Recombinant engineering bacterium and method for improving expression quantity of lipase PCL

Abstract

The invention discloses recombinant engineering bacteria and a method for improving the expression quantity of lipase PCL. The recombinant engineering bacteria are obtained by inserting a cofactor TF at the front end of a PCL gene sequence of a recombinant expression vector pPICZ alpha A-PCL, then inserting a kex-2 site between the cofactor TF and the PCL gene sequence and then transforming pichia pastoris competent cells. The constructed recombinant engineering bacterium can express lipase PCL and secrete the lipase PCL to the outside of cells, the enzyme activity and the protein content of fermentation liquor of the recombinant engineering bacterium are remarkably improved, the lipase can be stably, efficiently and safely produced, and the recombinant engineering bacterium has important industrial application potential.

Description

Technical Field

[0001] The present invention belongs to the fields of genetic engineering and fermentation technology. More specifically, the present invention relates to a recombinant engineering bacterium for enhancing the secreted expression of monoglyceride lipase PCL, a method for constructing the same, and a method for enhancing the secreted expression of monoglyceride lipase PCL by using the recombinant engineering bacterium. Background Art

[0002] Lipase PCL derived from Penicillium camembertii is a monoglyceride and diglyceride lipase (monoglyceride lipase), which can efficiently hydrolyze monoglyceride (MAG) and diglyceride (DAG), but has almost no effect on triglyceride (TAG). This specificity makes PCL irreplaceable in specific industrial applications. At present, there are few production methods for monoglyceride lipase PCL, mainly solid culture fermentation. For example, Miranda et al. produced lipase by solid-state fermentation of Penicillium, using industrial waste as a culture medium, and the lipase activity reached 5786 U / L.

[0003] The Komagataella phaffii expression system is a new type of heterologous protein expression system developed in recent years. It not only has the advantages of simple operation, easy cultivation, and high expression level of the prokaryotic expression system, but also has the characteristics of post-translational modification of heterologous proteins that the prokaryotic expression system does not have. At the same time, it avoids the defects of poor secretion efficiency, unstable expression strains, and easy loss of expression plasmids of Saccharomyces cerevisiae. Therefore, this expression system has become one of the most excellent and widely used heterologous gene expression systems.

[0004] However, there are few studies on the production of lipase PCL by Komagataella phaffii at present. The applicant previously constructed a constitutive recombinant Komagataella phaffii engineering strain X33 / pGAPZαA-PCL, which realized the heterologous secreted expression of monoglyceride lipase PCL in Komagataella phaffii. However, the enzyme activity and protein content of the expressed monoglyceride lipase PCL are not ideal enough, which limits its industrial production. Summary of the Invention

[0005] Based on this, the purpose of the present invention is to improve the enzyme activity and expression level of lipase PCL secreted and expressed in Komagataella phaffii.

[0006] The specific technical solutions for achieving the above invention purpose are as follows.

[0007] In the first aspect of the present invention, there is provided a recombinant engineering bacterium for increasing the expression level of lipase PCL, which is obtained by inserting cofactor TF at the front end of the PCL gene sequence of recombinant expression vector pPICZαA-PCL, and then inserting a kex-2 cleavage site between the cofactor TF and the PCL gene sequence, followed by transformation of Pichia pastoris competent cells; the nucleotide sequence of the PCL gene is as shown in SEQ ID NO:1, and the nucleotide sequence of the cofactor TF is as shown in SEQ ID NO:2 or SEQ ID NO:3.

[0008] In the second aspect of the present invention, there is provided a method for constructing a recombinant engineering bacterium for increasing the expression level of lipase PCL, comprising the following steps:

[0009] (1) Insert cofactor TF at the front end of the PCL gene sequence of recombinant expression vector pPICZαA-PCL, and then insert a kex-2 cleavage site between the cofactor TF and the PCL gene to construct recombinant expression vector pPICZαA-TF-PCL;

[0010] (2) Linearize the recombinant expression vector pPICZαA-TF-PCL obtained in step (1), and then perform electrotransformation with Pichia pastoris competent cells to obtain the recombinant engineering bacterium.

[0011] In the third aspect of the present invention, there is provided the use of the above-mentioned recombinant engineering bacterium in increasing the expression level of lipase PCL.

[0012] In the fourth aspect of the present invention, there is provided a method for increasing the expression level of lipase PCL, comprising the following steps: culturing the above-mentioned genetic engineering bacterium and obtaining lipase PCL through induced expression.

[0013] In the present invention, by integrating the coding gene of lipase PCL and the coding gene of a specific cofactor - TF into the pPICZαA plasmid carrying the AOX1 promoter, and inserting a Kex-2 cleavage site between the cofactor TF and the PCL gene, recombinant expression vector pPICZαA-TF-PCL is constructed. Then, linearized pPICZαA-TF-PCL is electrotransformed together with the competent cells of Pichia pastoris X33 (receptor microorganism) to construct a recombinant Pichia pastoris engineering strain X33 / pPICZαA-TF-PCL that can express lipase PCL and secrete it extracellularly. Moreover, the enzyme activity and protein content of its fermentation broth are significantly higher than those of the fermentation broth of the constitutive Pichia pastoris engineering strain X33 / pGAPZαA-PCL.

[0014] In addition, by analyzing and predicting the structure of the cofactor TF, the inventors truncated it to different degrees and constructed several recombinant Pichia pastoris engineering strains. The strains were fermented in shake flasks in BMMY medium, and PCL was obtained after 4 days of induction. It was found that compared with X33 / pPICZαA-TF-PCL, only X33 / pPICZαA-TF D3 -PCL could greatly improve the enzyme activity and protein content of lipase PCL. Further verification was carried out by scaling up in a 7L fermenter. After 120h of induction under the conditions of an induction temperature of 25°C and a pH of 6.0, the recombinant Pichia pastoris engineering strain X33 / pPICZαA-TF-PCL had an enzyme activity of 6500U / mL and a protein content of 4.02g / L.

[0015] In the present invention, when lipase PCL is expressed in recombinant Pichia pastoris engineering bacteria, on the one hand, the fusion of the cofactor TF can significantly improve the secretion level of recombinant lipase PCL. On the other hand, the intracellular endogenous enzyme is used to cleave the target enzyme protein and the cofactor. Therefore, the target enzyme protein secreted into the fermentation supernatant does not carry the cofactor. Compared with the existing fusion protein expression technology, the target enzyme protein has a higher content and is purer. The present invention provides an effective solution for the fermentation and application of recombinant enzymes. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 It is the map of the Pichia pastoris engineering strain X33 / pGAPZαA-PCL used in the present invention.

[0017] Figure 2 It is the structural schematic diagram of the recombinant expression vector constructed in Example 1 of the present invention.

[0018] Figure 3 It is the protein electrophoresis diagram of the shake flask fermentation broth of the recombinant Pichia pastoris engineering strain constructed in Example 1 of the present invention. Among them, Control 1: X33 / pGAPZαA-PCL; Control 2: X33 / pPICZαA-PCL; TF-PCL: X33 / pPICZαA-TF-PCL; TrXA-PCL: X33 / pPICZαA-TrXA-PCL;

[0019] SUMO-PCL: X33 / pPICZαA-SUMO-PCL; GST-PCL: X33 / pPICZαA-GST-PCL.

[0020] Figure 4 It is the protein electrophoresis diagram of the shake flask fermentation broth of the recombinant Pichia pastoris engineering strain constructed in Example 2 of the present invention. Among them, PCL-inducible: X33 / pGAPZαA-PCL; TF-PCL: X33 / pPICZαA-TF-PCL; TF D1: X33 / pPICZαA-TF D1 -PCL; TF D2 : X33 / pPICZαA-TF D2 -TF-PCL; TF D3 : X33 / pPICZαA-TF D3 -PCL; TF D4 : X33 / pPICZαA-TF D4 -PCL.

[0021] Figure 5 This is the protein electrophoresis pattern of lipase PCL produced by the Pichia pastoris engineering strain X33 / pGAPZαA-PCL in Example 3 of the present invention at different fermentation times.

[0022] Figure 6 This is the recombinant Pichia pastoris engineering strain X33 / pPICZαA-TF D3 -PCL's protein electrophoresis pattern of lipase PCL produced at different fermentation times. Detailed implementation methods

[0023] To facilitate the understanding of the present invention, the present invention will be described more comprehensively below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosed content of the present invention more thorough and comprehensive.

[0024] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the technical field to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not used to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0025] If not specifically specified, the embodiments are all carried out under conventional experimental conditions, such as those in the Molecular Cloning Experimental Manual by Sambrook et al. (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or under the conditions recommended by the manufacturer's instructions. All raw materials and reagents used in the present invention are commercially available, and any biological germplasm materials can be provided for scientific research externally.

[0026] In some embodiments of the present invention, a recombinant engineering bacterium for increasing the expression level of lipase PCL is disclosed. It is obtained by inserting cofactor TF at the front end of the PCL gene sequence of recombinant expression vector pPICZαA-PCL, and then inserting a kex-2 cleavage site between the cofactor TF and the PCL gene sequence, and then transforming Pichia pastoris competent cells; the nucleotide sequence of the PCL gene is as shown in SEQ ID NO:1, and the nucleotide sequence of the cofactor TF is as shown in SEQ ID NO:2 or SEQ ID NO:3.

[0027] In some embodiments, the nucleotide sequence of the cofactor TF is as shown in SEQ ID NO:3.

[0028] In some embodiments, the recombinant expression vector pPICZαA-PCL is obtained by cloning the PCL gene into the MCS cloning site of the expression vector pPICZαA.

[0029] In some embodiments, the PCL gene is synthesized using the genome of Pichia pastoris X33 / pGAPZαA-PCL as a template and SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10 and SEQ ID NO:11 as primers.

[0030] In some embodiments, the Pichia pastoris is X33.

[0031] In other embodiments of the present invention, a method for constructing a recombinant engineering bacterium for increasing the expression level of lipase PCL is disclosed, including the following steps:

[0032] (1) Insert cofactor TF at the front end of the PCL gene sequence of recombinant expression vector pPICZαA-PCL, and then insert a kex-2 cleavage site between the cofactor TF and the PCL gene to construct the recombinant expression vector pPICZαA-TF-PCL;

[0033] (2) Linearize the recombinant expression vector pPICZαA-TF-PCL obtained in step (1), and then perform electroporation with Pichia pastoris competent cells to obtain the recombinant engineering bacterium.

[0034] In some embodiments, in step (1), SEQ ID NO:12 and SEQ ID NO:13 are used as primers, or SEQ ID NO:22 and SEQ ID NO:23 are used as primers, and the cofactor TF is inserted at the front end of the PCL gene sequence of the recombinant expression vector pPICZαA-PCL by seamless cloning. In other embodiments of the present invention, the application of the above recombinant engineering bacterium in increasing the expression level of lipase PCL is disclosed.

[0035] In some other embodiments of the present invention, a method for increasing the expression level of lipase PCL is disclosed, which includes the following steps: culturing the above-mentioned genetically engineered bacterium and obtaining lipase PCL through induced expression.

[0036] In some of the embodiments, the conditions for culturing are: 30°C ± 1°C, pH 5.0 ± 0.1, 200 rpm ± 10 rpm, aeration rate 3 L / min ± 0.3 L / min. Culture until the glycerol in the modified BSM medium is exhausted, and then perform glycerol feeding to increase the wet weight to 180 g / L - 240 g / L within 3 h - 6 h.

[0037] In some of the embodiments, the conditions for induction are: 25°C ± 1°C, pH 6.0 ± 0.1. After starvation for 25 min - 35 min, add methanol at a flow rate of 3 mL / h - 6 mL / h, and control the dissolved oxygen between 30% - 40% by controlling the methanol flow rate, and induce for 120 h ± 5 h.

[0038] In some of the embodiments, a method for increasing the expression level of lipase PCL includes the following steps:

[0039] (1) Inoculate the YPD secondary seed liquid of the genetically engineered bacterium into 2.6 L - 2.8 L of modified BSM medium at an inoculation amount of 8% - 12%, at 30°C ± 1°C, pH 5.0 ± 0.1, 200 rpm ± 10 rpm, aeration rate 3 L / min ± 0.3 L / min. Culture until the glycerol in the modified BSM medium is exhausted, and then perform glycerol feeding to increase the wet weight to 180 g / L - 240 g / L within 3 h - 6 h;

[0040] (2) Cool down to 25°C ± 1°C, adjust the pH to 6.0 ± 0.1. After starvation for 25 min - 35 min, add methanol at a flow rate of 3 mL / h - 6 mL / h, and control the dissolved oxygen between 30% - 40% by controlling the methanol flow rate, with a flow rate of 3 - 6 m / h, and induce for 120 h ± 5 h.

[0041] In the following examples, the media involved include: ① Seed liquid YPD medium (1 L): 10 g of yeast powder, 20 g of peptone, 20 g of glucose, natural pH. Add 15 g of agar to the solid medium.

[0042] ②BMGY medium (1 L): 10 g yeast extract, 20 g peptone, 10 g glycerol, 13.4 g YNB, make up to 900 mL, after sterilization, add 100 mL potassium phosphate buffer in the laminar flow hood, natural pH. ③BMMY medium (1 L): 10 g yeast extract, 20 g peptone, 13.4 g YNB, make up to 800 mL, after sterilization, add 100 mL potassium phosphate buffer in the laminar flow hood, add 100 mL 20% biotin, natural pH. ④Modified BSM medium (1 L): 10 mL 85% H3PO4, 0.94 g CaSO4, 18.2 g K2SO4, 14.9 g MgSO4·7H2O, 40 g glycerol, 4.13 g KOH, 15 mL PTM1 trace elements. ⑤PTM1 trace elements (1 L): 6.0 g CuSO4·5H2O, 0.08 g NaI, 3.0 g MnSO4·H2O, 0.2 g Na2MoO4·2H2O, 0.02 g H3BO3, 0.5 g CoCl2, 20.0 g ZnCl2, 65.0 g FeSO4·7H2O, 0.2 g Biotin, 5.0 mL concentrated H2SO4. ⑥Glycerol feeding medium (1 L): 70% (v / v) glycerol, 12 mL PTM1.

[0043] In the following examples, the reagents used include: ①4% PVA: Accurately weigh 40 g of polyvinyl alcohol in a glass beaker, add 800 mL of water, heat at about 40 °C, stir while heating, heat and dissolve for about 40 min, after complete dissolution, filter with double-layer gauze and reserve. ②NaOH solution (first prepare a stock solution of 0.5 mol / L and dilute to 0.05 mol / L when in use): Accurately weigh 20 g and dissolve in water, boil to dissolve completely, cool, pour out the supernatant into a 1 L volumetric flask, and make up to 1 L. ③PBS solution: Accurately weigh 4.56 g of K2HPO4·3H2O in a beaker, dissolve with distilled water, and make up to 1 L, that is, 0.02 mol / L K2HPO4 buffer. 0.02 mol / L KH2PO4: Accurately weigh 2.72 g in a beaker, dissolve with water and make up to 1 L. Then mix the two solutions in proportion and adjust the pH value to 5.6. ④Emulsifier: Take appropriate amounts of the two solutions in a ratio of 4% PVA: dioleoyl glycerol (v / v) = 3:1, mix them, and homogenize for 6 min under a high-pressure homogenizer, with an intermittent period of 1 min every 2 min until the emulsifier turns milky white without yellowing, indicating that the emulsifier has been prepared, otherwise the homogenization time needs to be extended.

[0044] In the following examples, the performance tests involved include:

[0045] ① Determination of enzyme activity in fermentation supernatant (acid-base titration method): Take 4 g of the prepared emulsifier and add 5 mL of buffer. Add 15 mL of industrial alcohol to the blank control. Preheat in a shaker at 150 rpm and 30 °C for 5 min. After preheating, add 1 mL of the fermentation supernatant diluted by an appropriate multiple, and then react for 5 min. Immediately add 15 mL of industrial alcohol to terminate the reaction after the reaction ends (Note: When adding industrial alcohol to the blank, shake it while adding, otherwise it is easy to agglomerate, and usually one blank and three parallel samples need to be made). Titrate with 0.05 mol / L NaOH, add a few drops of phenolphthalein as an indicator, and titrate until the liquid changes from milky white to slightly red (Note: Control the volume difference of NaOH used for titrating the blank and the sample within 1 - 2 mL). Calculate the enzyme activity according to the enzyme activity calculation formula: X = (V - V0) × c / 0.05 × 50 × 1 / 5 × n, where V is the volume of NaOH used for titrating the sample (mL); V0 is the volume of NaOH consumed for titrating the blank (mL); c is the concentration of NaOH used for titration (mol / L); 50 means that 1.00 mL of 0.05 mol / L NaOH solution is equivalent to 50 μmol of lipase; 15 is the reaction time (min); n is the dilution multiple.

[0046] ② Determination of protein content (Improved Bradford method protein concentration assay kit): Preparation of standard curve: Dilute the 1.0 mg / mL bovine serum albumin standard solution successively to a series of concentrations of 0.05, 0.1, 0.15, 0.2, 0.25, and 0.3 mg / mL. Then add 20 μL of the above series of concentrations of bovine serum albumin solution and 200 μL of Bradford reagent to a 96-well microplate, let it stand and react for 5 min, and then measure its absorbance value at a wavelength of 595 nm. Add 20 μL of the target protein solution and 200 μL of Bradford reagent to a 96-well microplate in sequence, let it stand and react for 5 min, and then measure its absorbance value at a wavelength of 595 nm.

[0047] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0048] Example 1 Construction of a recombinant Pichia pastoris engineering strain for highly efficient secretion and expression of lipase PCL

[0049] In this example, several recombinant Pichia pastoris engineering strains (including the lipase PCL gene and different cofactors derived from Escherichia coli) were constructed, and a recombinant Pichia pastoris engineering strain X33 / pPICZαA-TF-PCL that can improve the enzyme activity and expression level of lipase PCL was screened out. The specific steps are as follows:

[0050] 1. Extract the existing Pichia pastoris engineering strain X33 / pGAPZαA-PCL in the laboratory (constructed by existing conventional techniques, and its map is as Figure 1The genome (as shown) was used to synthesize the PCL gene sequence (the nucleotide sequence is as shown in SEQ ID NO: 1) with primers (SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11). The synthesized gene sequence was cloned into the MCS cloning site of the Pichia pastoris inducible expression vector pPICZαA (Invitrogen, catalog number: V20520) to construct the recombinant expression vector pPICZαA-PCL (for subsequent control experiments), and the correctness of the constructed recombinant expression vector was verified by PCR sequencing.

[0051] 2. By the method of seamless cloning, the recombinant expression vector pPICZαA-PCL constructed in step 1 was linearized using primers (SEQ ID NO: 7, SEQ ID NO: 9), and then cofactors TF (using primers SEQ ID NO: 12 and SEQ ID NO: 13), SUMO (using primers SEQ ID NO: 14 and SEQ ID NO: 15), GST (using primers SEQ ID NO: 16 and SEQ ID NO: 17), and TrXA (using primers SEQ ID NO: 18 and SEQ ID NO: 19) were inserted at the front end of the PCL gene sequence respectively. Four recombinant expression vectors were constructed, and then the kex-2 cleavage site was inserted at the back end of the cofactor (that is, between the PCL gene and the cofactor). The specific primer information is shown in Table 1. The structural schematic diagram of the constructed recombinant expression vector is as Figure 2 shown.

[0052] Table 1 Synthetic fragments of recombinant expression vectors and primers for vector linearization

[0053]

[0054]

[0055] 3. The recombinant expression vector pPICZαA-PCL constructed in step 1 and the 4 recombinant expression vectors constructed in step 2 were linearized by PCR (the primers used are shown in Table 2) and purified. Then the PCR products were recovered using a PCR product purification kit, and various inorganic salts, proteins, oligonucleotide primers and other impurities were removed. Finally, they were eluted with sterile water to obtain purified linearized recombinant expression vectors.

[0056] Table 2 Primers for linearization of recombinant expression vectors

[0057] Name 5'-Sequence-3' AOX1-F1 CGCTCATTCCAATTCCTTCT(SEQ ID NO:20) AOX1-R1 AGCTCCAATCAAGCCCAA(SEQ ID NO:21)

[0058] 4. Mix the purified linearized recombinant expression vector with the Pichia pastoris competent cells X33 for electroporation. Set the electroporation parameters: capacitance, voltage, and resistance are 25 μF, 1500 V, and 400 Ω, respectively. Through colony PCR verification, 5 recombinant Pichia pastoris engineering strains, namely Pichia pastoris recombinant expression strains, were successfully obtained and named as follows: X33 / pPICZαA-PCL, X33 / pPICZαA-TF-PCL, X33 / pPICZαA-TrXA-PCL, X33 / pPICZαA-SUMO-PCL, and X33 / pPICZαA-GST-PCL.

[0059] 5. Spread the recombinant Pichia pastoris engineering strains obtained in step 4 onto YPD solid medium containing 100 μg / ml Zeocin, and incubate them upside down in a 30 °C constant temperature incubator in the dark for about 2 days. Pick single colonies and transfer them to 5 mL of YPD liquid medium, and culture them at 30 °C and 200 rpm for 18 h; transfer them to 50 mL of BMGY medium at an inoculation amount of 3% (v / v), and culture them at 30 °C and 200 rpm for 12 h; transfer them to 100 mL of BMMY medium at an inoculation amount of 10% (v / v), and culture them at 30 °C and 200 rpm for 24 h. Then, at 25 °C, add 1% (v / v) methanol every 12 h; induce for a total of 96 h.

[0060] Meanwhile, streak culture X33 / pGAPZαA-PCL stored in the laboratory, pick single colonies and transfer them to 5 mL of YPD liquid medium, and culture them at 30 °C and 200 rpm for 18 h; transfer them to 50 mL of YPD medium at an inoculation amount of 10% (v / v), and culture them at 30 °C and 200 rpm for 24 h. Then, add 1% (v / v) glycerol every 12 h; induce for a total of 96 h. The shake flask fermentation results are shown in Table 3 and Figure 2 as follows.

[0061] Table 3 Expression levels of different strains

[0062] Strain Carbon source Enzyme activity (U / mL) X33 / pGAPZαA-PCL Glycerol 108 X33 / pPICZαA-PCL Methanol 20 X33 / pPICZαA-TF-PCL Methanol 480 X33 / pPICZαA-TrXA-PCL Methanol 0 X33 / pPICZαA-SUMO-PCL Methanol 0 X33 / pPICZαA-GST-PCL Methanol 0

[0063] The results in Table 3 show that: compared with X33 / pGAPZαA-PCL (control 1), the enzyme activity in the fermentation broth of X33 / pPICZαA-PCL (control 2) decreased significantly, but the enzyme activity in the fermentation broth of X33 / pPICZαA-TF-PCL was 480 U / mL, much higher than that of X33 / pGAPZαA-PCL, while the enzyme activities in the fermentation broths of several strains containing other cofactors were 0. Figure 3The protein electrophoresis pattern also shows that the protein content in the fermentation broth of X33 / pPICZαA-TF-PCL is significantly higher. Therefore, the recombinant Pichia pastoris engineering strain X33 / pPICZαA-TF-PCL is suitable as a production strain for monoglyceride and diglyceride lipase PCL.

[0064] The nucleotide sequence of the PCL gene is shown in SEQ ID NO:1, and the nucleotide sequence of the cofactor TF is shown in SEQ ID NO:2.

[0065] SEQ ID NO:1

[0066] AGTGTTAGTACTAGTGAGCTTGATCAGTTTGAATTCTGGGTCCAATATGCTGCAGCTTCCTATTATGAAGCAGACTATACTGCCCAAGTCGGAGACAAACTGTCCTGTTCTAAAGGCAACTGCCCAGAGGTAGAAGCTACTGGAGCTACAGTTTCCTACGATTTTAGTGACTCCACTATTACCGACACGGCCGGTTACATAGCTGTCGATCATACGAATTCAGCCGTTGTGCTTGCTTTCAGAGGTTCTTATTCCGTTAGAAATTGGGTGGCTGATGCTACTTTCGTTCATACAAACCCCGGTTTATGTGATGGTTGTCTAGCTGAGCTGGGTTTCTGGTCTTCATGGAAGTTGGTGCGAGACGACATCATCAAGGAATTGAAGGAGGTTGTTGCCCAAAATCCTAACTACGAACTAGTTGTAGTTGGACATTCTTTGGGTGCTGCCGTTGCCACATTGGCAGCTACTGACTTAAGAGGAAAAGGATACCCTTCAGCTAAGTTGTACGCTTATGCCTCTCCTAGGGTAGGTAATGCCGCATTGGCCAAGTACATTACAGCTCAGGGTAACAACTTCAGATTTACACACACCAATGACCCAGTGCCCAAACTGCCATTGTTGTCAATGGGGTACGTTCACGTTTCTCCTGAATACTGGATCACCTCCCCTAACAATGCAACCGTCTCTACCAGTGATATAAAAGTCATTGATGGAGATGTATCTTTCGATGGAAACACTGGTACTGGGTTACCACTGTTGACTGATTTTGAGGCACACATTTGGTATTTTGTTCAAGTGGATGCAGGTAAGGGCCCAGGCCTTCCATTTAAACGTGTC

[0067] SEQ ID NO:2

[0068]

[0069] Example 2 Optimization of Recombinant Pichia pastoris Engineering Strain X33 / pPICZαA-TF-PCL

[0070] In this example, the recombinant Pichia pastoris engineering strain X33 / pPICZαA-TF-PCL constructed in Example 1 was further optimized, which specifically included the following steps:

[0071] 1. Analyze the TF structure and design TF D1 TF D2 TF D3 TF D4 Four factors. Using the pPICZαA-TF-PCL constructed in Example 1 as a template and according to the primers in Table 4, four recombinant expression vectors pPICZαA-TF D1 / TF D2 / TF D3 / TF D4 -PCL were respectively constructed. Among them, the nucleotide sequence of TF D1 is shown in SEQ ID NO:4, the nucleotide sequence of TF D2 is shown in SEQ ID NO:5, the nucleotide sequence of TF D3 is shown in SEQ ID NO:3, and the nucleotide sequence of TF D4 is shown in SEQ ID NO:6.

[0072] Table 4 Primers for Recombinant Vector Synthesis Fragments

[0073]

[0074]

[0075] 2. Perform PCR linearization treatment (using the primers shown in Table 2) and purification on the above 4 constructed recombinant expression vectors, then recover the PCR products with a PCR product purification kit, remove various inorganic salts, proteins, oligonucleotide primers and other impurities at the same time, and finally elute with sterile water to obtain purified linearized recombinant expression vectors.

[0076] 3. Mix the purified linearized recombinant expression vectors with Pichia pastoris competent X33 for electroporation, and set the parameters of electroporation: capacitance, voltage, and resistance are 25 μF, 1500 V, and 400 Ω respectively. Through colony PCR verification, 4 recombinant Pichia pastoris engineering strains were successfully obtained, which are named as follows: X33 / pPICZαA-TF D1 -PCL, X33 / pPICZαA-TF D2-TF-PCL, X33 / pPICZαA-TF D3 -PCL and X33 / pPICZαA-TF D4 -PCL.

[0077] 4. Spread the recombinant Pichia pastoris engineering strains obtained in step 3 onto YPD solid medium containing 100 μg / ml Zeocin (bleomycin), and place it upside down in a constant temperature incubator at 30 °C for about 2 days in the dark.

[0078] Pick single colonies and transfer them to 5 mL of YPD liquid medium, and culture them at 30 °C and 200 rpm for 18 h; transfer them to 50 mL of BMGY medium according to an inoculation amount of 3% (v / v), and culture them at 30 °C and 200 rpm for 12 h; transfer them to 100 mL of BMMY medium according to an inoculation amount of 10% (v / v), and culture them at 30 °C and 200 rpm for 24 h. Then, at 25 °C, add 1% (v / v) methanol every 12 h; induce for a total of 96 h. Take the shake flask fermentation results as shown in Table 5 and Figure 4 as shown.

[0079] Table 5 Expression levels of different strains

[0080]

[0081]

[0082] Table 5 results show that compared with X33 / pPICZαA-TF-PCL, except for X33 / pPICZαA-TF D3 -PCL, the enzyme activities of the fermentation broths of other strains all decreased to varying degrees, while the enzyme activity of the fermentation broth of X33 / pPICZαA-TF D3 -PCL increased significantly, rising from the original 480 U / mL to 530 U / mL. Figure 4 The protein electrophoresis pattern also shows that the protein content of the fermentation broth of X33 / pPICZαA-TF D3 -PCL is significantly higher. Therefore, the recombinant Pichia pastoris engineering strain X33 / pPICZαA-TF D3 -PCL is more suitable as a production strain for lipase (mono- and diacylglycerol lipase) PCL.

[0083] TF D1 The nucleotide sequence of TF is shown in SEQ ID NO:4, the nucleotide sequence of TF D2 is shown in SEQ ID NO:5, the nucleotide sequence of TF D3 is shown in SEQ ID NO:3, the nucleotide sequence of TF D4 is shown in SEQ ID NO:6.

[0084] SEQ ID NO:3:

[0085] CAGGCGACCTGGAAAGAAAAAGACGGCGCTGTTGAAGCAGAAGACCGCGTGACCATCGACTTCACCGGTTCTGTAGACGGCGAAGAGTTCGAAGGCGGTAAAGCGTCTGATTTCGTACTGGCGATGGGCCAGGGTCGTATGATCCCGGGCTTTGAAGACGGTATCAAAGGCCACAAAGCTGGCGAAGAGTTCACCATCGACGTGACCTTCCCGGAAGAATACCACGCAGAAAACCTGAAAGGTAAAGCAGCGAAATTCGCTATCAACCTGAAGAAAGTTGAAGAGCGTGAACTGCCGGAACTGACCGCAGAG

[0086] SEQ ID NO:4:

[0087] ATGCAAGTTTCAGTTGAAACCACTCAAGGCCTTGGCCGCCGTGTAACGATTACTATCGCTGCTGACAGCATCGAGACCGCTGTTAAAAGCGAGCTGGTCAACGTTGCGAAAAAAGTACGTATTGACGGCTTCCGCAAGGGCAAAGTGCCAATGAATATCGTTGCTCAGCGTTATGGCGCGTCTGTACGCCAGGACGTTCTGGGTGACCTGATGAGCCGTAACTTCATTGACGCCATCATTAAAGAAAAAATCAATCCGGCTGGCGCACCGACTTATGTTCCGGGCGAATACAAGCTGGGTGAAGACTTCACTTACTCTGTAGAGTTTGAAGTTTAT

[0088] SEQ ID NO:5

[0089] ATGCAAGTTTCAGTTGAAACCACTCAAGGCCTTGGCCGCCGTGTAACGATTACTATCGCTGCTGACAGCATCGAGACCGCTGTTAAAAGCGAGCTGGTCAACGTTGCGAAAAAAGTACGTATTGACGGCTTCCGCAAGGGCAAAGTGCCAATGAATATCGTTGCTCAGCGTTATGGCGCGTCTGTACGCCAGGACGTTCTGGGTGACCTGATGAGCCGTAACTTCATTGACGCCATCATTAAAGAAAAAATCAATCCGGCTGGCGCACCGACTTATGTTCCGGGCGAATACAAGCTGGGTGAAGACTTCACTTACTCTGTAGAGTTTGAAGTTTATCCGGAAGTTGAACTGCAAGGTCTGGAAGCGATCGAAGTTGAAAAACCGATCGTTGAAGTGACCGACGCTGACGTTGACGGCATGCTGGATACTCTGCGTAAACAGCAG

[0090] SEQ ID NO:6

[0091] TTCATCAAACGTTTCGGCGTTGAAGATGGTTCCGTAGAAGGTCTGCGCGCTGAAGTGCGTAAAAACATGGAGCGCGAGCTGAAGAGCGCCATCCGTAACCGCGTTAAGTCTCAGGCGATCGAAGGTCTGGTAAAAGCTAACGACATCGACGTACCGGCTGCGCTGATCGACAGCGAAATCGACGTTCTGCGTCGCCAGGCTGCACAGCGTTTCGGTGGCAACGAAAAACAAGCTCTGGAACTGCCGCGCGAACTGTTCGAAGAACAGGCTAAACGCCGCGTAGTTGTTGGCCTGCTGCTGGGCGAAGTTATCCGCACCAACGAGCTGAAAGCTGACGAAGAGCGCGTGAAAGGCCTGATCGAAGAGATGGCTTCTGCGTACGAAGATCCGAAAGAAGTTATCGAGTTCTACAGCAAAAACAAAGAACTGATGGACAACATGCGCAATGTTGCTCTGGAAGAACAGGCTGTTGAAGCTGTACTGGCGAAAGCGAAAGTGACTGAAAAAGAAACCACTTTCAACGAGCTGATGAACCAGCAGGCG

[0092] Example 3: High-efficient production of PCL using recombinant Pichia pastoris engineering strain X33 / pPICZαA-TF D3 -PCL

[0093] In this example, the recombinant Pichia pastoris engineering strain X33 / pPICZαA-TF D3 -PCL constructed in Example 2 was subjected to scale-up culture, including the following steps:

[0094] 1. The glycerol strains X33 / pGAPZαA-PCL stored at -80°C and the glycerol strain X33 / pPICZαA-TF D3 -PCL constructed in Example 2 were spread on YPD solid medium containing 100 μg / ml Zeocin (bleomycin), and then inverted and cultured in the dark at 30°C in a constant temperature incubator for about 2 days.

[0095] 2. Single colonies were picked and transferred into 100 mL of YPD liquid medium, and cultured at 30°C and 200 rpm for 24 h to obtain the first-stage YPD seed liquid;

[0096] 3. Transfer 50 mL of YPD primary seed liquid into 300 mL of YPD medium, and culture it at 30 °C and 200 rpm for 12 h to obtain YPD secondary seed liquid.

[0097] 4. Load 2.7 L of modified BSM medium into a 5 L fermenter, insert pH and dissolved oxygen electrodes and calibrate them. Then sterilize it at 121 °C for 20 min. After sterilization, connect the circulating water to cool it down to 30 °C, and introduce air for closed-loop control. Adjust the pH to 5.0 with ammonia water. Inoculate 10% (v / v) of YPD secondary seed liquid into the fermenter by flame inoculation. Set the rotation speed to 200 rpm and the ventilation volume to 3 L / min, and start fermentation (maintain at pH 5.0 and 30 °C).

[0098] 5. When the glycerol in the fermentation medium (modified BSM medium) is exhausted and the dissolved oxygen rises rapidly, enter the glycerol feeding stage. For strain X33 / pGAPZαA-PCL in the glycerol feeding stage, set the temperature to 30 °C and the pH to 5.0 respectively. Monitor the enzyme activity, total protein concentration and wet cell weight every 12 h, and end the fermentation after 108 h. For strain X33 / pPICZαA-TF D3 -PCL, after the glycerol is exhausted, carry out glycerol feeding to maintain the wet weight growth to 180 g / L - 240 g / L within 3 - 6 h, stop feeding, cool down to 25 °C, adjust the pH to 6.0, starve for half an hour, and then add methanol at a flow rate of 3 mL / h - 6 mL / h. Control the dissolved oxygen between 30% - 40% by adjusting the methanol flow rate. Take samples every 12 h to monitor the enzyme activity, total protein concentration and wet cell weight, and end the induction after 120 h.

[0099] 6. Experimental results

[0100] The protein electrophoresis patterns of the partial glyceride lipase PCL produced by X33 / pGAPZαA-PCL and X33 / pPICZαA-TF D3 -PCL at different fermentation times are shown in Figure 4 and Figure 5 respectively. After measuring the enzyme activity and protein content, the highest enzyme activity of the fermentation broth of X33 / pGAPZαA-PCL is 1850 U / ml, and the protein content is 1.2 g / L. The highest enzyme activity of the fermentation broth of X33 / pPICZαA-TF D3 -PCL is 6500 U / ml, and the protein content is 4.03 g / L. Therefore, using the recombinant Pichia pastoris engineering strain X33 / pPICZαA-TF D3 -PCL to express and secrete PCL enzyme can significantly improve the enzyme activity and expression level of PCL.

[0101] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope described in this specification.

[0102] The above-described embodiments only express several implementation manners of the present invention, and the description thereof is relatively specific and detailed. However, it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the invention patent should be subject to the appended claims.

Claims

1. A recombinant engineering bacterium for improving the expression level of lipase PCL, characterized in that, It is obtained by inserting cofactor TF at the front end of the PCL gene sequence of recombinant expression vector pPICZαA-PCL, and then inserting a kex-2 cleavage site between the cofactor TF and the PCL gene sequence, and then transforming Pichia pastoris competent cells; The nucleotide sequence of the PCL gene is as shown in SEQ ID NO:1, and the nucleotide sequence of the cofactor TF is as shown in SEQ ID NO:2 or as shown in SEQ ID NO:

3.

2. The recombinant engineering bacterium for increasing the expression level of lipase PCL according to claim 1, wherein The recombinant expression vector pPICZαA-PCL is obtained by cloning the PCL gene into the MCS cloning site of the expression vector pPICZαA.

3. The recombinant engineered bacterium for increasing the expression level of lipase PCL according to claim 2, wherein The PCL gene is synthesized using the genome of Pichia pastoris X33 / pGAPZαA-PCL as a template and SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10 and SEQ ID NO:11 as primers.

4. The recombinant engineered bacterium for increasing the expression level of lipase PCL according to any one of claims 1 to 3, characterized in that, The nucleotide sequence of the cofactor TF is as shown in SEQ ID NO:3; and / or, the Pichia pastoris is X33.

5. A method for constructing a recombinant engineering bacterium for increasing the expression level of lipase PCL according to any one of claims 1 to 4, characterized in that, It includes the following steps: (1) Insert cofactor TF at the front end of the PCL gene sequence of recombinant expression vector pPICZαA-PCL, and then insert a kex-2 cleavage site between the cofactor TF and the PCL gene to construct the recombinant expression vector pPICZαA-TF-PCL; (2) Linearize the recombinant expression vector pPICZαA-TF-PCL obtained in step (1), and then perform electroporation with Pichia pastoris competent cells to obtain it.

6. The method for constructing a recombinant engineering bacterium for increasing the expression level of lipase PCL according to claim 5, wherein In step (1), SEQ ID NO:12 and SEQ ID NO:13 are used as primers, or SEQ ID NO:22 and SEQ ID NO:23 are used as primers, and the cofactor TF is inserted at the front end of the PCL gene sequence of the recombinant expression vector pPICZαA-PCL by the method of seamless cloning.

7. Use of the recombinant engineering bacteria according to any one of claims 1 to 4 in increasing the expression level of lipase PCL.

8. A method for increasing the expression level of lipase PCL, characterized in that, It includes the following steps: culturing the recombinant engineering bacteria according to any one of claims 1 to 4, and obtaining lipase PCL through induced expression.

9. The method for increasing the expression level of lipase PCL according to claim 8, wherein The conditions for the culture are: 30°C ± 1°C, pH 5.0 ± 0.1, 200 rpm ± 10 rpm, aeration volume 3 L / min ± 0.3 L / min, culture until the glycerol in the modified BSM medium is exhausted, and perform glycerol feeding to make the wet weight increase to 180 g / L to 240 g / L within 3 h to 6 h; and / or, the conditions for the induction are: 25°C ± 1°C, pH 6.0 ± 0.1, after starvation for 25 min to 35 min, add methanol at a flow rate of 3 mL / h to 6 mL / h, and induce for 120 h ± 5 h.

10. The method for increasing the expression level of lipase PCL according to claim 8, wherein It includes the following steps: (1) Inoculate the YPD secondary seed solution of the genetically engineered bacteria into 2.6 L to 2.8 L of modified BSM medium at an inoculation amount of 8% to 12%, and culture at 30°C ± 1°C, pH 5.0 ± 0.1, 200 rpm ± 10 rpm, with an aeration rate of 3 L / min ± 0.3 L / min until the glycerol in the modified BSM medium is exhausted, and then perform glycerol feeding to increase the wet weight to 180 g / L to 240 g / L within 3 h to 6 h; (2) Cool down to 25°C ± 1°C, adjust the pH to 6.0 ± 0.1, after starving for 25 min to 35 min, feed methanol at a rate of 3 mL / h to 6 mL / h and induce for 120 h ± 5 h.

Images