SLAF marker closely linked with rice black-streaked dwarf virus resistance major QTL and application of SLAF marker

Abstract

The invention provides an SLAF molecular marker for resisting rice black-streaked dwarf virus QTL qRBSDV6, the SLAF molecular marker comprises a primer pair as shown in Marker 629043F and a primer pair as shown in Marker 629043R, and the invention further provides related application of the SLAF molecular marker for resisting rice black-streaked dwarf virus QTL qRBSDV6. The molecular marker for resisting the rice black-streaked dwarf virus QTL can detect the resistance of rice to the rice black-streaked dwarf virus, can predict the resistance of the rice to the rice black-streaked dwarf virus, can also be used for molecular marker-assisted breeding of rice with high resistance to the rice black-streaked dwarf virus, accelerates the progress of rice disease-resistant breeding, is simple and rapid in detection, and is high in practicability. The method is low in cost, free of environmental influence and suitable for large-scale popularization and application.

Description

Technical Field

[0001] The present invention relates to a major effect QTL for resistance to rice black streaked dwarf disease qRBSDV6 Tightly linked molecular markers can be used in molecular marker-assisted breeding, which belongs to the field of rice disease-resistant breeding and molecular biology. Background Art

[0002] Rice black-streaked dwarf disease, caused by the rice black-streaked dwarf virus (RBSDV), is a major viral disease. Infected rice plants exhibit abnormal growth and development, resulting in stunted growth and failure to produce seeds and produce grains. Losses can reach up to 50% after infection, posing a serious threat to rice production. The lack of disease-resistant rice varieties, the promotion of rice-wheat rotations, and changes in environmental conditions such as warmer winters have led to an increasing incidence of the virus's vector, the small brown planthopper (Lagerstroemia striatellus).

[0003] To date, there are no effective chemical agents for the prevention and control of viral diseases. The current method for controlling rice black-streaked dwarf disease primarily relies on pesticides to control the vector. However, due to the large population size of the Laodelphax striatellus, control is difficult. Over time, the vector insects develop resistance, and there are also environmental pollution issues. Therefore, using pesticides to suppress viral transmission is not a long-term strategy. Utilizing the variety's inherent disease resistance is the most economical and effective method for controlling viral diseases. Rice resistance to RBSDDV is a complex trait controlled by multiple genes. Over 30 QTLs associated with RBSDDV resistance have been identified, distributed across all chromosomes except chromosome 12. This suggests that rice resistance resources from different sources may have distinct mechanisms for resistance to rice black-streaked dwarf disease. Furthermore, the complexity of these mechanisms has severely hampered the progress of rice resistance breeding for rice black-streaked dwarf disease.

[0004] Identifying resistance to rice black-streaked dwarf disease (RBSDV) is a major constraint on disease-resistant rice breeding. Although field testing is quick and easy in severely affected areas, it is susceptible to environmental conditions and inter-annual and regional variations in the occurrence (incidence and prevalence) of the small brown planthopper (SBPH). This can lead to significant discrepancies in resistance testing results between studies. Furthermore, the simultaneous transmission of rice stripe virus (RSV) by SBPH can interfere with field testing results. Artificial inoculation testing, a controlled resistance testing method, can circumvent the challenges of field testing. However, since RBSDV is not transmitted through SBPH eggs, this method is relatively time-consuming and labor-intensive. Consequently, phenotypic screening for disease-resistant lines during breeding is extremely difficult.

[0005] Molecular marker-assisted selection utilizes molecular markers tightly linked to target genes to accurately identify the genotypes of different individuals in hybrid offspring. This approach is unrestricted by environmental factors or gene expression, offering advantages such as simple and rapid detection methods, significantly improving selection accuracy and breeding efficiency. Using a genetic population constructed from Wuke, a rice variety uniquely resistant to black streaked dwarf disease, and Huaidao 5, a susceptible variety, genetic analysis identified molecular markers linked to the major QTL for disease resistance on Wuke chromosome 6. This allows for early-stage screening of the offspring of this resistant variety and its derivatives at the seedling stage, effectively identifying disease-resistant plants and eliminating susceptible ones, saving costs while improving breeding efficiency. Summary of the Invention

[0006] Purpose of the invention: The technical problem to be solved by the present invention is to provide a molecular marker that can effectively screen for a gene resistant to rice black streaked dwarf disease and a method for using the molecular marker.

[0007] The present invention uses the F2 segregating population established by hybridizing Wuke and Huaidao No. 5 to construct a genetic linkage map of SLAF markers. By identifying the disease resistance phenotype of the population, the major effect QTL on chromosome 6 of Wuke is located, and the SLAF molecular markers closely linked to it are obtained. Marker629043 .

[0008] The molecular marker provided by the present invention is closely linked to the major QTL of resistance to rice black streaked dwarf disease on chromosome 6 of Wuke Marker629043 , is obtained by: Wuke was hybridized with Huaidao 5 to construct an F2 segregating population. The resistance of each strain in the population to rice black streaked dwarf disease was identified by artificial inoculation.

[0009] DNA of each strain in the F2 population was extracted and digested with restriction endonuclease MseI. The digested fragments were blunt-ended, 5' phosphorylated, and 3'-end A-treated. Sequencing adapters were connected, and the target fragments were selected by gel excision for PCR amplification and sequencing.

[0010] Develop SLAF markers for each locus, filter out markers with missing parental information, low completeness, and severe segregation, and screen polymorphic markers to construct a genetic linkage map.

[0011] Combining genotypic and phenotypic data, the resistance QTLs were located using the QTL Icimapping software, with the threshold set at LOD = 2.0.

[0012] Obtained QTLs significantly associated with disease resistance qRBSDV6 , and closely linked molecular markers Marker629043 .

[0013] The present invention can overcome the shortcomings of poor repeatability, time-consuming and labor-intensive identification of rice black streaked dwarf disease resistance in conventional breeding, thereby simplifying the selection method and improving breeding efficiency, thereby accelerating the breeding process of disease-resistant varieties. DETAILED DESCRIPTION

[0014] The methods used in the following examples are all conventional methods unless otherwise specified.

[0015] Example 1, major QTL for resistance to rice black-streaked dwarf virus qRBSDV6 Acquisition of tightly linked molecular markers 1. Plant materials The F2 segregating population constructed from the hybridization of Wuke and Huaidao 5 was used to identify the resistance to rice black streaked dwarf disease.

[0016] 2. Virus source and virus inoculation (1) Rice black-streaked dwarf virus (RBSDV) was collected from Nanjing, Jiangsu Province. Suspected RBSDV plants at 4-5 leaf age were collected and tested by RT-PCR using RBSDV-specific primers. RBSDV-positive plants were artificially inoculated and identified. After confirmation by testing, they were transplanted to the laboratory's experimental field to preserve the virus source for feeding and toxicity testing.

[0017] (2) SBPH larvae were collected from laboratory-maintained populations and reared on RBSDV-positive rice plants for 7 days. SBPH were then transferred to healthy Wuyujing 3 rice seedlings for 8 days to allow RBSDV to circulate within the SBPH. The virus-carrying rate of the SBPH population was determined using a dot-ELISA.

[0018] 3. Evaluation of resistance to rice black streaked dwarf disease 108 F 2:3 To identify resistance in families, rice was sown in 500ml beakers. At the 1.5-leaf stage, the rice seedlings were inoculated with two infected SBPHs per plant for three days, based on the prevalence of SBPHs. After removing the SBPHs, the seedlings were transplanted to a cement pond experimental plot at the Jiangsu Academy of Agricultural Sciences. No pesticides or antivirals were applied during the rice growth period, and all other field management procedures were standard. One month after transplanting, the incidence of rice black-streaked dwarf disease (RBD) was recorded. Compared to healthy plants, diseased plants exhibited significant dwarfing, with stiff, dark green leaves and waxy, white bumps on the undersides, sheaths, and stems. Three replicates were performed for each family. The mean of the replicates was used as the phenotypic value. Resistance to RBD was evaluated using the incidence (number of RBD-infected plants / total number of plants × 100%).

[0019] 4. Rice plant DNA extraction (CTAB method) 1) Weigh 500 mg of rice leaves into a 2.0 mL Eppendorf tube. Cool the tube in liquid nitrogen. Once the tube is filled with liquid nitrogen, remove the tube immediately and grind it into a powder using a grinding rod. 2) Incubate in a water bath at 65°C for 0.5 h, shaking every 10 min; 3) Centrifuge at 12,000 rpm for 10 min at 4°C and remove the upper aqueous phase; 4) Add 900 μL of chloroform:isoamyl alcohol solution (24:1) and mix thoroughly until the solution changes color from green to white. 5) Centrifuge at 12,000 rpm for 10 min at 4°C and remove the upper aqueous phase. 6) Add an equal volume of isopropanol (or 2 volumes of anhydrous ethanol) and incubate at -20°C for 20-30 minutes to precipitate the flocculent DNA. 7) Centrifuge at 12,000 rpm for 10 min at 4°C, discard the supernatant, add 1 mL of 70% ethanol for washing, and centrifuge at 12,000 rpm for 5 min at 4°C. Discard the supernatant, blot dry with filter paper, and place on a clean bench to air dry.

[0020] 8) Dissolve the DNA in 30 μL of deionized water and store at 4°C until use.

[0021] The OD value and concentration were determined using an Eppendorf BioPhotometer Plus nucleic acid and protein analyzer, and the DNA of each sample was diluted to 20 ng / μL for later use.

[0022] 5. Development of SLAF markers and construction of genetic linkage maps The sample DNA was digested with the restriction endonuclease MseI, resulting in inserts ranging from 230 to 280 bp. The digested fragments were blunt-ended, 5'-phosphorylated, and 3'-end amplified. Sequencing adapters were ligated, and the target fragments were selected by gel excision. PCR amplification and sequencing were then performed. Data were evaluated and statistically analyzed. SLAF markers were identified through clustering and error correction. Polymorphic markers were selected and genotyped, and marker composition suitable for F2 population mapping was screened. Two-point linkage analysis was performed using RECORD. Based on marker distribution along the chromosome, markers on the same chromosome were identified as a linkage group. Linear alignment of markers within a linkage group was obtained using RECORD, and genetic distances between adjacent markers were estimated to create a genetic linkage map.

[0023] 6. Main effect QTL qRBSDV6 Acquisition of tightly linked molecular markers Combining population phenotypic and genotypic data, the ICIM-ADD model of the QTL Icimapping software was used to locate the QTL, with a step size of 0.5 cM and a threshold of LOD = 2.0. The positioning results showed that the QTL was located on chromosome 6. qRBSDV6 is a major QTL, and is associated with SLAF markers Marker629043 Tightly linked.

[0024] The sequences of SLAF marker Marker629043 in Wuke and Huaidao 5 are: TCCAAATTTTATACTACATAAATGCTCTACATTTGTATTGXXXXXXXXXXCCAAGGCTTGTGCGACCCAACCAGTCAACTTTCTCCATGC TCCAAATTTTATACTACCTAAATGCTCTATATTTGTACTGXXXXXXXXXXCCAAGGCTTGTGCGACCCAACCAGTCAACTTTCTCCATGC To develop convenient molecular markers, we used SLAF markers Marker629043 Sequence design of primers: Marker629043F :TCCAAATTTTATACTAC Marker629043R :GCATGGAGAAAGTTGACTG 7. PCR amplification and detection A 20 μL PCR reaction system was used (Table 1); The PCR reaction procedure was as follows: denaturation at 94°C for 5 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s; extension at 72°C for 10 min, and storage at 4°C. The PCR products were detected on 2% agarose gel.

[0025] Table 1 PCR reaction system sample volume DNA (10 ng / μL) 1.0 μL Primer forward (4 pmol / μL) 1.0 μL Primer reverse (4 pmol / μL) 1.0 μL 2×Mix 10 μL ddH2O 7 μL Total volume 20 μL Use primers Marker629043F / R The samples were amplified by PCR using Marker629043F If the 18th base is A in unidirectional sequencing, the sample contains the major QTL for Wuke resistance to rice black streaked dwarf disease qRBSDV6 If the 18th base is C, the sample does not contain the major QTL for Wuke resistance to rice black-streaked dwarf disease. qRBSDV6.

[0026] Example 2: Application of a SLAF marker tightly linked to the major QTL for resistance to rice black-streaked dwarf disease in the hybrid progeny of Wuke and Huaidao No. 5.

[0027] Using SLAF markers closely linked to the QTL for resistance to rice black streaked dwarf disease, we identified F genes in the hybrids of Wuke and Huaidao 5. 2:3 The resistance of some individual plants to rice black streaked dwarf virus was predicted. DNA of each individual plant was extracted and then labeled with SLAF primers. Marker629043F / R PCR amplification analysis and PCR product sequencing were performed to determine the presence of the corresponding marker. The presence of the marker indicated resistance to rice black-streaked dwarf virus, while its absence indicated susceptibility. Subsequently, artificial inoculation was used to determine the actual resistance of the tested lines to rice black-streaked dwarf virus and compare it with the predicted results. The results (Table 2) showed that the predicted results were consistent with the actual test results.

[0028] Table 2 Utilization Marker629043 Prediction of Rice Black-streaked Dwarf Disease Resistance in Wuke / Huaidao 5 F2:3 Population Strain name mark RBSDVD resistance prediction results RBSDVD resistance actual results WH296 - feel feel WH355 - feel feel WH427 - feel feel WH669 - feel feel WH878 - feel feel WH175 + anti- anti- WH332 + anti- anti- WH341 + anti- anti- WH352 + anti- anti- WH381 + anti- anti- WH392 + anti- anti- WH409 + anti- anti- WH1114 + anti- anti-

Claims

1. A molecular marker tightly linked to a major QTL for resistance to rice black-streaked dwarf disease, characterized by: Molecular markers of the major QTL locus for resistance to rice black-streaked dwarf disease Marker629043 ,include Marker629043F and Marker629043R Primer pairs.

2. A major QTL locus for resistance to rice black-streaked dwarf disease, characterized in that: The major QTL locus for resistance to rice black streaked dwarf disease is closely linked to the molecular marker on chromosome 6 of rice. The molecular marker includes Marker629043F and Marker629043R Primer pairs.

3. The major QTL locus for resistance to rice black-streaked dwarf virus according to claim 2, wherein: The significant LOD value of the major QTL locus for resistance to rice black-streaked dwarf disease and its linkage with resistance to rice black-streaked dwarf disease is 2.

9.

4. A method for detecting resistance to rice black-streaked dwarf disease using molecular markers, characterized in that: The following steps are involved: (1) Extracting genomic DNA from the rice to be tested; (2) using the molecular markers of the QTL loci for resistance to rice black-streaked dwarf disease according to claim 1 to perform PCR amplification on the genomic DNA; (3) Use Marker629043F The PCR product is sequenced in one direction. If the 18th base is A, the rice to be tested is black-streaked dwarf disease-resistant rice; otherwise, the rice to be tested is not black-streaked dwarf disease-resistant rice.

5. A method for breeding rice with high resistance to black streaked dwarf disease using molecular markers, characterized in that: The following steps are involved: (1) Extracting genomic DNA from the rice to be tested; (2) performing PCR amplification on the genomic DNA using the molecular marker of the major QTL locus of rice black streaked dwarf disease according to claim 1; (3) Use Marker629043F The PCR product is sequenced in one direction. If the 18th base is A, the rice to be tested is highly resistant to rice black-streaked dwarf disease, and the rice with high resistance to black-streaked dwarf disease is applied to rice disease resistance breeding. 6 . Use of the molecular marker of the major QTL locus for resistance to rice black-streaked dwarf disease according to claim 1 in detecting the resistance level of rice black-streaked dwarf disease. 7 . Use of the molecular marker of the major QTL locus for resistance to rice black-streaked dwarf disease according to claim 1 in predicting the resistance to rice black-streaked dwarf disease.