locations where organic sediments had developed and were observed, and the collected environmental samples were transported to a laboratory environment within 7 days to remove other contaminants such as bacterial microorganisms, fungi, and protists except for the Thraustochytrium-based microalgae to be isolated. By continuous microscopic observation method, Thraustochytrium-based microalgal cells were isolated by focusing on samples showing the unique morphology of Thraustochytrium-based microalgae and forming zoospores that can be observed in the life cycle or producing an ectoplasmic network in the developmental stage. As the medium for isolation and culture used in the isolation process, modified YEP medium (0.1 g / L yeast extract, 0.5 g / L peptone, MgSO4 ·7H 2 O 2 g / L, sea salt 50 g / L, H 3 BO 3 5.0 mg / L, MnCl 2 3.0 mg / L, CuSO 4 0.2 mg / L, NaMo 4 ·2H 2 O 0.05 mg / L, CoSO 4 0.05 mg / L, ZnSO 4 ·7H 2 O 0.7 mg / L, agar 15 g / L). Through several separation and subculture processes, pure and isolated colonies with contaminants removed can be obtained, and the isolated colonies are again subjected to a contaminant control and removal process in a solid medium containing a mixture of antibiotics (streptomycin sulfate 0 - 50 mg / L, ampicillin 0 - 30 mg / L, penicillin G 0 - 30 mg / L, kanamycin sulfate 0 - 30 mg / L) to obtain pure and isolable colonies.

[0095] Example 2. Evaluation of Cultures of Isolated Microalgae and Selection of Excellent Strains

[0096] Cultures of the pure and isolated colonies in Example 1 were evaluated, and excellent strains were selected through this.

[0097] Specifically, under the conditions of 10 - 35 °C and 100 - 200 rpm, using a modified GYEP medium (glucose 5 g / L, glycerol 5 g / L, yeast extract 0.1 g / L, peptone 0.5 g / L, MgSO 4 ·7H 2 O 2 g / L, sea salt 50 g / L, H 3 BO 3 5.0 mg / L, MnCl 2 3.0 mg / L, CuSO 4 0.2 mg / L, NaMo 4 ·2H 2 O 0.05 mg / L, CoSO 4 0.05 mg / L, ZnSO 4 ·7H 2Cultivate the pure isolated colonies in Example 1 with 0.7 mg / L for about 2 days. Based on the results of the cultivation carried out, 29 species of microalgae were selected, which can grow under temperature conditions of 30 °C or higher and have excellent growth rates, and microbial cell masses can be obtained. Cultivate the selected microalgae strains in an improved GYEP medium, including 30 g / L of glucose as a carbon source and cultivation conditions of 30 °C, 150 rpm and a 500 ml flask scale for 2 days. After confirming that all the added carbon sources were consumed in the 2-day cultivation environment, collect the whole culture solution and dry it overnight in a drying oven at 60 °C to obtain biomass.

[0098] To analyze the lipid and polyunsaturated fatty acid contents of the cultivated microalgae microbial cells, the following method was used, and the fatty acid-containing oil derived from microalgae using dry microbial cells was measured by the following method. Add 8.3 M hydrochloric acid solution (HCl) to 5 g of dry microbial cells, and hydrolyze the cell wall of the microalgae microbial cells at 80 °C, then add 30 mL of diethyl ether and 20 mL of petroleum ether and mix for 30 seconds, and then repeat the centrifugation process 3 times or more. Collect the separated solvent layer and transfer it to a round flask whose weight has been pre-measured, then remove the solvent by nitrogen purging, and cool and weigh it in a desiccator. Measure the weight of the dried oil by subtracting the weight of the empty flask from the weight of the flask after drying, and calculate the total oil content. The inclusion of docosahexaenoic acid (DHA) in the oil is shown by pretreatment with 0.5 N NaOH in methanol and 14% boron trifluoride methanol (BF 3 ) and measurement by gas chromatography.

[0099] [Equation 1]

[0100] Total oil content (%) = (*oil g / dry microbial cell mass g) X 100

[0101] *oil g: weight of the flask after acid hydrolysis and solvent removal – weight of the empty flask

[0102] "Biomass" in Table 1 below refers to the concentration of microbial cells in the culture solution and can be used interchangeably with DCW (dry cell weight) in Table 2 below.

[0103] Table 1

[0104]

[0105]

[0106] (In this table, TFA refers to total fatty acids and can be used interchangeably with crude fat content or crude fat amount or total lipid.)

[0107] As shown in Table 1, the results showed that the intracellular DHA content of two strains, CD01-1821 and CD01-1822, was very high, 50% or higher.

[0108] As a fatty acid analysis, cultures of two strains, CD01-1821 and CD01-1822, which had excellent intracellular DHA content, were evaluated in a 5 L scale cultivator. Under the conditions of 30 °C and 150 rpm, in a 500 mL flask, using sterilized MJW02 medium (glucose 30 g / L, MgSO 4 ·7H 2 O 3.0 g / L, Na 2 SO 4 15 g / L, NaCl 0.8 g / L, yeast extract 1.0 g / L, MSG·1H 2 O 1.0 g / L, NaNO 3 1.0 g / L, KH 2 PO 4 0.8 g / L, K 2 HPO 4 1.5 g / L, CaCl 2 0.5 g / L, vitamin mixed solution 10 ml / L), seed culture was carried out for about 24 hours. An aliquot was taken from the flask of the seed culture and inoculated into a 5 L cultivator. A glucose carbon source of 28% relative to the total culture broth was supplied and cultured for about 72 hours, and the culture was carried out in sterilized MJW02 medium under the conditions of a culture environment of 30 °C, 500 rpm, 1.5 vvm, and pH 5 - 8.

[0109] Table 2

[0110]

[0111] As shown in Table 2, the results confirmed that the CD01-1821 strain was easier during the scale-up process because it had a higher total biomass production and crude fat content compared to the CD01-1822 strain under the same fermentation conditions. Therefore, the CD01-1821 strain was selected and used for strain sequence identification and the development of other strains.

[0112] Example 3. Confirmation of the culture characteristics of the CD01-1821 strain under complex carbon sources

[0113] In the fermentation based on heterotrophic microorganisms, glucose components are mainly used as raw materials for carbon sources. At this time, glucose is a monosaccharide in a purified form of 90% or higher, and it costs more during industrial-scale fermentation compared to other carbon source raw material components. In order to use inexpensive carbon source raw materials and thus ensure price competitiveness, it is important to discover strains that can be normally cultured in carbon source components that are not purified glucose, can be used in the microbial fermentation process, and are inexpensive.

[0114] Therefore, fermentation culture evaluations using glucose, fructose, or sucrose as the main components in crude sugar were conducted for the CD01-1821 strain and the CJM01 strain (Patent No. 10-2100650, already approved) selected in Example 2, and the culture characteristics were confirmed. Cultivation was carried out in a 30L incubator, and based on the improved MJW02 medium, experiments were conducted using a mixture containing 450 g / L of glucose, 225 g / L of glucose and 225 g / L of fructose, and a crude sugar lysate containing 225 g / L of glucose, 220 g / L of fructose, and 1.51 g / L of sulfate as the main carbon source components. The culture conditions were set to be the same as those of 30 °C, 500 rpm, 1.5 vvm, pH 5 - 8, and carbon sources were supplied at 35% of the total culture solution volume respectively.

[0115] Table 3

[0116]

[0117] As a result, as shown in Table 3, the CD01-1821 strain showed equal or higher total biomass production and crude fat content even when fermented under conditions of a fructose mixture (non-glucose single component) or a sucrose lysate medium. On the other hand, the CJM01 strain showed a two-stage growth form of dual carbon source consumption and cell growth pattern because sugar components other than glucose components were added to the medium, and the phenomenon of an extended total culture time was shown. Through the corresponding experiments, it was confirmed that the CD01-1821 strain has the possibility of scale-up fermentation under complex carbon source conditions.

[0118] Example 4. Identification of the new Schizochytrium strain CD01-1821

[0119] For the molecular biological identification of the microalgae strain CD01-1821 isolated and selected in Example 1 and Example 2, the 18S rRNA gene sequence was analyzed.

[0120] Specifically, gDNA was extracted and isolated from the colonies of pure isolated microalgae CD01-1821, and then a PCR amplification reaction was carried out using the primers 18s-Fwd and LABY-ARev for gene amplification at the 18s rRNA locus described in Table 4.

[0121] Table 4

[0122]

[0123] The PCR reaction was carried out through the following steps: Using a reaction solution containing taq polymerase, denaturation was performed at 95 °C for 5 minutes, and then repeated denaturation at 95 °C for 30 seconds, annealing at 50 °C for 30 seconds, and polymerization at 72 °C for 2 minutes for 35 cycles, and then polymerization reaction was carried out at 72 °C for 5 minutes. The reaction solution amplified through this PCR process was subjected to electrophoresis in a 1% agarose gel, and it was confirmed that a DNA fragment of approximately 1000 bp in size was amplified, and base sequencing analysis was performed. Through NCBI BLAST search, it was confirmed that the corresponding sequence obtained from the analysis result showed 95.11% homology with the 18S rRNA gene sequence of Schizochytrium limacinum strain OUC109, which belongs to microalgae of the family Thraustochytriaceae, and showed 95.0% homology with the 18S rRNA gene sequence of Schizochytrium sp. strain LY-2012. Through this, it was confirmed that the isolated microalgae CD01-1821 is a new strain of the genus Schizochytrium, and it was named Schizochytrium sp. CD01-1821 strain, and it was deposited at the Korean Collection for Type Cultures (KCTC), Korea Research Institute of Bioscience and Biotechnology on August 23, 2021, and was given the deposit number KCTC14660BP.

[0124] Example 5. Development of an artificially mutated strain of a new Schizochytrium microalgae

[0125] An artificially mutated strain was developed from the wild-type microalgae strain (Schizochytrium sp. CD01-1821) isolated in Example 4 according to γ-ray irradiation through the following method.

[0126] Specifically, in the improved GYEP medium (glucose 10 g / L, yeast extract 1 g / L, peptone 1 g / L, MgSO 4 ·7H 2 O 2 g / L, H 3 BO 3 5.0 mg / L, MnCl 2 3.0 mg / L, CuSO 4 0.2 mg / L, NaMo 4 ·2H 2 O 0.05 mg / L, CoSO 4 0.05 mg / L, ZnSO 4 ·7H 2The pure, isolated Schizochytrium sp. CD01-1821 strain (KCTC14660BP) was cultured in a medium (O 0.7 mg / L) for about 24 hours to reach the early exponential phase, and then the culture broth sample was centrifuged to harvest the microbial cells. The harvested microbial cells were suspended in a 0.1 M phosphate buffer solution containing 1.0% NaCl so that the number of cells was about 10 9 cells / mL and used for gamma-ray irradiation.

[0127] The gamma-ray irradiation experiment was conducted at the Korea Atomic Energy Research Institute, Advanced Radiation Technology Institute, and a dose of 7 kGY of gamma-rays was irradiated. After the 0 / N recovery process in a dark room, the irradiated microalgae culture broth sample was cultured in a GYEP medium containing 20 g / L of agar and 2-butanol that inhibits fatty acid synthesis. The microalgae colonies that grew during the cultivation period of about 2 weeks were selected and subcultured under the same medium and culture environmental conditions. Strains that could grow continuously between generations and had excellent colony growth were preferentially selected. In addition, colonies that were white in morphology and grew rapidly were selected. The selected colonies were pure and isolated, cultured in the form of a single cell line, and the corresponding strain was named the CD01-1003 strain, which was deposited at the Korean Collection for Type Cultures (KCTC), Korea Research Institute of Bioscience and Biotechnology on November 21, 2022, and given the deposit number KCTC15201BP.

[0128] Example 6. Confirmation of the culture characteristics of the mutant Schizochytrium sp. CD01-1003 strain

[0129] Example 6-1. Cultivation of the CD01-1821 strain and the CD01-1003 strain

[0130] To confirm the culture characteristics of the wild-type Schizochytrium sp. CD01-1821 strain and the mutant Schizochytrium sp. CD01-1003 strain, the wild-type Schizochytrium sp. CD01-1821 strain selected in Example 2 and the mutant Schizochytrium sp. CD01-1003 strain selected in Example 5 were evaluated by fermentation culture.

[0131] Specifically, preliminary cultivation was carried out before this cultivation on a 30 L scale. By inoculating them into a GYEP medium containing 50 ml of working volume and 30 g / L of glucose in a 500 ml flask, they were cultivated in an oscillating incubator at 30 °C and 180 rpm for about 20 hours. The preliminary culture was inoculated into a 30 L fermenter containing the medium under the same conditions and fermented and cultivated in a total working volume of 20 L. Under the conditions of 30 °C, 500 rpm, 0.5 - 1 vvm, and pH 5 - 7, glucose corresponding to 20% of the working volume was continuously input and used for cell culture, and glucose was injected to keep the glucose concentration at the level of 20 g / L at this time. When all the provided carbon source glucose was exhausted, the cultivation was terminated. The microbial cells from which the supernatant was removed after the cultivation was completed were used for experiments on measuring crude fat and fatty acids, crude protein content, and intracellular extraction and recovery.

[0132] Analysis of Crude Fat and Fatty Acid Contents of Cultured Samples of CD01 - 1003 Mutant Strain and Wild - type CD01 - 1821 Strain in Example 6 - 2

[0133] In order to analyze the lipid and polyunsaturated fatty acid contents in the cells of the wild - type Schizochytrium sp. CD01 - 1821 strain and the mutant Schizochytrium sp. CD01 - 1003 strain, experiments were carried out by the following method.

[0134] Specifically, 8.3 M hydrochloric acid solution (HCl) was added to 2 g of each dry microbial cell obtained in Example 6 - 1, and the cell wall of the microalgae microbial cells was hydrolyzed at 80 °C. Then, 30 mL of ether and 20 mL of petroleum ether were added and mixed for 30 seconds, and then the centrifugation process was repeated 3 times or more. The separated solvent layer was collected and transferred to a round flask whose weight had been pre - measured, and then the solvent was removed by nitrogen purging, and it was cooled and weighed in a desiccator. The weight of the dried oil was measured, and the total oil content was calculated. The DNA inclusion in the oil was pretreated with 0.5 N NaOH in methanol and 14% boron trifluoride methanol (BF 3 ) and measured by gas chromatography. The measurement results are shown in Table 5 below.

[0135] ■ Total oil content (%, * oil g / dry microbial cell mass g x 100)

[0136] * oil g: Weight of the flask after acid hydrolysis and solvent removal – Weight of the empty flask

[0137] Table 5

[0138]

[0139] As a result, as shown in Table 5, both the wild-type CD01-1821 strain and the mutant CD01-1003 strain consumed all the supplied carbon source (glucose) within approximately 60 hours, and the biomass produced was at a level of approximately 160 g / L. In particular, in the CD01-1003 strain, 71.7% of the biomass produced consisted of crude fat components, and 30% or more of the biomass contained a high content of the ω3 component of DHA (C22:6n-3). In addition, the crude fat productivity of the CD01-1003 strain was shown to be 47.86 g / L / day, and thus it was confirmed that it had a better crude fat productivity compared to the wild-type strain, and the C22:6n-3 (DHA) productivity was shown to be 14.54 g / L / day, and thus it was confirmed that it had a higher C22:6n-3 (DHA) productivity compared to the wild-type strain.

[0140] Example 7. Derivation of Distinguishing Markers for the CD01-1003 Mutant Strain and the Wild-Type CD01-1821 Strain

[0141] By using the following method to find the mutated sequence in the CD01-1003 strain, PCR markers were generated by comparing the complete genomic sequences of the wild-type CD01-1821 strain and the mutant CD01-1003 strain.

[0142] Specifically, when compared with the genome of the wild-type CD01-1821 strain, by confirming the complete genomic sequence of the mutant CD01-1003 strain, a 36-base pair deletion part (the bold part in the following SEQ ID NO:4 sequence) was confirmed on the genome. The following shows the amplification target sequences of the wild-type CD01-1821 strain and the mutant CD01-1003 strain. The underlined part is the primer sequence for amplifying the corresponding DNA fragment sequence, and the bold part indicates the sequence that exists in the wild-type CD01-1821 strain but is deleted in the mutant CD01-1003 strain.

[0143] [Amplified DNA Fragment Sequence of CD01-1821 Strain (SEQ ID NO:4)]

[0144]

[0145] [Amplified DNA Fragment Sequence of CD01-1003 Strain (SEQ ID NO:5)] GCCAGGCAGCTGAATGTAATGGGATCACGGCAAGCTTCCAATACAGATTAGACCGCCCGGATCCCTTACAAAAGGCTGTGAGGCCAATGATCGATTGATCAATAGATAGTTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGAAAACAAATACCTAGGCGATTACTGCTTCACTATAGCTTTTTTCTCCTGCTTTTATCCGGCTGCCGTTTCGAGGCTTGGGCGAGGCGCCATTTCCC TTCACTCTTCTCCACAGCCA

[0146] Select primers A: 5'-GCCAGGCAGCTGAATGTAAT-3' (SEQ ID NO: 6) and primer B: 5'-TGGCTGTGGAGAAGAGTGAA-3' (SEQ ID NO: 7) that amplify these portions, and use these for PCR amplification reactions. For the PCR reaction, after denaturing for 5 minutes at 95°C using a reaction solution containing taq polymerase, repeat denaturation at 95°C for 10 seconds, annealing at 50°C for 10 seconds, and polymerization at 72°C for 15 seconds 35 times, and then perform a polymerization reaction at 72°C for 5 minutes. Subject the reaction solution amplified by this PCR process to electrophoresis in a 1.7% agarose gel and confirm the size of the amplified DNA ( Figure 1 ).

[0147] As a result, as Figure 1 shown, it was confirmed that the size of the DNA fragment in the amplified mutant CD01-1003 strain was approximately 313 bp, and it differed from the wild-type CD01-1821 strain in which a DNA fragment of approximately 349 bp was amplified.

[0148] Therefore, from the results, it was confirmed that primers A: 5'-GCCAGGCAGCTGAATGTAAT-3' and primer B: 5'-TGGCTGTGGAGAAGAGTGAA-3' can be used to select the mutant CD01-1003 strain.

[0149] Based on the above description, those skilled in the art to which this application pertains will be able to understand that, without changing the technical spirit or basic characteristics of this application, this application can be implemented in other specific forms. In this regard, the above embodiments should be understood as illustrative in all aspects rather than restrictive. The scope of this application should be construed as all forms of changes or modifications obtained from the meaning and scope of the appended claims, and the above detailed description and its equivalent concepts are included within the scope of this application.

[0150] Deposit number

[0151] Name of the depository institution: Korea Collection for Type Cultures (KCTC), Korea Research Institute of Bioscience and Biotechnology

[0152] Deposit number: KCTC14660BP

[0153] Deposit date: 20210823

[0154] Name of the depository institution: Korea Collection for Type Cultures (KCTC), Korea Research Institute of Bioscience and Biotechnology

[0155] Deposit number: KCTC15201BP

[0156] Deposit date: 20221121

[0157] Budapest Treaty International Depositary Authority for the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure

[0158] Deposit certificate issued by the international depositary authority in accordance with Regulation 7.1 To: CJ CheilJedang Corporation

[0159] 330, Jeonggok-dong, Dongdaemun-gu, Seoul, Korea

[0160] CJ CheilJedang Center

[0161] (Postcode) 100 - 400

[0162]

[0163] Budapest Treaty International Depositary Authority for the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure

[0164] Deposit certificate issued by the international depositary authority in accordance with Regulation 7.1 To: CJ CheilJedang Corporation

[0165] 330, Jeonggok-dong, Dongdaemun-gu, Seoul, Korea

[0166] CJ CheilJedang Center

[0167] (Postcode) 100 - 400

[0168]

Claims

1. A Schizochytrium CD01-1003 strain, which is a microalgae deposited under the deposit number KCTC15201BP, which produces bio-oil containing a high concentration of DHA (docosahexaenoic acid, 22:6).

2. The strain according to claim 1, wherein the bio-oil comprises 25 to 35 wt% DHA based on the total weight of fatty acids.

3. The strain according to claim 1, wherein the bio-oil productivity of the strain is 44 to 54 g / L / day. The strain according to claim 1 , wherein the DHA productivity of the strain is 12.5 to 16.5 g / L / day. 5 . The strain according to claim 1 , wherein the genomic DNA of the strain comprises a nucleotide sequence in which 36 nucleotides are deleted from the nucleotide sequence of SEQ ID NO: 4 of the Schizochytrium sp. CD01-1821 strain as a parent strain. The strain according to claim 5, wherein the nucleotide sequence having 36 nucleotides deleted from the nucleotide sequence of SEQ ID NO: 4 consists of SEQ ID NO:

5.

7. The strain according to claim 1, wherein the strain is selected using a primer set consisting of the nucleotide sequences of SEQ ID NO: 6 and SEQ ID NO:

7.

8. A microbial product for producing DHA (docosahexaenoic acid, 22:6), comprising the strain according to any one of claims 1 to 7 or a culture solution thereof as an active ingredient. 9 . A biomass derived from a Schizochytrium strain, comprising the strain according to claim 1 , a culture broth of the strain, dry matter of the culture broth, or a lysate of the dry matter. 10 . A feed composition comprising the biomass derived from the Schizochytrium strain according to claim 9 , or a concentrate, dry matter or extract of the biomass. 11 . A food composition comprising the biomass derived from the Schizochytrium strain according to claim 9 , or a concentrate, a dry matter or an extract of the biomass.

12. A method for producing biomass derived from a Schizochytrium strain, wherein include: Cultivating the strain according to any one of claims 1 to 7; and A biomass containing DHA (docosahexaenoic acid, 22:6) is recovered from the strain, the culture broth thereof, or the dry matter or lysate of the culture broth.

13. A method for producing a bio-oil derived from a Schizochytrium strain, wherein include: Cultivating the strain according to any one of claims 1 to 7; and A bio-oil containing DHA (docosahexaenoic acid, 22:6) is recovered from the strain, the culture broth thereof, or the dry matter or lysate of the culture broth.

Images