Use of Ube2f, Cul5 or Rnf7 in prevention and / or treatment of infections

Abstract

The invention discloses an application of Ube2f, Cul5 or Rnf7 in prevention and / or treatment of infection. The invention provides any one of the following applications of a reagent targeting a Ube2f gene, a Cul5 gene or an Rnf7 gene or an expression product thereof: (i) an application in preparation of a product for preventing and / or treating infection; (ii) use in preparation of a product for enhancing the anti-infection ability of immune cells; (iii) use in the preparation of a product for preventing and / or reversing immune cell depletion.

Description

Technical Field

[0001] The present invention belongs to the technical field of immune cell technology, and particularly relates to the use of Ube2f, Cul5 or Rnf7 in the prevention and / or treatment of infections. Background Art

[0002] During pathogen infection, insufficient expansion, too rapid regression of immune cells (such as T cells), inability to form effective immune memory, or entry into a state of exhaustion are important reasons why pathogens cannot be completely cleared and long-term immune memory cannot be formed. At present, the methods for increasing T cell expansion, promoting immune memory formation and inhibiting exhaustion are very limited and further research is needed.

[0003] Citation Document 1 discloses that knockout of Ube2f significantly sensitizes cancer cells to platinum treatment by increasing the protein level of NOXA and subsequently promoting apoptosis. Citation Document 2 discloses that deletion of Cul5 reduces the ubiquitination and subsequent degradation of pJak1, leading to increased levels of pJak1 and pSTAT6 and reducing the threshold of IL-4 receptor signaling. Citation Document 3 discloses that Rnf7 affects CARMA2 signaling by regulating the ubiquitination status of MALT1 and the NF-κB regulatory molecule NEMO.

[0004] However, the physiological and pathological functions of the Ube2f gene, Cul5 gene or Rnf7 gene in T cells are still unclear, especially their roles in the prevention and / or treatment of infections are unclear.

[0005] Citation Document

[0006] Citation Document 1: Zhou, Lisha et al. “Induction of NEDD8-conjugating enzyme E2UBE2F by platinum protects lung cancer cells from apoptosis and confers toplatinum-insensitivity.” Cell death & disease vol. 11, 11 975.12 Nov. 2020, doi:10.1038 / s41419-020-03184-4

[0007] Citation Document 2: Kumar, Binod et al. “The ubiquitin ligase Cul5 regulates CD4 +T cell fate choice and allergic inflammation.”Nature communications vol.13,12786.19May.2022,doi:10.1038 / s41467-022-30437-x

[0008] Citation 3: Telesio, Gianluca et al. “The E3 Ubiquitin Ligase RNF7 Negatively Regulates CARD14 / CARMA2sh Signaling.” International journal of molecular sciences vol.18,12 2581.1Dec.2017,doi:10.3390 / ijms18122581 Summary of the Invention

[0009] Problems to be Solved by the Invention

[0010] During the infection process, insufficient expansion of immune cells (such as T cells), rapid entry into the contraction phase, and the inability to form memory T cells are current problems.

[0011] Aiming at the problems existing in the prior art, the present invention significantly enhances the expansion ability of T cells during the infection process, increases the formation of memory T cells, inhibits T cell exhaustion, thereby improving the anti-infection ability of T cells and significantly reducing the infection of pathogens by editing the Ube2f, Cul5 or Rnf7 genes in T cells.

[0012] Solutions for Solving the Problems

[0013] The first aspect of the present invention provides any one of the following uses of a reagent targeting the Ube2f gene, Cul5 gene or Rnf7 gene or its expression product:

[0014] (i) Use in the preparation of a product for preventing and / or treating infection;

[0015] (ii) Use in the preparation of a product for enhancing the anti-infection ability of immune cells;

[0016] (iii) Use in the preparation of a product for preventing and / or reversing immune cell exhaustion.

[0017] In some embodiments, the infection includes at least one of bacterial infection, viral infection, fungal infection, protozoan infection, and parasitic infection.

[0018] In some embodiments, the prevention and / or treatment of infection includes preventing and / or treating infectious diseases and / or diseases and / or symptoms related to infection, and / or enhancing the subject's anti-infection ability.

[0019] In some specific embodiments, the diseases and / or symptoms related to infection are one or more selected from the group consisting of: pathological damage caused by infection; immune cell exhaustion after infection, including reduced proliferative ability, weakened killing ability, and reduced cytokine secretion of immune cells; endotoxin shock or death; inflammatory damage of organs; multiple organ failure; acute and / or chronic inflammatory diseases caused by infection.

[0020] In some specific embodiments, enhancing the subject's anti-infection ability includes enhancing the anti-infection ability of immune cells in the subject and / or preventing and / or reversing immune cell exhaustion in the subject.

[0021] In some embodiments, the immune cells include at least one of T cells, NKT cells, NK cells, innate lymphoid cells (ILC), and chimeric antigen receptor NK cells (CAR-NK cells).

[0022] In some specific embodiments, the T cells include naive T cells, αβ T cells, γδ T cells, CD4 + T cells, CD8 + T cells, memory T cells, activated T cells, exhausted T cells, tolerant T cells, chimeric antigen receptor T cells (CAR-T cells), T cell receptor T cells (TCR-T cells), and antigen-specific T cells.

[0023] In some specific embodiments, the T cells include activated T cells.

[0024] In some specific embodiments, the T cells include antigen-specific T cells, preferably, the antigen-specific T cells are antigen-specific T cells against the pathogen causing the infection.

[0025] In some specific embodiments, the T cells include CD8 + T cells.

[0026] In some specific embodiments, the T cells include exhausted T cells.

[0027] In some embodiments, the immune cells are immune cells from the subject; and / or, the infection is an infection in the subject.

[0028] In some specific embodiments, the subject is a human or a non-human animal.

[0029] In some embodiments, the reagent targeting the Ube2f gene, Cul5 gene, or Rnf7 gene or their expression products includes at least one of nucleic acids, polypeptides, ribonucleoprotein complexes, and small molecule inhibitors.

[0030] In some specific embodiments, the nucleic acid includes at least one of antisense RNA molecules and RNA interference molecules.

[0031] In some specific embodiments, the polypeptide includes at least one of an antibody or its antigen-binding fragment, an artificial zinc finger nuclease, and a TALEN system.

[0032] In some specific embodiments, the ribonucleoprotein complex includes the CRISPR / cas system.

[0033] In some embodiments, the reagent targeting the Ube2f gene, Cul5 gene, or Rnf7 gene or their expression products includes the reagent used in any one of gene knockout technology, gene silencing technology, inactivating mutation technology, and PROTAC technology.

[0034] In some embodiments, the product is a pharmaceutical composition, a kit, a reagent, or a reagent kit.

[0035] In a second aspect of the present invention, there is provided a modified immune cell, wherein the modified immune cell is an immune cell treated with a reagent targeting the Ube2f gene, Cul5 gene, or Rnf7 gene or their expression products.

[0036] In some embodiments, the immune cell includes at least one of T cells, NKT cells, NK cells, innate lymphoid cells (ILC), and chimeric antigen receptor NK cells (CAR-NK cells).

[0037] In some specific embodiments, the T cells include naive T cells, αβ T cells, γδ T cells, CD4 + T cells, CD8 + T cells, memory T cells, activated T cells, exhausted T cells, tolerant T cells, chimeric antigen receptor T cells (CAR-T cells), T cell receptor T cells (TCR-T cells), and antigen-specific T cells.

[0038] In some specific embodiments, the T cells include activated T cells.

[0039] In some specific embodiments, the T cells include antigen-specific T cells.

[0040] In some specific embodiments, the T cells include CD8 +T cells.

[0041] In some specific embodiments, the T cells include exhausted T cells.

[0042] In some embodiments, the antigen-specific T cells are antigen-specific T cells against the pathogen causing the infection.

[0043] In some specific embodiments, the infection includes at least one of bacterial infection, viral infection, fungal infection, protozoal infection, and parasitic infection.

[0044] In some specific embodiments, the infection is an infection in a subject.

[0045] In the third aspect of the present invention, there is provided the use of the modified immune cells as described in the second aspect of the present invention in the preparation of a product for preventing and / or treating an infection.

[0046] In the fourth aspect of the present invention, there is provided a composition comprising at least one selected from the following (a) to (d):

[0047] (a) A reagent targeting the Ube2 gene or its expression product;

[0048] (b) A reagent targeting the Cul5 gene or its expression product;

[0049] (c) A reagent targeting the Rnf7 gene or its expression product; and,

[0050] (d) The modified immune cells as described in the second aspect of the present invention.

[0051] In some embodiments, the composition is a pharmaceutical composition, and the pharmaceutical composition further includes a pharmaceutically acceptable carrier.

[0052] Effects of the Invention

[0053] The present invention edits the genes of antigen-specific immune cells such as T cells to achieve the effect of enhancing the anti-infection ability of T cells. By knocking out the Ube2f gene, Cul5 gene, or Rnf7 gene, it inhibits T cells from entering the contraction phase, keeps T cells in the expansion phase, enhances the T cell expansion ability, enhances the persistence of T cells, and / or enhances the formation of memory T cells, that is, prevents and reverses T cells from entering the exhausted state, and enhances the anti-pathogen (virus) ability, such as reducing the viral load. Brief Description of the Drawings

[0054] Figure 1 Respectively knocking out Ube2f, Cul5, and Rnf7 enhances CD8 during the chronic infection process of LCMV clone 13 +Proliferation capacity and persistence of T lymphocytes

[0055] Figure 1 In A, it is a schematic diagram of the experimental design. Cas9 + P14 cells were activated and transduced with a retrovirus expressing a non-targeting sgRNA with a GFP marker (sgControl) or an indicated sgRNA with a Thy1.1 marker. GFP-positive and Thy1.1-positive P14 cells were mixed at a ratio of 1:1 and co-transferred into B6 mice infected with LCMV clone 13 one day before adoptive cell transfer. GFP and Thy1.1 double-positive P14 cells in the blood were detected by flow cytometry. The distribution of P14 cells in the peripheral blood of recipient mice was detected on days 0, 7, 14, 28, and 56 after infection. Figure 1 In B, it shows flow cytometry plots of the proportion of Thy1.1- and GFP-positive cells in P14 cells in the peripheral blood detected by flow cytometry in representative mice of each group on days 0, 7, 14, 28, and 56 after infection; Figure 1 In C, it shows a line graph of Thy1.1-positive P14 cells in the blood during LCMV clone 13 infection (n = 4 mice per group), which is a two-way ANOVA multiple-comparisons test, Figure 1 In D, it is a statistical graph of the viral titers of the sera of the mouse control group (sgControl) and the sgUbe2f group 30 days after LCMV clone 13 infection (n = 8 - 11), which is a two-tailed paired Student's t test.

[0056] Figure 2 Knockout of Ube2f, Cul5, and Rnf7 respectively enhances the proliferation capacity and persistence of CD8 + Proliferation capacity and persistence of T lymphocytes

[0057] Figure 2 In A, it is a schematic diagram of the experimental design. Cas9 + P14 cells were activated and transduced with a retrovirus expressing a non-targeting sgRNA with a GFP marker (sgControl) or an indicated sgRNA with a Thy1.1 marker. GFP-positive and Thy1.1-positive P14 cells were mixed at a ratio of 1:1 and co-transferred into B6 mice infected with LCMV-Armstrong one day before adoptive cell transfer. GFP and Thy1.1 double-positive P14 cells in the blood were detected by flow cytometry. The distribution of P14 cells in the peripheral blood of recipient mice was detected on days 7, 14, 28, and 35 after infection.Figure 2 Panel B in [reference] shows flow cytometry representative plots of the proportion of Thy1.1-positive and GFP-positive P14 cells among CD8-positive T cells in the peripheral blood of recipient mice at days 7, 14, 28, and 35 after LCMV-Armstrong infection. Figure 2 Panel C in [reference] shows a line graph of the proportion of P14 cells among CD8-positive T cells in the blood during LCMV Armstrong infection (n = 4). Figure 2 Panel D in [reference] shows the proportion of control P14 cells (sgControl) and P14 cells with knockout of Ube2f, Cul5, and Rnf7 among CD8-positive T cells in the spleen of recipient mice at day 36 after LCMV-Armstrong infection. There were 4 - 6 mice in each group. Figure 2 Panel E in [reference] shows the absolute numbers of control P14 cells (sgControl) and P14 cells with knockout of Ube2f, Cul5, and Rnf7 in the spleen of recipient mice at day 36 after LCMV-Armstrong infection. There were 4 - 6 mice in each group. Figure 2 The data in Panels C, D, and E are presented as mean ± standard error of the mean (mean ± SEM); Figure 2 Panel C was analyzed by two-way ANOVA Mixed-effects analysis; Figure 2 Panels D and E were both analyzed by two-tailed unpaired Student's t test.

[0058] Figure 3 Knockout of Ube2f enhances the expansion ability and persistence of CD8 + T lymphocytes during Listeria monocytogenes-ovalbumin (LM-OVA) infection

[0059] Figure 3 Panel A in [reference] shows a dot plot of the proportion of control (sgControl) or Ube2f-knockout (sgUbe2f) OT-1 cells among CD8 + T cells in the spleen of recipient mice at day 45 after LM-OVA infection. Figure 3 Panel B in [reference] shows a statistical graph of the absolute numbers of control or Ube2f-knockout OT-1 cells in the spleen of recipient mice at 45 days after LM-OVA infection. The statistical method was two-tailed unpaired Student's t test, and n = 4 - 5. Detailed implementation manners

[0060] Various exemplary embodiments, features, and aspects of the present invention will be described in detail below. The term "exemplary" used herein means "serving as an example, embodiment, or illustration." Any embodiment described herein as "exemplary" is not necessarily to be construed as superior to or better than other embodiments.

[0061] In addition, for a better description of the present invention, numerous specific details are given in the following detailed implementation manners. Those skilled in the art should understand that the present invention can also be implemented without some specific details. In other instances, methods, means, equipment, and steps well-known to those skilled in the art are not described in detail so as to highlight the gist of the present invention.

[0062] Unless otherwise stated, the units used in this specification are all international standard units, and the numerical values and numerical ranges appearing in the present invention should be understood to include the systematic errors inevitable in industrial production.

[0063] In this specification, the meaning expressed by using "may" includes both the meaning of performing a certain process and the meaning of not performing a certain process.

[0064] In this specification, the so-called "some specific / preferred implementation manners", "other specific / preferred implementation manners", "implementation manners", etc. refer to the specific elements (for example, features, structures, properties, and / or characteristics) related to the implementation manner described herein, which are included in at least one of the implementation manners described herein, and may or may not exist in other implementation manners. In addition, it should be understood that the elements can be combined in various implementation manners in any suitable way.

[0065] In this specification, the numerical range represented by using "numerical value A to numerical value B" refers to the range including the endpoint numerical values A and B.

[0066] In this specification, when the term "and / or" is used to connect two or more options, it should be understood to mean any one of the options or any two or more of the options.

[0067] In this specification, the term "immune cell" refers to any cell that plays a role in the immune response. Immune cells are of hematopoietic origin and include lymphocytes such as B cells and T cells; natural killer cells; myeloid cells such as monocytes, macrophages, dendritic cells, eosinophils, neutrophils, mast cells, basophils, and granulocytes.

[0068] In this specification, the term "lymphocyte" refers to all populations of immature, mature, undifferentiated, and differentiated white lymphocytes, which include tissue-specific types and specialized types. By way of non-limiting examples, the lymphocytes include B cells, T cells, NKT cells, and NK cells.

[0069] As used herein, "administering", "giving", and "treating", when applied to an animal, a human, an experimental subject, a cell, a tissue, an organ, or a biological fluid, mean the contact of an exogenous drug, therapeutic agent, diagnostic agent, or composition with the animal, human, subject, cell, tissue, organ, or biological fluid. "Administering", "giving", and "treating" can refer to, for example, therapeutic, pharmacokinetic, diagnostic, research, and experimental methods. Treating a cell includes the contact of a reagent with the cell, as well as the contact of a reagent with a fluid that contacts the cell. "Administering", "giving", and "treating" also mean treating a cell in vitro and ex vivo by a reagent, diagnostic agent, binding composition, or by another cell. "Treating", when applied to a human, veterinary medicine, or research subject, means a therapeutic, prophylactic, or preventive measure, research, and diagnostic applications.

[0070] As used herein, "treatment" means administering to a patient a therapeutic agent, either internally or externally, such as a recombinant immune cell of the present invention, the patient having one or more disease symptoms, and the therapeutic agent being known to have a therapeutic effect on these symptoms. Generally, the therapeutic agent is administered to the treated patient or population in an amount effective to alleviate one or more disease symptoms, either by inducing regression of such symptoms or inhibiting the development of such symptoms to any clinically measurable degree. The amount of a therapeutic agent effective to alleviate any particular disease symptom (also referred to as a "therapeutically effective amount") can vary depending on a variety of factors, such as the patient's disease state, age, and weight, as well as the ability of the drug to produce the desired effect in the patient. Whether a disease symptom has been alleviated can be evaluated by any clinical test method commonly used by a doctor or other professional healthcare provider to assess the severity or progression of the symptom.

[0071] As used herein, the term "prevention" refers to prophylactic treatment of a subject who does not currently have and has not had in the past a disease but is at risk of developing a disease or who has had a disease in the past, does not currently have the disease, but is at risk of disease recurrence.

[0072] As used herein, "effective amount" includes an amount sufficient to ameliorate or prevent the symptoms or condition of a medical disorder. An effective amount also means an amount sufficient to permit or facilitate diagnosis. The effective amount for a particular patient or veterinary subject can vary depending on factors such as the disorder to be treated, the overall health of the patient, the method of administration, route, and dosage, and the severity of side effects. The effective amount can be the maximum dose or dosing regimen that avoids significant side effects or toxic effects.

[0073] In this specification, a "therapeutically effective amount" is an amount sufficient to provide a therapeutic benefit in the treatment of a disorder or sufficient to delay or minimize one or more symptoms associated with the disorder. A therapeutically effective amount refers to the amount of a therapeutic agent, alone or in combination with other therapies, that provides a therapeutic benefit in the treatment of a disorder. The term "therapeutically effective amount" can include an amount that improves overall therapy; reduces or avoids symptoms, signs, or causes of a disorder; and / or enhances the therapeutic efficacy of another therapeutic agent.

[0074] In this specification, a "prophylactically effective amount" is an amount sufficient to prevent a disorder or one or more symptoms associated with the disorder or to prevent its recurrence. A prophylactically effective amount refers to the amount of a therapeutic agent, alone or in combination with other agents, that provides a prophylactic benefit in preventing a disorder. The term "prophylactically effective amount" can include an amount that improves overall prophylaxis or enhances the prophylactic efficacy of another prophylactic agent.

[0075] In this specification, the term "pharmaceutically acceptable" (or "pharmacologically acceptable", "medicinally acceptable") refers to molecular entities and compositions that, when administered to an animal or a human as appropriate, do not produce adverse reactions, allergic reactions, or other untoward reactions. As used herein, the term "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial agents, isotonic agents, and absorption delaying agents, buffers, excipients, binders, lubricants, gels, surfactants, etc. that can be used as a medium for pharmaceutically acceptable substances.

[0076] In this specification, the "UBE2F gene" and the "Ube2f gene" can be used interchangeably without special definition. The Ube2f gene is the Ube2f gene of any target subject.

[0077] In this specification, the "CUL5 gene" and the "Cul5 gene" can be used interchangeably without special definition. The "Cul5 gene" is the "Cul5 gene" of any target subject.

[0078] In this specification, the "RNF7 gene" and the "Rnf7 gene" can be used interchangeably without special definition. The "Rnf7 gene" is the "Rnf7 gene" of any target subject.

[0079] In this specification, a "subject" or a "host" refers to a human or a non-human animal, including mammals. For example, primates (such as humans, monkeys), cattle, sheep, goats, alpacas, horses, dogs, cats, rabbits, rats, mice, etc. A "subject" or a "host" includes both therapeutic and non-therapeutic types. A "subject" or a "host" includes experimental animal models or animals used for the production of biomolecules that treat diseases, i.e., "non-therapeutic hosts" or "non-therapeutic subjects".

[0080] <Use for preventing and / or treating infections, enhancing the anti-infection ability of immune cells, and preventing and / or reversing immune cell exhaustion>

[0081] In some aspects of the present invention, there is provided any one of the following uses of a reagent targeting the Ube2f gene, Cul5 gene, or Rnf7 gene:

[0082] (i) Use in the preparation of a product for preventing and / or treating infections;

[0083] (ii) Use in the preparation of a product for enhancing the anti-infection ability of immune cells;

[0084] (iii) Use in the preparation of a product for preventing and / or reversing immune cell exhaustion.

[0085] (Gene, expression product of the gene)

[0086] In some embodiments, the expression product of the Ube2f gene, Cul5 gene, or Rnf7 gene refers to molecules in various forms of the Ube2f gene, Cul5 gene, or Rnf7 gene at each stage, such as but not limited to molecules generated during amplification, replication, transcription, splicing, processing, translation, and modification of the Ube2f gene, Cul5 gene, or Rnf7 gene, such as cDNA, mRNA, precursor protein, mature protein, and fragments thereof.

[0087] In some embodiments, exemplary information on the Ube2f gene, Cul5 gene, and Rnf7 gene can be found in Table 1 below.

[0088] Table 1 Information on the Ube2f gene, Cul5 gene, and Rnf7 gene

[0089]

[0090] In the present invention, specifically, the human UBE2F gene (Gene ID: 140739, updated on November 23, 2023, https: / / www.ncbi.nlm.nih.gov / gene / 140739) and the murine Ube2f gene (Gene ID: 67921, updated on November 23, 2023, https: / / www.ncbi.nlm.nih.gov / gene / 67921) encode the UBE2F protein in cells.

[0091] The human CUL5 gene (Gene ID: 8065, updated on December 3, 2023, https: / / www.ncbi.nlm.nih.gov / gene / 8065) and the murine Cul5 gene (Gene ID: 75717, updated on November 23, 2023, https: / / www.ncbi.nlm.nih.gov / gene / 75717) encode the CUL5 protein in cells.

[0092] The human RNF7 gene (Gene ID: 9616, updated on November 23, 2023, https: / / www.ncbi.nlm.nih.gov / gene / 9616) and the murine Rnf7 gene (Gene ID: 19823, updated on November 23, 2023, https: / / www.ncbi.nlm.nih.gov / gene / 19823) encode the RNF7 protein in cells. The above genes are hereby incorporated by reference into the present invention in their entirety.

[0093] (Reagents targeting the gene or its expression product)

[0094] In some embodiments, a reagent targeting the Ube2f gene or its expression product, a reagent targeting the Cul5 gene or its expression product, or a reagent targeting the Rnf7 gene or its expression product can recognize and bind to the Ube2f gene or its expression product, the Cul5 gene or its expression product, or the Rnf7 gene or its expression product. In some embodiments, a reagent targeting the Ube2f gene or its expression product, a reagent targeting the Cul5 gene or its expression product, or a reagent targeting the Rnf7 gene or its expression product can modulate the level or activity of the Ube2f gene or its expression product, the Cul5 gene or its expression product, or the Rnf7 gene or its expression product. In some specific embodiments, a reagent targeting the Ube2f gene or its expression product, a reagent targeting the Cul5 gene or its expression product, or a reagent targeting the Rnf7 gene or its expression product can reduce the level or activity of the Ube2f gene or its expression product, the Cul5 gene or its expression product, or the Rnf7 gene or its expression product. In some specific embodiments, a reagent targeting the Ube2f gene or its expression product, a reagent targeting the Cul5 gene or its expression product, or a reagent targeting the Rnf7 gene or its expression product can silence the Ube2f gene or its expression product, the Cul5 gene or its expression product, or the Rnf7 gene or its expression product.

[0095] In other embodiments, a reagent targeting the Ube2f gene or its expression product, a reagent targeting the Cul5 gene or its expression product, or a reagent targeting the Rnf7 gene or its expression product reduces or eliminates the expression and / or function of the Ube2f gene, Cul5 gene, or Rnf7 gene (e.g., in immune cells, specifically T cells). Exemplarily, the T cells do not contain the Ube2f gene, Cul5 gene, or Rnf7 gene, or the biological functions of the expression products of the Ube2f gene, Cul5 gene, or Rnf7 gene in the T cells are inhibited. In some specific embodiments, compared with immune cells (such as T cells) not treated with a reagent targeting the Ube2f gene or its expression product, a reagent targeting the Cul5 gene or its expression product, or a reagent targeting the Rnf7 gene or its expression product, the expression or function of the Ube2f gene, Cul5 gene, or Rnf7 gene in immune cells (such as T cells) treated with a reagent targeting the Ube2f gene or its expression product, a reagent targeting the Cul5 gene or its expression product, or a reagent targeting the Rnf7 gene or its expression product is reduced by at least 10%, 20%, 30%, 40%, 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100%.

[0096] In the present invention, a reagent targeting the Ube2f gene or its expression product, a reagent targeting the Cul5 gene or its expression product, or a reagent targeting the Rnf7 gene or its expression product can be a reagent used in at least one of gene knockout technology, gene silencing technology, inactivating mutation technology, PROTAC technology, or can be a small molecule inhibitor.

[0097] In some embodiments, a reagent targeting the Ube2f gene or its expression product, a reagent targeting the Cul5 gene or its expression product, or a reagent targeting the Rnf7 gene or its expression product is selected from, but not limited to: at least one of nucleic acids, polypeptides, ribonucleoprotein complexes (RNPs), or small molecule inhibitors.

[0098] Nucleic Acid

[0099] In some embodiments, the nucleic acid is selected from DNA, RNA, DNA / RNA.

[0100] In some specific embodiments, the nucleic acid includes at least one of antisense RNA molecules and RNA interference molecules.

[0101] "Antisense RNA molecule" refers to an RNA molecule that is complementary to an mRNA transcript, regardless of length. An antisense RNA molecule is a single-stranded RNA molecule that can be introduced into a cell, tissue, or subject and that causes a decrease in the expression of an endogenous target gene product through a mechanism that depends on the degradation of the target mRNA transcript mediated by ribonuclease H rather than on an endogenous gene silencing pathway. In some embodiments, the antisense nucleic acid comprises a modified backbone, such as phosphorothioate, phosphorodithioate, or other backbones known in the art, or may comprise non-natural internucleoside linkages. In some embodiments, the antisense nucleic acid may comprise locked nucleic acid (LNA).

[0102] "RNA interference molecule" refers to an RNA polynucleotide that mediates a decrease in the expression of an endogenous target gene product by degrading the target mRNA through an endogenous gene silencing pathway (e.g., Dicer and RNA-induced silencing complex (RISC)). Exemplary RNA interference molecules include microRNA (also referred to herein as "miRNA"), short hairpin RNA (shRNA), small interfering RNA (siRNA), RNA aptamer, and morpholino.

[0103] In some specific embodiments, the siRNA comprises a sense strand and an antisense strand; wherein the sense strand and the antisense strand are complementary and together form an RNA dimer; and, the antisense strand is capable of hybridizing or being complementary to a target sequence in the Ube2f gene or its expression product, the Cul5 gene or its expression product, or the Rnf7 gene or its expression product. In some specific embodiments, the siRNA can specifically bind to a target sequence in the Ube2f gene or its expression product, the Cul5 gene or its expression product, or the Rnf7 gene or its expression product.

[0104] In some specific embodiments, the shRNA is obtained by vector expression, for example, by cloning a DNA fragment that can transcribe the shRNA into a viral expression vector and then expressing it. The shRNA includes a sense strand fragment and an antisense strand fragment, as well as a stem-loop structure connecting the sense strand fragment and the antisense strand fragment. The sequences of the sense strand fragment and the antisense strand fragment are complementary, and the sequence of the antisense strand is complementary or hybridizable to the transcript sequence of the target sequence in the Ube2f gene, the Cul5 gene, or the Rnf7 gene. After digestion by an enzyme, the shRNA can become siRNA, thereby specifically regulating the level or activity of the Ube2f gene or its expression product, the Cul5 gene or its expression product, or the Rnf7 gene or its expression product.

[0105] Those skilled in the art should understand that when targeting the Ube2f gene or its expression product, the Cul5 gene or its expression product, or the Rnf7 gene or its expression product, effective siRNA or shRNA can be designed and prepared according to the principles of interfering RNA design well-known in the art.

[0106] Polypeptide

[0107] In some embodiments, the polypeptide is selected from at least one of: an antibody or an antigen-binding fragment thereof, a protein containing one or more zinc finger binding domains and an enzyme domain (zinc finger system, or artificial zinc finger nuclease (Zinc Finger Nucleases, ZFN)), a protein containing a transcription activator-like effector (TALE) nuclease domain and an enzyme domain (TALEN system).

[0108] Ribonucleoprotein Complex (RNP)

[0109] In some embodiments, the RNP is selected from: the CRISPR / cas system.

[0110] In some specific embodiments, the CRISPR / cas system comprises a nucleic acid molecule and an enzyme protein, wherein the nucleic acid molecule is a guide RNA (gRNA) molecule, and the enzyme protein is a Cas protein or a Cas ortholog.

[0111] In some alternative embodiments, the enzyme protein is selected from Cas9, Cas12a, Cas12b, Cas13a, Cas13b, Cas13c, Cas13e, or Cas13f protein or its ortholog.

[0112] In some embodiments, the CRISPR / cas system includes any one of the following:

[0113] (i) The targeting domain sequence in the guide RNA (gRNA) targeting the Ube2f gene is complexed with a first Cas endonuclease protein to form a first ribonucleoprotein (RNP) complex;

[0114] (ii) The targeting domain sequence in the guide RNA (gRNA) targeting the Cul5 gene is complexed with a second Cas endonuclease protein to form a second ribonucleoprotein (RNP) complex; and

[0115] (iii) The targeting domain sequence in the guide RNA (gRNA) targeting the Rnf7 gene is complexed with a third Cas endonuclease protein to form a third ribonucleoprotein (RNP) complex.

[0116] In some embodiments, in the CRISPR / Cas system of the present invention, the nucleic acid binding segment in the guide RNA (gRNA) targeting the Ube2f gene binds to a target DNA sequence having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to the DNA sequence encoded by the Ube2f gene of a subject (e.g., NCBI Gene ID: 140739 or Gene ID: 67921); the nucleic acid binding segment in the guide RNA (gRNA) targeting the Cul5 gene binds to a target DNA sequence having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to the DNA sequence encoded by the Cul5 gene of a subject (e.g., NCBI Gene ID: 8065 or Gene ID: 75717); the nucleic acid binding segment in the guide RNA (gRNA) targeting the Rnf7 gene binds to a target DNA sequence having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to the DNA sequence encoded by the Rnf7 gene of a subject (e.g., NCBI Gene ID: 9616 or Gene ID: 19823).

[0117] In some specific embodiments, in the CRISPR / Cas system of the present invention, the targeting domain in the guide RNA (gRNA) targeting the Ube2f gene comprises the sequence TCCCGATGCCTACAACATGG (SEQ ID NO: 3) or a sequence having at least 85%, 90%, 95% identity to SEQ ID NO: 3; the targeting domain in the guide RNA (gRNA) targeting the Cul5 gene comprises the sequence AGGCATATATTGTTGAATGG (SEQ ID NO: 4) or a sequence having at least 85%, 90%, 95% identity to SEQ ID NO: 4; the targeting domain of the guide RNA (gRNA) targeting the Rnf7 gene comprises the sequence TGCATCGCTTACCCATCACC (SEQ ID NO: 5) or a sequence having at least 85%, 90%, 95% identity to SEQ ID NO: 5.

[0118] Small Molecule Inhibitor

[0119] In some specific embodiments, the reagents targeting the Ube2f gene or its expression product, the reagents targeting the Cul5 gene or its expression product, or the reagents targeting the Rnf7 gene or its expression product comprise small molecule inhibitors, which can reduce or silence the level or activity of the Ube2f gene or its expression product, the Cul5 gene or its expression product, or the Rnf7 gene or its expression product.

[0120] In the present invention, the term "small molecule" refers to a low molecular weight compound, which can be synthetically produced or obtained from natural sources, and has a molecular weight of less than 2000 Daltons (Da), less than 1500 Da, less than 1000 Da, less than 900 Da, less than 800 Da, less than 700 Da, less than 600 Da or less than 500 Da.

[0121] In some embodiments, the small molecule inhibitor can be an organic compound, an inorganic compound, or a composition of organic and / or inorganic compounds. In some specific embodiments, the small molecule inhibitor is an active substance or compound prepared chemically. Generally, these compounds are synthesized in a classical manner through chemical reactions between different organic and / or inorganic compounds.

[0122] In some embodiments, the small molecule inhibitor can exert its activity in the form in which it is administered, or the small molecule inhibitor can be a prodrug. Thus, "small molecule inhibitor" encompasses both the active form and the prodrug.

[0123] The term "prodrug" refers to a compound or substance that is converted into a therapeutically active agent under physiological conditions. In some embodiments, a prodrug is a compound or substance that is metabolized into a pharmaceutically active form in the body of a subject after administration (e.g., through enzymatic activity in the body of the subject).

[0124] The term "small molecule inhibitor" also encompasses its pharmaceutically acceptable salts. The term "pharmaceutically acceptable salts" refers to any salt form of the small molecule inhibitor that is safe and effective for administration to a subject and that has the desired biological, pharmaceutical, and / or therapeutic activity. Pharmaceutically acceptable salts include salts of acidic or basic groups. Pharmaceutically acceptable acid addition salts can include, but are not limited to, hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, mesylate, esylate, benzenesulfonate, p-toluenesulfonate, and pamoate (i.e., 1,1'-methylene-bis-(2-hydroxy-3-naphthoate)). Suitable base salts can include, but are not limited to, aluminum, calcium, lithium, magnesium, potassium, sodium, zinc, and diethanolamine salts.

[0125] (Immune cells, immune cell exhaustion)

[0126] In the present invention, the immune cells include T cells, NKT cells, NK cells, innate lymphoid cells (ILC), or other immune cells with anti-infection ability, and, chimeric antigen receptor NK cells (CAR-NK cells) or other therapeutic immune cells expressing non-natural antigen receptors, but are not limited thereto.

[0127] In the present invention, the term "T cell" includes naive T cells, αβ T cells, γδ T cells, CD4 + T cells, CD8 + T cells, memory T cells, activated T cells, exhausted T cells, tolerant T cells, chimeric antigen receptor T cells (CAR-T cells), T cell receptor T cells (TCR-T cells), and antigen-specific T cells, but are not limited thereto.

[0128] In some specific embodiments, the T cells include activated T cells.

[0129] In some specific embodiments, the T cells include CD8 + T cells.

[0130] In some specific embodiments, the T cells include antigen-specific T cells.

[0131] In some specific embodiments, the antigen-specific T cells are antigen-specific T cells against the pathogen causing the infection.

[0132] In some embodiments, the T cells include exhausted T cells.

[0133] In the present invention, immune cell depletion refers to a pathological state in which the number of certain immune cells in the body's immune system is significantly reduced or their functions are impaired, resulting in a decline in the body's immune function.

[0134] In the present invention, the term "exhausted T cells" or "T cell exhaustion" refers to dysfunctional T cells, and the progressive loss of effector function of exhausted T cells during infection.

[0135] In some specific embodiments, preventing and / or reversing T cell exhaustion includes: inhibiting T cells from entering the contraction phase, keeping T cells in the expansion phase, enhancing the T cell expansion ability, enhancing the T cell persistence, and / or enhancing the formation of memory T cells.

[0136] In the present invention, the "expansion phase" refers to the stage in which T cells undergo an immune response after contacting an antigen or other stimulating factors. In this stage, the number of T cells will increase rapidly to counter the antigenic stimulation. This stage is one of the key links in the T cell immune response.

[0137] In the present invention, the "contraction phase" refers to a stage in the T cell immune response, in which the number of T cells will be significantly reduced. This stage usually occurs after the T cell expansion phase and is a key stage in T cell differentiation.

[0138] In the present invention, "persistence" refers to the lifespan and stability of T cells. T cells with strong persistence can survive for a long time and maintain a certain immune function, which helps to maintain long-term immune memory. T cells with weak persistence are prone to death, and new T cells need to be continuously replenished to maintain the function of the immune system.

[0139] In some embodiments, the immune cells are from a subject. In some specific embodiments, the subject is a human or a non-human animal.

[0140] In some specific embodiments, the subject has an infection.

[0141] In some specific embodiments, the immune cells include antigen-specific immune cells against the pathogen causing the infection in a subject with an infection.

[0142] (Infection)

[0143] As used herein, the term "infection" refers to the invasion of a subject's cells, tissues, and / or organs by pathogens such as bacteria, viruses, fungi, worms, or protozoa. In some embodiments, the pathogen can grow, reproduce, and / or produce toxins in the subject's cells, tissues, and / or organs. In some embodiments, the subject can respond to the pathogen (e.g., an allergic reaction or an immune response). Examples of infections include, but are not limited to, bacterial infections, viral infections, fungal infections, parasitic infections, and protozoal infections.

[0144] In some embodiments, the infection is an acute infection. In other embodiments, the infection is a chronic infection.

[0145] In some embodiments, the infection is a viral infection, and in other embodiments, the infection is a bacterial infection.

[0146] In some embodiments, chronic infection refers to the persistence of a pathogen in the body after an acute infection or a latent infection. In some embodiments, the chronic infection is a chronic infection in a subject. In some embodiments, the subject is a human or a non-human animal.

[0147] In the present invention, preventing and / or treating an infection includes preventing and / or treating infectious diseases and / or diseases and / or symptoms associated with the infection, and / or enhancing the subject's ability to resist infection.

[0148] In some embodiments, the diseases and / or symptoms associated with the infection are one or more selected from the group consisting of: pathological damage caused by the infection; immune cell exhaustion after the infection, including reduced proliferation ability, weakened killing ability, and reduced cytokine secretion of immune cells; endotoxin shock or death; inflammatory damage to organs; multiple organ failure, for example, the organs are selected from: liver, spleen, brain, kidney, heart, lung, stomach, intestine; acute and / or chronic inflammatory diseases caused by the infection (e.g., autoimmune diseases such as inflammatory bowel disease, rheumatoid arthritis, systemic lupus erythematosus, chronic nephritis, tuberculosis, chronic gastrointestinal diseases).

[0149] In some embodiments, enhancing the subject's ability to resist infection includes enhancing the anti-infection ability of immune cells in the subject, and / or preventing and / or reversing immune cell exhaustion in the subject.

[0150] (Product)

[0151] In the present invention, the product can be a pharmaceutical composition, a kit, a reagent, or a reagent kit.

[0152] <Modified Immune Cells and Their Use in Treating Infections>

[0153] In some aspects of the present invention, there is provided a modified immune cell, which is an immune cell treated with a reagent targeting the Ube2f gene, Cul5 gene, or Rnf7 gene or their expression products as described above.

[0154] In the present invention, the immune cells include T cells, NKT cells, NK cells, innate lymphoid cells (ILCs), or other immune cells with anti-infection ability, as well as chimeric antigen receptor NK cells (CAR-NK cells) or other therapeutic immune cells expressing non-natural antigen receptors, but are not limited thereto.

[0155] In the present invention, the term "T cell" includes naive T cells, αβ T cells, γδ T cells, CD4 + T cells, CD8 + T cells, memory T cells, activated T cells, exhausted T cells, tolerant T cells, chimeric antigen receptor T cells (CAR-T cells), T cell receptor T cells (TCR-T cells), and antigen-specific T cells, but are not limited thereto.

[0156] In some embodiments, the T cells include activated T cells.

[0157] In some embodiments, the T cells include CD8 + T cells.

[0158] In some embodiments, the T cells include antigen-specific T cells.

[0159] In some embodiments, the antigen-specific T cells are antigen-specific T cells against the pathogen causing the infection. Wherein, the infection is the infection as described above.

[0160] In some embodiments, the T cells include exhausted T cells.

[0161] In some embodiments, the immune cells are from a subject. In some specific embodiments, the subject is a human or non-human animal.

[0162] In some specific embodiments, the subject has an infection. In some specific embodiments, the immune cells include antigen-specific immune cells against the pathogen causing the infection in a subject with an infection.

[0163] In some aspects of the present invention, there is provided the use of modified T cells in the preparation of a product for preventing and / or treating an infection, wherein the modified T cells are T cells treated with a reagent targeting the Ube2f gene, Cul5 gene, or Rnf7 gene or their expression products as described above.

[0164] In some specific embodiments, a reagent targeting the Ube2f gene or its expression product, a reagent targeting the Cul5 gene or its expression product, or a reagent targeting the Rnf7 gene or its expression product reduces or eliminates the expression and / or function of the Ube2f gene, Cul5 gene, or Rnf7 gene in the modified T cells. Exemplarily, the modified T cells do not contain the Ube2f gene, Cul5 gene, or Rnf7 gene, or the biological functions of the expression products of the Ube2f gene, Cul5 gene, or Rnf7 gene in the T cells are inhibited. In some specific embodiments, compared with T cells (unmodified T cells) not treated with a reagent targeting the Ube2f gene or its expression product, a reagent targeting the Cul5 gene or its expression product, or a reagent targeting the Rnf7 gene or its expression product, the expression or function of the Ube2f gene, Cul5 gene, or Rnf7 gene in the modified T cells treated with a reagent targeting the Ube2f gene or its expression product, a reagent targeting the Cul5 gene or its expression product, or a reagent targeting the Rnf7 gene or its expression product is reduced by at least 30%, 40%, 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100%.

[0165] (Treatment method)

[0166] In the present invention, there are no special limitations on the method of treating immune cells with a reagent targeting the Ube2f gene or its expression product, a reagent targeting the Cul5 gene or its expression product, or a reagent targeting the Rnf7 gene or its expression product. For example, it can be to introduce a reagent targeting the Ube2f gene or its expression product, a reagent targeting the Cul5 gene or its expression product, and / or a reagent targeting the Rnf7 gene or its expression product into the immune cells. In some exemplary embodiments, treating immune cells with a reagent targeting the Ube2f gene or its expression product, a reagent targeting the Cul5 gene or its expression product, or a reagent targeting the Rnf7 gene or its expression product can be to introduce a nucleotide carrying one or more components capable of expressing a reagent targeting the Ube2f gene or its expression product, a reagent targeting the Cul5 gene or its expression product, or a reagent targeting the Rnf7 gene or its expression product into the immune cells by techniques known to those skilled in the art.

[0167] In some embodiments, the vector used is a viral vector, viroid vector, or non-viral vector. In some embodiments, a recombinant vector of a polynucleotide comprising one or more components of a reagent targeting the Ube2f gene or its expression product, a reagent targeting the Cul5 gene or its expression product, or a reagent targeting the Rnf7 gene or its expression product (e.g., components for reducing or eliminating the expression and / or function of the Ube2f gene, Cul5 gene, and Rnf7 gene in immune cells, such as sgRNA, Cas protein, etc.) is a viral vector. Suitable viral vectors include, but are not limited to, viral vectors based on: vaccinia virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retroviral vectors (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous sarcoma virus, Harvey sarcoma virus, avian leukosis virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus), etc. Suitable non-viral vectors are selected from transposons, lipid nanoparticles, liposomes, exosomes, attenuated bacteria, or virus-like particles.

[0168] In some embodiments, the polynucleotide sequence of a reagent targeting the Ube2f gene or its expression product, a reagent targeting the Cul5 gene or its expression product, or a reagent targeting the Rnf7 gene or its expression product is operably linked to a control element, such as a transcriptional control element, such as a promoter. The transcriptional control element can be functional in eukaryotic cells (e.g., mammalian cells) or prokaryotic cells (e.g., bacterial or archaeal cells). In some embodiments, the polynucleotide sequence of a reagent targeting the Ube2f gene or its expression product, a reagent targeting the Cul5 gene or its expression product, or a reagent targeting the Rnf7 gene or its expression product is operably linked to multiple control elements that allow the polynucleotide to be expressed in both prokaryotic and eukaryotic cells. Depending on the cell type and gene regulation system used, any of many suitable transcriptional and translational control elements (including constitutive and inducible promoters, transcriptional enhancer elements, transcriptional terminators, etc.) can be used in the expression vector.

[0169] In some embodiments, non-limiting examples of suitable eukaryotic promoters (promoters that function in eukaryotic cells) include those from cytomegalovirus (CMV) immediate early, herpes simplex virus (HSV) thymidine kinase, early and late SV40, long terminal repeats (LTRs) from retroviruses, and mouse metallothionein 1. The selection of suitable vectors and promoters is well within the ability of those of ordinary skill in the art. The expression vector may also contain a ribosome binding site for translation initiation and a transcription terminator. The expression vector may also include appropriate sequences for amplification of expression. The expression vector may also contain a nucleotide sequence encoding a protein tag (e.g., 6×His tag, hemagglutinin tag, green fluorescent protein, etc.) fused to the site-specifically modified polypeptide, thereby producing a chimeric polypeptide.

[0170] (Method and culture for obtaining immune cells).

[0171] In the present invention, there is no particular limitation in principle for the method of obtaining immune cells. Exemplarily, peripheral blood mononuclear cells can be isolated from the peripheral blood of a subject, and immune cells with a specific phenotype can be isolated by, for example, magnetic bead sorting, flow cytometry sorting techniques.

[0172] In some embodiments, in the present disclosure, there is no particular limitation in principle for the method of culturing immune cells. In some embodiments, immune cells can be implanted into a subject for expansion, and the expanded recombinant immune cells in vivo can be obtained. The modified immune cells obtained after expansion from the first-generation subject can be used for autologous treatment of the subject or for allogeneic treatment of other subjects. In some embodiments, the immune cells are autologous immune cells or allogeneic immune cells for the subject. In some embodiments, the immune cells can also be expanded in vitro.

[0173] <Composition>

[0174] In another aspect, the present disclosure provides a composition. In some embodiments, the "composition" is a preparation comprising at least one of (a) the reagent targeting the Ube2f gene or its expression product described above; (b) the reagent targeting the Cul5 gene or its expression product; (c) the reagent targeting the Rnf7 gene or its expression product; and (d) the modified immune cells described above, which can be administered or delivered to a subject or cells. The composition can (i) prevent and / or treat infection; (ii) enhance the anti-infection ability of immune cells; (iii) prevent and / or reverse immune cell exhaustion.

[0175] "Therapeutic composition" or "pharmaceutical composition" (used interchangeably herein) is a composition comprising (a) a reagent targeting the Ube2f gene or its expression product as described above; (b) a reagent targeting the Cul5 gene or its expression product; (c) a reagent targeting the Rnf7 gene or its expression product; and (d) at least one of the modified immune cell species as described above, which can be administered to a subject to treat an infection. In some alternative embodiments, the composition for treating a disease further comprises a pharmaceutically acceptable carrier.

[0176] <Method>

[0177] In some embodiments, the present disclosure provides a method for treating an infection in a subject in need thereof. The method comprises administering to the subject a reagent targeting the Ube2f gene or its expression product, a reagent targeting the Cul5 gene or its expression product, and / or a reagent targeting the Rnf7 gene or its expression product as described above, or administering to the subject the modified immune cell as described above, or administering to the subject the composition or pharmaceutical composition as described above.

[0178] In some embodiments, the present disclosure provides a method for enhancing the anti-infection ability of immune cells, which comprises the step of treating immune cells with a reagent targeting the Ube2f gene or its expression product, a reagent targeting the Cul5 gene or its expression product, and / or a reagent targeting the Rnf7 gene or its expression product as described above.

[0179] In some embodiments, the present disclosure provides a method for preventing and / or reversing immune cell exhaustion, which comprises the step of treating immune cells with a reagent targeting the Ube2f gene or its expression product, a reagent targeting the Cul5 gene or its expression product, and / or a reagent targeting the Rnf7 gene or its expression product as described above.

[0180] Examples

[0181] The embodiments of the present invention will be described in detail below in conjunction with examples. However, those skilled in the art will understand that the following examples are only for illustrating the present invention and should not be construed as limiting the scope of the present invention. For those not specified in the examples, conventional conditions or conditions recommended by the manufacturer are used. Those reagents or instruments not specified by the manufacturer can be obtained as conventional products through commercial purchase.

[0182] Example 1. Preparation of recombinant T cells with knockout of Ube2f, Cul5 and Rnf7

[0183] 1. Construction of gene knockout vectors

[0184] In this example, retrovirus-based sgRNA expression vectors were constructed, namely pMSCV-sgUbe2f-Thy1.1, pMSCV-sgCul5-Thy1.1, pMSCV-sgRnf7-Thy1.1, pMSCV-sgControl-Thy1.1, and pMSCV-sgControl-GFP.

[0185] Among them, the vector pMSCV-sgControl-Thy1.1 (SEQ ID NO:1), where the 1686-1705th positions are the random sequence SEQ ID NO:2 that does not target any gene, and is called sgNon-targeting or sgControl as a control for not knocking out any gene;

[0186] The vector pMSCV-sgUbe2f-Thy1.1, the sequence of this vector is the sequence obtained by replacing the 1686-1705th positions of SEQ ID NO:1 with SEQ ID NO:3, and keeping other sequences unchanged. SEQ ID NO:3 is the target sequence recognition region of sgUbe2f for knocking out Ube2f, and is used to knock out Ube2f;

[0187] The vector pMSCV-sgCul5-Thy1.1, the sequence of this vector is the sequence obtained by replacing the 1686-1705th positions of SEQ ID NO:1 with SEQ ID NO:4, and keeping other sequences unchanged. SEQ ID NO:4 is the target sequence recognition region of sgCul5 for knocking out Cul5, and is used to knock out Cul5;

[0188] The vector pMSCV-sgRnf7-Thy1.1, the sequence of this vector is the sequence obtained by replacing the 1686-1705th positions of SEQ ID NO:1 with SEQ ID NO:5, and keeping other sequences unchanged. SEQ ID NO:5 is the target sequence recognition region of sgRnf7 for knocking out Rnf7, and is used to knock out Rnf7;

[0189] The vector pMSCV-sgControl-GFP, the sequence of this vector is the sequence obtained by replacing the Th1.1 expression sequence at positions 2079-2615 of SEQ ID NO:1 with the EGFP expression sequence (SEQ ID NO:6).

[0190] All vectors were obtained by total gene synthesis.

[0191] The sgRNAs used above are shown in Table 2 below:

[0192] Table 2 Target sequence recognition regions of sgRNAs

[0193]

[0194] 2. Isolation and activation of naïve P14 cells

[0195] Naïve CD8 + T cells were isolated from the spleens of Cas9 + P14 transgenic mice (obtained by crossing JAX:#037394 and #026430 from Jaxson Laboratory), and the cells were resuspended in 2 ml of RPMI1640 medium (containing 5% fetal bovine serum and interleukin-2). Meanwhile, the polypeptide gp33-41 (Qiangyao Biotech, Cat#04010023714; a polypeptide composed of 9 amino acid residues, which is the optimal sequence in the GP1 epitope of lymphocytic choriomeningitis virus, with the sequence KAVYNFATC; SEQ ID NO:7) was added for in vitro activation. That is, the cells were cultured in an incubator at 37°C with 5% carbon dioxide. After 24 hours of culture, virus infection was carried out.

[0196] 3. Isolation and activation of naïve OT1 cells

[0197] Naïve CD8 + T cells were isolated from the spleens of Cas9 + OT1 transgenic mice (obtained by crossing JAX:#037394 and #003831 from Jaxson Laboratory), and the cells were resuspended in 2 ml of RPMI1640 medium (containing 5% fetal bovine serum and interleukin-2). Meanwhile, the polypeptide OVA257-264 (synthesized by Qiangyao Biotech; a polypeptide composed of 8 amino acid residues, which is the class I (Kb)-restricted peptide epitope of ovalbumin (OVA), with the sequence SIINFEKL; SEQ ID NO:8) was added for in vitro activation. That is, the cells were cultured in an incubator at 37°C with 5% carbon dioxide. After 24 hours of culture, virus infection was carried out.

[0198] 4. Construction of P14 cells with Ube2f gene knockout

[0199] 1) Preparation of retrovirus

[0200] 1×10 6After the Phoenix-Eco cells (ATCC#CRL-3214) were adherently cultured for 24 hours, 20 μg of the sgRNA expression vector pMSCV-sgUbe2f-Thy1.1 prepared in 1 above and 60 μg of the packaging plasmid pCL-Eco (purchased from Addgene#12371) were co-transfected using the Chemifect eukaryotic cell transfection reagent (Fengrui Biotech, Beijing). After 48 hours of transfection, the supernatant containing the packaged virus was harvested. The virus supernatant was filtered through a 0.45 μm filter membrane to remove dead cell impurities, obtaining the retrovirus supernatant, that is, the retrovirus with Ube2f knocked out.

[0201] 2) Infection with retrovirus particles

[0202] 1×10 6 amount of CD8 + T cells that had been in vitro cultured and activated for 36 hours in step 2 were added to 1 ml of the retrovirus supernatant obtained in step 1), mixed well, and then centrifuged at 2000×g horizontally at room temperature for 2 hours. Then it was placed in a carbon dioxide incubator and cultured for 4 hours, and then changed to 2 ml of fresh RPMI1640 medium (containing 5% fetal bovine serum and 2 ng / ml of interleukin-2) and continued to be cultured (this time was recorded as the time after infection). Thy1.1-positive cells (Thy1.1-biotin, BioLegend#202510) were sorted out using flow cytometry, that is, the P14 cells with Ube2f knocked out were obtained (denoted as Thy1.1-sgUbe2f-P14).

[0203] 5. Construction of P14 cells with Cul5 knocked out

[0204] The difference from "4. Construction of P14 cells with Ube2f gene knocked out" is only that "sgRNA expression vector pMSCV-sgUbe2f-Thy1.1" was replaced with "sgRNA expression vector pMSCV-Cul5-Thy1.1", and other steps remained unchanged, obtaining the P14 cells with Cul5 knocked out (denoted as Thy1.1-sgCul5-P14).

[0205] 6. Construction of P14 cells with Rnf7 knocked out

[0206] The difference from "4. Construction of P14 cells with Ube2f gene knocked out" is only that "sgRNA expression vector pMSCV-sgUbe2f-Thy1.1" was replaced with "sgRNA expression vector pMSCV-sgRnf7-Thy1.1", and other steps remained unchanged, obtaining the P14 cells with Rnf7 knocked out (denoted as Thy1.1-sgRnf7-P14).

[0207] 7. Construction of sgControl-P14 cells with unknocked-out genes

[0208] The difference from "4. Construction of P14 cells with knocked-out Ube2f gene" is only that: replace "sgRNA expression vector pMSCV-sgUbe2f-Thy1.1" with "sgRNA expression vector pMSCV-sgControl-Thy1.1", and keep other steps unchanged, to obtain P14 cells with unknocked-out genes (denoted as Thy1.1-sgControl-P14).

[0209] The difference from "4. Construction of P14 cells with knocked-out Ube2f gene" is only that: replace "sgRNA expression vector pMSCV-sgUbe2f-Thy1.1" with "sgRNA expression vector pMSCV-sgControl-GFP", and keep other steps unchanged, to obtain P14 cells with unknocked-out genes (denoted as GFP-sgControl-P14).

[0210] 8. Construction of OT1 cells with knocked-out Ube2f gene

[0211] The difference from "4. Construction of P14 cells with knocked-out Ube2f gene" is that: replace "P14 cells" with "OT1 cells", and keep other steps unchanged, to obtain OT1 cells with knocked-out Ube2f (denoted as Thy1.1-sgUbe2f-OT1).

[0212] 9. Construction of sgControl-OT1 cells with unknocked-out genes

[0213] The difference from "8. Construction of OT1 cells with knocked-out Ube2f" is only that: replace "sgRNA expression vector pMSCV-sgUbe2f-Thy1.1" with "sgRNA expression vector pMSCV-sgControl-Thy1.1", and keep other steps unchanged, to obtain OT1 cells with unknocked-out genes (denoted as Thy1.1-sgControl-OT1).

[0214] Example 2. Virus infection and titration

[0215] Lymphocytic choriomeningitis virus (LCMV) strains Armstrong and LCMV clone 13 each induce acute and chronic infections. LCMV replicates in BHK21[C13] cells ( CCL10). And titration is performed by plaque assay on VERO cells. Infect mice intravenously with LCMV clone 13 (2×10 6 PFU) or LCMV Armstrong (2×10 6Mice were intraperitoneally infected with LCMV (1×10

[0216] Example 3. Infection with Listeria expressing ovalbumin 257-264 peptide

[0217] Listeria expressing ovalbumin 257-264 peptide is hereinafter referred to as LM-OVA. LM-OVA was propagated in brain heart infusion medium supplemented with erythromycin. Mice were intravenously infected with LM-OVA (1×10 5 PFU). Mice infected with LM-OVA were housed in accordance with the institutional biosafety regulations of Tsinghua University. The bacterial load of LM-OVA in serum / organ / tissue samples was quantified by qPCR assay.

[0218] Example 4. Knockout of Cul5, Rnf7, and Ube2f respectively enhanced the expansion ability and persistence of CD8 + T cells during chronic infection with LCMV clone 13 virus

[0219] The cell re-infusion process is as shown in A of Figure 1 : CD8 + T cells were isolated from the spleen and lymph nodes of Cas9 + P14 transgenic mice and activated with the polypeptide gp33-41 for 24 hours to obtain activated CD8 + T cells (the method is the same as 2) in Example 1; then the retroviruses obtained by transfecting pMSCV-sgControl-Thy1.1, the retroviruses obtained by transfecting pMSCV-sgCul5-Thy1.1, the retroviruses obtained by transfecting pMSCV-sgRnf7-Thy1.1, the retroviruses obtained by transfecting pMSCV-sgUbe2f-Thy1.1, and the retroviruses obtained by transfecting pMSCV-sgControl-GFP were used to infect the activated CD8 + T cells respectively to obtain recombinant cells named Thy1.1-sgControl-P14, Thy1.1-sgCul5-P14, Thy1.1-sgRnf7-P14, Thy1.1-sgUbe2f-P14, and GFP-sgControl-P14 cells (the method is the same as 4-7 in Example 1). The above cells obtained after 24 hours of infection were respectively injected into the tail veins of C57bl / B6 mice (hereinafter referred to as B6 mice). The input method is as follows:

[0220] B6 mice at 6 - 8 weeks old with a body weight of 20 - 25 g were divided into 4 groups, namely sgControl (control) group (4 mice), sgCul5 group (4 mice), sgRnf7 group (4 mice), and sgUbe2f group (4 mice).

[0221] Mice were infected with LCMV clone 13 (the same method as in Example 2). On the second day after infection, P14 cells were transfused back into the mice according to the following groups.

[0222] sgControl (control) group: 10 5 prepared Thy1.1 - sgControl - P14 cells and GFP - sgControl - P14 cells were respectively formulated into cell suspensions with PBS, and after mixing them at a ratio of 1:1, they were transfused into each mouse in the sgControl group via the tail vein;

[0223] sgCul5 group: 10 5 prepared Thy1.1 - sgCul5 - P14 cells and GFP - sgControl - P14 cells were respectively formulated into cell suspensions with PBS, and after mixing them at a ratio of 1:1, they were transfused into each mouse in the sgCul5 group via the tail vein;

[0224] sgRnf7 group: 10 5 prepared Thy1.1 - sgRnf7 - P14 cells and GFP - sgControl - P14 cells were respectively formulated into cell suspensions with PBS, and after mixing them at a ratio of 1:1, they were transfused into each mouse in the sgRnf7 group via the tail vein;

[0225] sgUbe2f group: 10 5 prepared Thy1.1 - sgUbe2f - P14 cells and GFP - sgControl - P14 cells were respectively formulated into cell suspensions with PBS, and after mixing them at a ratio of 1:1, they were transfused into each mouse in the sgUbe2f group via the tail vein.

[0226] At 7 days, 14 days, 28 days, and 56 days after LCMV clone 13 infection respectively, the proportion of the un - knocked - out gene Thy1.1 - sgControl - P14 cells, Cul5 - knocked - out Thy1.1 - sgCul5 - P14 cells, Rnf7 - knocked - out Thy1.1 - sgRnf7 - P14 cells, and Ube2f - knocked - out Thy1.1 - sgUbe2f - P14 cells in the total CD8 + T cells transfused back into the peripheral blood of each mouse were analyzed by Thy1.1 antibody (with Thy1.1 screening label on the knockout vector) and GFP fluorescence flow cytometry, that is, the proliferation and persistence of the transfused P14 cells were monitored in the peripheral blood.

[0227] The results were asFigure 1 B in Figure 1 and C in + showed that during the chronic infection of LCMV clone 13, on day 7 post-infection, compared with Thy1.1 Figure 1 control P14 cells in the control group, the deletion of Cul5, Rnf7, and Ube2f enhanced the expansion of P14 cells in the blood; subsequently, on days 14 and 28 post-infection, the P14 cells in the sgControl (control) group gradually decreased and entered the contraction phase, while the deletion of Cul5, Rnf7, and Ube2f attenuated the decrease of P14 cells during the contraction phase; on day 56 post-infection, the P14 cells with the deletion of Cul5, Rnf7, and Ube2f were significantly increased compared with the P14 cells in the control group, indicating that the deletion of Cul5, Rnf7, and Ube2f enhanced the formation of memory P14 cells. Meanwhile, as

[0228] shown in Figure 1 D in

[0229] These data indicate that the deletion of Cul5, Rnf7, and Ube2f respectively during the chronic infection of LCMV clone 13 virus significantly promotes CD8+ T lymphocytes form memory cells.

[0230] Example 5: In an acute infection induced by LCMV-Armstrong, knocking out Cul5, Rnf7, and Ube2f significantly promoted the formation of memory cells in CD8 + T lymphocytes

[0231] The cell infusion process is as shown in Figure 2 A in: Isolate CD8 + T cells from the spleens and lymph nodes of Cas9 + P14 transgenic mice, activate them with the polypeptide gp33-41 for 24 hours to obtain activated CD8 + T cells (the method is the same as 2 in Example 1); then, the retroviruses obtained by transfecting pMSCV-sgControl-Thy1.1, the retroviruses obtained by transfecting pMSCV-sgCul5-Thy1.1, the retroviruses obtained by transfecting pMSCV-sgRnf7-Thy1.1, the retroviruses obtained by transfecting pMSCV-sgUbe2f-Thy1.1, and the retroviruses obtained by transfecting pMSCV-sgControl-GFP are respectively used to infect the activated CD8 + T cells to obtain recombinant cells named Thy1.1-sgControl-P14, Thy1.1-sgCul5-P14, Thy1.1-sgRnf7-P14, Thy1.1-sgUbe2f-P14, and GFP-sgControl-P14 cells (the method is the same as 4-7 in Example 1). The above cells obtained after 24 hours of infection are respectively injected into B6 mice via the tail vein. The specific input method is as follows:

[0232] Divide 6-8-week-old B6 mice weighing 20-25 g into 4 groups, namely the sgControl (control) group (5 mice), the sgCul5 group (4 mice), the sgRnf7 group (4 mice), and the sgUbe2f group (4 mice).

[0233] sgControl (control) group: Respectively prepare cell suspensions of 10 5 prepared Thy1.1-sgControl-P14 cells and GFP-sgControl-P14 cells with PBS, mix them at a ratio of 1:1, and then re-infuse them into each mouse in the sgControl group via the tail vein;

[0234] sgCul5 group: Respectively prepare 10 5The prepared Thy1.1-sgCul5-P14 cells and GFP-sgControl-P14 cells were made into cell suspensions with PBS, and after mixing them at a ratio of 1:1, they were transfused into each mouse in the sgCul5 group via the tail vein;

[0235] sgRnf7 group: Respectively, 10 5 prepared Thy1.1-sgRnf7-P14 cells and GFP-sgControl-P14 cells were made into cell suspensions with PBS, and after mixing them at a ratio of 1:1, they were transfused into each mouse in the sgRnf7 group via the tail vein;

[0236] sgUbe2f group: Respectively, 10 5 prepared Thy1.1-sgUbe2f-P14 cells and GFP-sgControl-P14 cells were made into cell suspensions with PBS, and after mixing them at a ratio of 1:1, they were transfused into each mouse in the sgUbe2f group via the tail vein.

[0237] At 7 days, 14 days, 28 days, and 35 days after LCMV-Armstrong infection respectively, using Thy1.1 antibody (the knockout vector carried the Thy1.1 screening label) and GFP fluorescence flow cytometry to analyze the proportion of unknocked-out gene Thy1.1-sgControl-P14 cells, Cul5-knocked-out Thy1.1-sgCul5-P14 cells, Rnf7-knocked-out Thy1.1-sgRnf7-P14 cells, and Ube2f-knocked-out Thy1.1-sgUbe2f-P14 cells in the peripheral blood of each mouse among the total CD8 + T cells, that is, to monitor the proliferation, contraction, and persistence of the input P14 cells in the blood and spleen.

[0238] The results are as Figure 2 shown in B and Figure 2 shown in C. During the acute LCMV-Armstrong infection, on the 7th day after infection, compared with the Thy1.1 + control P14 cells in the control group, the deletion of Cul5, Rnf7, and Ube2f enhanced the amplification of P14 cells in the blood; subsequently, on the 14th and 28th days after infection, the P14 cells in the sgControl (control) group gradually decreased and entered the contraction phase, and the deletion of Cul5, Rnf7, and Ube2f weakened the decrease of P14 cells in the contraction phase; on the 35th day after infection, the P14 cells with the deletion of Cul5, Rnf7, and Ube2f were significantly increased compared with the P14 cells in the control group, indicating that it enhanced the formation of memory P14 cells. At the same time, as Figure 2As shown in B of [reference], in the sgCul5 group, sgRnf7 group, and sgUbe2f group, the proportion change trend of GFP-sgControl-P14 cells was similar to that of GFP-sgControl-P14 cells in the control group, that is, from day 14 to day 35 after infection, GFP-sgControl-P14 cells began to enter the contraction phase and gradually decreased, while the proportion of P14 cells lacking Cul5, Rnf7, and Ube2f in the same mouse was significantly higher than that of control sgControl-P14 cells on day 7, and from day 14 to 35, the contraction rate of P14 cells lacking Cul5, Rnf7, and Ube2f was significantly lower than that of control sgControl-P14 cells in the same mouse. By day 35, the proportion of P14 cells lacking Cul5, Rnf7, and Ube2f was 10 - 20 times that of control sgControl-P14 cells of the same host. This result further indicates that the deletion of Cul5, Rnf7, and Ube2f enhances the expansion ability and persistence of CD8+ T cells during the acute infection of LCMV-Armstrong.

[0239] The results are as Figure 2 shown in D of [reference] and Figure 2 E of [reference]. At 35 days after LCMV-Armstrong infection, in the spleen of mice, compared with Thy1.1 + control P14 cells in the control group, the proportion and number of P14 cells lacking Cul5, Rnf7, and Ube2f were significantly increased. These data suggest that the knockout of Cul5, Rnf7, and Ube2f respectively during the acute infection of LCMV-Armstrong virus significantly promotes the formation of memory cells by CD8 + T lymphocytes.

[0240] Example 6: In the acute infection induced by LM-OVA, the knockout of Ube2f significantly promotes the formation of memory cells by CD8 + T lymphocytes

[0241] CD8 + T cells were isolated from the spleen and lymph nodes of Cas9 + OT1 transgenic mice and activated with the polypeptide OVA257-264 for 24 hours to obtain activated CD8 + T cells (the method is the same as 3 in Example 1); then the retroviruses obtained by transfecting pMSCV-sgControl-Thy1.1 and the retroviruses obtained by transfecting pMSCV-sgUbe2f-Thy1.1 were respectively used to infect the activated CD8 +T cells were obtained, and the recombinant cells were named Thy1.1-sgControl-OT1 and Thy1.1-sgUbe2f-OT1 (the method was the same as steps 8-9 in Example 1). The above cells obtained after 24 hours of infection were respectively intravenously injected into B6 mice through the tail vein, and the specific injection method was as follows:

[0242] Six- to eight-week-old B6 mice weighing 20-25 g were divided into 4 groups, namely the control (sgControl) group (5 mice) and the sgUbe2f group (4 mice).

[0243] Control (sgControl) group: 10 5 prepared Thy1.1-sgControl-OT1 cells were formulated into a cell suspension with PBS and intravenously infused back into each mouse in the sgControl group through the tail vein;

[0244] sgUbe2f group: 10 5 prepared Thy1.1-sgUbe2f-OT1 cells were formulated into a cell suspension with PBS and intravenously infused back into each mouse in the sgUbe2f group through the tail vein.

[0245] On the 45th day after LM-OVA infection, flow cytometry was used to analyze the proportion of the non-gene-knocked-out Thy1.1-sgControl-OT1 cells and the Ube2f-knocked-out Thy1.1-sgUbe2f-OT1 cells in the spleen of each mouse among the total CD8 + T cells. The results are shown in A in Figure 3 and B in Figure 3 . Compared with the control OT-1 cells, the proportion and the number of OT-1 cells lacking Ube2f in the spleen among CD8 + T cells were significantly increased. This result proves that in the acute infection induced by LM-OVA, knocking out Ube2f significantly promoted the formation of memory cells by CD8 + T lymphocytes.

[0246] Nucleotide sequence of vector pMSCV-sgControl-Thy1.1 (SEQ ID NO:1):

[0247] TTCGCACGATTGCACCTTGG GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTGAATTCGCTAGCTAGGTCTTGAAAGGAGTGGGAATTGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGATCCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGACCGGTTCTAGAGCGCTGCCACC ATGGCCACAACaATGGGTCTTTTCTGCAGTCACCGTCCTCGA GGCACCATGAACCCAGCCATCAGCGTCGCTCTCCTGCTCTCAGTCTTGCAGGTGTCCCGAGGGCAGAAGGTGACCA GCCTGACAGCCTGCCTGGTGAACCAAAACCTTCGCCTGGACTGCCGCCATGAGAATAACACCAAGGATAACTCCAT CCAGCATGAGTTCAGCCTGACCCGAGAGAAGAGGAAGCACGTGCTCTCAGGCACCCTTGGGATACCCGAGCACACG TACCGCTCCCGCGTCACCCTCTCCAACCAGCCCTATATCAAGGTCCTTACCCTAGCCAACTTCACCACCAAGGATG AGGGCGACTACTTTTGTGAGCTTCGCGTCTCGGGCGCGAATCCCATGAGCTCCAATAAAAGTATCAGTGTGTATAG AGACAAGCTGGTCAAGTGTGGCGGCATAAGCCTGCTGGTTCAGAACACATCCTGGATGCTGCTGCTGCTGCTTTCC CTCTCCCTCCTCCAAGCCCTGGACTTCATTTCTCTGTGA

[0248] Among them, the single-underlined part is sgControl; the double-underlined part is Thy1.1.

[0249] The nucleotide sequence encoding EGFP (SEQ ID NO: 6)

[0250] atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtctggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggcgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa

Claims

1. Use of a reagent targeting the Ube2f gene, Cul5 gene, or Rnf7 gene or their expression products for any of the following: (i) Use in the preparation of a product for preventing and / or treating infection; (ii) Use in the preparation of a product for enhancing the anti-infection ability of immune cells; (iii) Use in the preparation of a product for preventing and / or reversing immune cell exhaustion.

2. The use according to claim 1, wherein, The infection includes at least one of bacterial infection, viral infection, fungal infection, protozoan infection, and parasitic infection.

3. The use according to claim 1 or 2, wherein, The prevention and / or treatment of infection includes preventing and / or treating infectious diseases and / or diseases and / or symptoms related to infection, and / or enhancing the anti-infection ability of a subject; Optionally, the disease and / or symptom related to infection is one or more selected from the group consisting of: pathological damage caused by infection; immune cell exhaustion after infection, including reduced proliferation ability, weakened killing ability, and reduced cytokine secretion of immune cells; endotoxin shock or death; inflammatory damage of organs; multiple organ failure; acute and / or chronic inflammatory diseases caused by infection; Optionally, enhancing the anti-infection ability of a subject includes enhancing the anti-infection ability of immune cells in the subject, and / or preventing and / or reversing immune cell exhaustion in the subject.

4. Use according to any one of claims 1 to 3, wherein, The immune cells include at least one of T cells, NKT cells, NK cells, innate lymphoid cells (ILC), and chimeric antigen receptor NK cells (CAR-NK cells); Optionally, the T cells include naïve T cells, αβ T cells, γδ T cells, CD4 + T cells, CD8 + T cells, memory T cells, activated T cells, exhausted T cells, tolerant T cells, chimeric antigen receptor T cells (CAR-T cells), T cell receptor T cells (TCR-T cells), and at least one antigen-specific T cell; Optionally, the T cells include activated T cells; Optionally, the T cells include antigen-specific T cells, preferably, the antigen-specific T cells are antigen-specific T cells against the pathogen causing the infection; Optionally, the T cell comprises CD8 + T cell; Optionally, the T cells include exhausted T cells.

5. Use according to any one of claims 1 to 4, wherein, The immune cells are immune cells from a subject; and / or, the infection is an infection in the subject; Optionally, the subject is a human or non-human animal.

6. Use according to any one of claims 1 to 5, wherein, The reagent targeting the Ube2f gene, Cul5 gene, or Rnf7 gene or their expression products includes at least one of nucleic acids, polypeptides, ribonucleoprotein complexes, and small molecule inhibitors; Optionally, the nucleic acids include at least one of antisense RNA molecules and RNA interference molecules; Optionally, the polypeptides include at least one of antibodies or their antigen-binding fragments, artificial zinc finger nucleases, and TALEN systems; Optionally, the ribonucleoprotein complex includes the CRISPR / cas system.

7. Use according to any one of claims 1 to 6, wherein, The reagent targeting the Ube2f gene, Cul5 gene, or Rnf7 gene or their expression products includes a reagent used in any one of gene knockout technology, gene silencing technology, inactivating mutation technology, and PROTAC technology.

8. The use according to any one of claims 1 to 7, characterized in that, The product is a pharmaceutical composition, medicine box, reagent, or reagent kit.

9. A modified immune cell, wherein, The modified immune cells are immune cells treated with a reagent targeting the Ube2f gene, Cul5 gene, or Rnf7 gene or their expression products; Optionally, the immune cells include at least one of T cells, NKT cells, NK cells, innate lymphoid cells (ILC), and chimeric antigen receptor NK cells (CAR-NK cells); Optionally, the T cells include at least one of naïve T cells, αβ T cells, γδ T cells, CD4 + T cells, CD8 + T cells, memory T cells, activated T cells, exhausted T cells, tolerant T cells, chimeric antigen receptor T cells (CAR-T cells), T cell receptor T cells (TCR-T cells), and antigen-specific T cells; Optionally, the T cells comprise activated T cells; Optionally, the T cells comprise antigen-specific T cells; Optionally, the T cells comprise CD8 + T cells; Optionally, the T cells comprise exhausted T cells.

10. The modified immune cell according to claim 9, wherein, The antigen-specific T cells are antigen-specific T cells against the pathogen causing the infection; Optionally, the infection comprises at least one of a bacterial infection, a viral infection, a fungal infection, a protozoan infection, and a parasitic infection; Optionally, the infection is an infection in a subject.

11. Use of the modified immune cell according to claim 9 or 10 in the preparation of a product for preventing and / or treating an infection.

12. A composition comprising at least one selected from the following (a) to (d): (a) A reagent targeting the Ube2 gene or its expression product; (b) A reagent targeting the Cul5 gene or its expression product; (c) A reagent targeting the Rnf7 gene or its expression product; and (d) The modified immune cell according to claim 9 or 10; Optionally, the composition is a pharmaceutical composition, and the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

Images