A method of constructing a fast-growing sterile zebrafish model
By knocking out the ck1 and ck2 genes in zebrafish, a fast-growing sterile zebrafish model was constructed using the CRISPR/Cas9 system, solving the problem of rapid growth and sterility in fish. This model achieves rapid growth, complete gonadal sterility, reduced costs, and protected ecological security.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- HUAZHONG AGRI UNIV
- Filing Date
- 2025-04-11
- Publication Date
- 2026-05-05
AI Technical Summary
Existing technologies cannot simultaneously achieve rapid growth and sterility in fish, resulting in long breeding cycles, high costs, and the risk of genetic contamination.
By knocking out the ck1 and ck2 genes in zebrafish using gene editing technology and then using the CRISPR/Cas9 system for gene editing, a fast-growing but sterile zebrafish model was constructed to ensure that the fish grows rapidly and has poor gonadal development, resulting in complete sterility.
A fast-growing, sterile zebrafish model was successfully constructed. The zebrafish exhibits rapid growth, poor gonadal development, and complete sterility, significantly shortening the breeding cycle, reducing production costs, preventing genetic pollution, and protecting the ecosystem.
Smart Images

Figure CN120555443B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of animal model preparation technology, and in particular to a method for constructing a fast-growing sterile zebrafish model. Background Technology
[0002] Developing new, fast-growing fish strains has significant economic, ecological, and social implications. First, from an economic perspective, fast-growing fish can significantly shorten the aquaculture cycle, increase yields and economic benefits, reduce production costs, and enhance the market competitiveness of the aquaculture industry. Second, fast-growing fish can meet the global demand for high-quality protein, especially given the growing importance of food security, providing a sustainable source of nutrition. Furthermore, through scientific breeding and genetic modification, this technology can reduce dependence on wild fish resources, protect marine ecosystems, and promote the sustainable use of fishery resources. Finally, new, fast-growing fish strains can also drive the development of related industrial chains, such as feed production, processing, and cold chain logistics, creating more employment opportunities and economic value for society.
[0003] Developing new sterile fish strains has profound significance for aquaculture and ecological protection. By editing genes and creating sterile strains, the reproductive capacity of farmed fish in the natural environment can be effectively blocked. This characteristic fundamentally solves the problem of genetic pollution caused by the hybridization of escaped individuals with wild populations in traditional aquaculture, avoids the risk of invasive species, and thus protects the stability and biodiversity of natural aquatic ecosystems. At the same time, sterile fish, because they do not require energy investment for gonadal development, exhibit significantly improved growth rates and feed conversion rates, which can shorten the farming cycle and reduce production costs, contributing to increased industry efficiency.
[0004] This invention discovers that the CK gene can not only promote gonadal development but also inhibit growth. Therefore, by knocking out the CK gene through gene editing technology, a new strain of fish that grows rapidly and is sterile can be obtained. Summary of the Invention
[0005] The purpose of this invention is to provide a method for constructing a fast-growing sterile zebrafish model, thereby contributing to the improvement of economic benefits in aquaculture and the maintenance of ecological security.
[0006] To achieve the above objectives, this invention provides the application of the ck gene in regulating the growth rate and fertility of fish. Fish with ck1 and ck2 genes knocked out grow faster and are all male-sterile zebrafish. The CDS sequence of the ck1 gene is shown in SEQ ID NO.1, and the CDS sequence of the ck2 gene is shown in SEQ ID NO.2.
[0007] The application of the ck gene in breeding fast-growing fish varieties, as described above.
[0008] A method for constructing a fast-growing, sterile zebrafish model using the aforementioned ck gene, comprising the following steps:
[0009] S1. Determine the target site sequences of the ck1 and ck2 genes;
[0010] S2. Synthesize gRNAs targeting the respective sites;
[0011] S3. Mix Cas9 protein and the two purified gRNAs at a volume ratio of 1:1 and inject them into fish eggs in stages 1 and 2 by microinjection; the concentration of both Cas9 protein and gRNA is 200 ng / μL.
[0012] S4. Identify the F0 generation of mutants and obtain homozygous single mutants of the ck1 and ck2 genes;
[0013] S5. Select ck1 and ck2 single mutants for mating to obtain double mutants in which both ck1 and ck2 are mutated, which is the fast-growing sterile zebrafish model.
[0014] Preferably, the target site sequence of ck1 in S1 is shown in SEQ ID NO.3, the upstream primer sequence for detecting the target site is shown in SEQ ID NO.4, and the downstream primer sequence is shown in SEQ ID NO.5; the target site sequence of the ck2 gene is shown in SEQ ID NO.6, the upstream primer sequence for detecting the target site is shown in SEQ ID NO.7, and the downstream primer sequence is shown in SEQ ID NO.8.
[0015] Preferably, the method for obtaining gRNA from the target site in S2 is as follows: using the target forward sequence with the T7 promoter sequence added and the target downstream sequence with the gRNA backbone added as primers, PCR amplification is performed and the amplification product is recovered by gel to obtain the template for gRNA synthesis; the gRNA synthesis template is used to prepare the reaction system and incubated at 37°C for 4 hours, followed by in vitro transcription; the transcription product is purified after DNA removal to obtain gRNA.
[0016] Preferably, the incubation reaction system for the template of gRNA synthesis is 12.5 μL of Phusion™ High-Fidelity PCRMaster Mix (2X), 1 μL of Tracr Fragment+T7 Primer Mix, 1 μL each of 0.3 μM upstream and downstream primers, 10.5 μL of nuclease-free water, and a total volume of 25 μL.
[0017] Preferably, the T7 promoter sequence is shown in SEQ ID NO.9, and the gRNA backbone sequence is shown in SEQ ID NO.10.
[0018] The application of a method described above for constructing a fast-growing sterile zebrafish model by knocking out the ck gene using CRISPR / Cas9 gene editing technology in the breeding of fast-growing fish varieties.
[0019] The application of a method described above for constructing a fast-growing, sterile zebrafish model by knocking out the ck gene using CRISPR / Cas9 gene editing technology in the breeding of sterile fish varieties.
[0020] Therefore, the method for constructing a fast-growing sterile zebrafish model provided by this invention has the following specific technical effects:
[0021] (1) This invention first discovered the role of the ck gene in regulating the growth rate and fertility of fish: fish with simultaneous knockout of ck1 and ck2 genes have a fast growth rate and are all sterile zebrafish.
[0022] (2) The method provided by this invention successfully constructed a fast-growing sterile zebrafish model. The zebrafish with poor gonadal development were all sterile and grew rapidly. Compared with wild zebrafish, the body length and weight of the 4-month-old double mutant zebrafish were significantly increased.
[0023] (3) The gene function and zebrafish model construction method disclosed in this invention can be used for the breeding of fast-growing fish and the study of related mechanisms, which is of great significance for improving the economic benefits and ecological security of aquaculture. Attached Figure Description
[0024] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0025] Figure 1 A schematic diagram of the design sites for ck1 and ck2 genes and sgRNA, and a sequencing result of PCR fragments of the ck1 and ck2 gene knockout zebrafish targeting regions; where (A) shows the target site of ck1 sgRNA and the positions of 14 and 10 base deletions after targeting, as well as the sequencing results showing ck1 - / - Changes in the target region sequence of zebrafish; (B) shows the target site of ck2 sgRNA and the location of the 7-base deletion after targeting, as well as the sequencing results showing ck2 - / - Changes in the target region sequence of zebrafish;
[0026] Figure 2 The results of immunofluorescence assay in the hypothalamus of zebrafish with double deletion of ck1 and ck2 genes;
[0027] Figure 3Anatomical diagram of the gonads of zebrafish with simultaneous knockout of WT (A), ck1 and ck2 (B);
[0028] Figure 4 Immunohistochemical results of gonads in zebrafish with simultaneous knockout of WT (A), ck1 and ck2 (B);
[0029] Figure 5 Statistical results of sex ratio (A), sex ratio (B), and spawning rate in zebrafish with ck1 and ck2 knocked out individually and ck1 and ck2 knocked out simultaneously;
[0030] Figure 6 Statistical results of body weight (A), body length (B), and feeding rate (C) of zebrafish with simultaneous knockout of WT, ck1, and ck2. Detailed Implementation
[0031] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.
[0032] To make the objectives, technical solutions, and advantages of this application clearer, more thorough, and more complete, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings and embodiments. The following detailed descriptions are all illustrations of embodiments, intended to provide further detailed explanation of the present invention. Unless otherwise specified, all technical terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0033] The instruments, equipment, reagents, and materials used in the examples were all obtained commercially.
[0034] Example 1
[0035] The specific steps for preparing a fast-growing and sterile zebrafish are as follows:
[0036] S1. Identify CRISPR / Cas9 gene editing targets. Determine the exon and intron positions in the CDS regions of ck1 and ck2. The exon and intron positions of ck1 are as follows: Figure 1 As shown in (A), the exon and intron positions of ck2 are as follows: Figure 1 As shown in (B), the CDS sequence of ck1 is shown in SEQ ID NO.1, and the CDS sequence of ck2 is shown in SEQ ID NO.2.
[0037] SEQ ID NO.1:
[0038] ATGAACGCTGGACTCTGTGTATGTGCCCTGCTGGCTGCTCTCTCCACCAGCAGCTGCCTTTCTCTCCCTGTACATTCAGAAGATGGAGTTCAGTCTAATGTCGGCTCCGCAACAGGACACACGCGCCACACCCGCGCAGCGCCGCCTGCTGGACAAATCAACCTGCTGACCAAACCAGAGGACGATGAAGAACCTCGCAGCAGCCTAACCGAACTACTGGCCAGAATCATCTCAACCAAAGGCTCATACCGCAGAAGTCCCGCTGCAAACAGCAGGACCATGGGTGCATCTCACAGAATAAAGGACAGAGATTACTTGGGATGGATGGATTTTGGCCGACGAAGCGCCGAGGAATATGAATACTCCTCATAA
[0039] SEQ ID NO.2:
[0040] ATGAACAGCGGGGTGTGTGTGTGTGTGATCCTGGCCGCGCTCTCAGTCTCAGTGTCGTGTGCGTCTCGGCCGGTCTCAGATGAGCGCTCTCTCTCCGCGCGCCGGCTCGCCCGCTCCGCCAGCCTCACTCTCCAGCAGCCGCTGCCACCAGCGGGCGACATCCAGCCCGACACCCGCGCCAACCTCAGCCAGCTGCTGGCCAAACTCATCTCCAGTAAAAAAGGCTCCGTTCGCCGGAACTCCTCGATGAACAGCCGAGCGAACAGCGTCAACCACCGGATAAAAGACCGGGATTATGTGGGCTGGATGGACTTCGGCCGCCGGAGCGCTGAGGAATATGAATACTCATCATAA
[0041] Further evaluate the target sequence at the website http: / / www.oligoevaluator.com / LoginServlet, requiring that the Secondary Structure is no / very weak / weak and the GC% is 40 - 60%.
[0042] Finally, 2-3 target sequences were identified for further confirmation. RNA was extracted from adult fish prepared for targeting and transcribed into cDNA, which was then used as a template. Primers were designed around the target site, ensuring they were more than 100 bp away from both sides of the target site, and that the PCR amplification product did not exceed 500 bp and was a single band. The PCR product was sent to a sequencing company to confirm the usability of the target site.
[0043] The most effective target from ck1 and ck2 was selected respectively. The target sequence of ck1 is shown in SEQ ID NO.3, the upstream primer sequence of the designed detection target is shown in SEQ ID NO.4, and the downstream primer sequence is shown in SEQ ID NO.5. The target sequence of ck2 is shown in SEQ ID NO.6, the upstream primer sequence of the designed detection target is shown in SEQ ID NO.7, and the downstream primer sequence is shown in SEQ ID NO.8.
[0044] SEQ ID NO.3:GTGGAGAGAGCAGCCA
[0045] SEQ ID NO.4:AGCAGTTTCACTCACTAATCCTC
[0046] SEQ ID NO.5:TGCGGAGCCGACATTAGAC
[0047] SEQ ID NO.6:GCTGAGGTTGGCGCGG
[0048] SEQ ID NO.7:TGCTCTCCTCCTCAGGTCTC
[0049] SEQ ID NO.8:TCAGTGTCGTGTGCGTCTC
[0050] S2. gRNA Synthesis. A T7 promoter sequence (as shown in SEQ ID NO. 9) was added before the designed target forward primer, and an upstream sequence of the gRNA backbone (as shown in SEQ ID NO. 10) was added after the target. Using the gRNA pMD19-T plasmid as a template, and with the target forward sequence containing the T7 promoter and the target downstream sequence containing the gRNA backbone as primers, a fragment including the target and gRNA sequences was amplified by PCR. The template for gRNA synthesis was then obtained by gel recovery. The amplification system is shown in Table 1. The amplification program was 98℃ for 10 s; 98℃ for 5 s, 55℃ for 15 s, 32 cycles; 72℃ for 1 min; and incubation at 4℃.
[0051] SEQ ID NO.9:TAATACGACTCACTATAG
[0052] SEQ ID NO.10:TTCTAGCTCTAAAAC
[0053] S3. Prepare the system according to Table 1, mix well, centrifuge briefly, and incubate at 37°C for 4 hours. Prepare the reaction system according to the instructions of the transcription kit for in vitro transcription. The reaction program is: 98°C for 10 seconds; 98°C for 5 seconds, 55°C for 15 seconds, 32 cycles; 72°C for 1 minute. After the reaction, immediately add 1 μL of DNase I and incubate at 37°C for another 15 minutes. Then purify the obtained product, which is gRNA.
[0054] Table 1 Reaction System
[0055] reagents Volume (μL) <![CDATA[Phusion TM High-FidelityPCRMasterMix(2X)]]> 12.5 TracrFragment+T7PrimerMix 1 0.3μM TargetF1 / R1oligonucleotidemix 1 Nuclease-free water 10.5 Total volume 25
[0056] The purification procedure was as follows: First, nuclease-free water was added to make a total volume of 200 μL. Then, 100 μL of binding buffer was added and mixed by pipetting. Next, 300 μL of ethanol (>96%) was added and mixed by pipetting. Finally, the mixture was transferred to a GeneJET container fitted with a collection tube. TM In the RNA Purification Micro Column, centrifuge at 14,000 rpm for 60 seconds at room temperature and discard the liquid. Add 700 μL of Wash Buffer 1 (ensure it has been diluted with 13 mL of >96% ethanol), centrifuge at 14,000 rpm for 30-60 seconds at room temperature and discard the liquid. Add another 700 μL of Wash Buffer 2 (ensure it has been diluted with 30 mL of >96% ethanol), centrifuge at 14,000 rpm for 30-60 seconds at room temperature and discard the liquid. Add another 700 μL of Wash Buffer 2, centrifuge at 14,000 rpm for 30-60 seconds at room temperature and discard the liquid. Centrifuge the empty tube at 14,000 rpm for 60 seconds at room temperature (residual ethanol in the RNA sample will inhibit the downstream enzyme reaction). Then transfer the column to a new 1.5 mL EP tube and add 15 μL of nuclease-free liquid to the column. Centrifuge at 14,000 rpm for 60 seconds in water at room temperature; add the centrifuged solution back into the column tube and centrifuge again at 14,000 rpm for 60 seconds (to improve recovery rate); finally, measure the concentration using Nanodrop. Store the stock solution in a liquid nitrogen tank and store the diluent at -80℃ for later use.
[0057] S4. Microinjection. Dissolve agarose in double-distilled water, heat it, pour it into a petri dish, and place a mold inside. After the agarose cools, remove the mold; the microinjection plate is now ready.
[0058] The capillary glass tube is fixed to the heating wire of the needle-drawing device, and the device is started to heat up, causing the capillary glass tube to stretch and burn off. The prepared glass tube is then rubbed on a needle-grinding device to form a notch, and the injection needle is now ready.
[0059] Sexually mature zebrafish were placed on either side of a mating box at a female-to-male ratio of 2:3, separated by a partition. The partition was removed the following morning, at which point the zebrafish began mating. 200 ng / μL of Cas9 protein and 200 ng / μL of gRNA were mixed thoroughly at a volume ratio of 1:1 and phenol red was added to prepare the injection solution. The microinjector was installed and turned on. Inject mode was selected, and the injection volume was set to 2 nL and the injection rate to 200 nL / sec. The zebrafish eggs were collected and arranged neatly in an injection plate. The injection needle was installed, air was expelled, and the injection solution was aspirated. The fertilized zebrafish eggs in stages 1-2 were microinjected within ten minutes.
[0060] S5. Mutant Identification. After the injected zebrafish eggs reached sexual maturity, approximately 0.5 cm of the tail fin was cut off and placed in a PCR tube. 30 μL of lysis buffer was added, and the PCR program was set to 60℃ for 30 min, followed by 94℃ for 10 min to obtain DNA. Using the obtained DNA as a template, PCR amplification was performed using the sequences shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.7, and SEQ ID NO.8 as primers, according to the system shown in Table 1. The amplification program was 94℃ for 10 min; 94℃ for 30 s, 55℃ for 30 s, 72℃ for 90 s, 36 cycles; 72℃ for 10 min.
[0061] The obtained PCR products were sequenced, and the sequencing results were analyzed to determine whether the knockout was successful. The presence of overlapping peaks, with the peak positions matching the expectations, indicated the presence of the F0 generation mutant. A total of 24 zebrafish were tested, and 17 F0 generation zebrafish were obtained.
[0062] S6. Preparation of F2 generation single knockout zebrafish mutants. Sexually mature F0 generation zebrafish mutants were crossbred with wild-type zebrafish to obtain F1 generation zebrafish mutants. The same method as in S5 was used for detection. Male and female zebrafish with the same peak position (same genotype) were selected for crossbringing to obtain the F2 generation ck1 knockout mutant (ck1...). - / - ) and F2 generation ck2 knockout mutant (ck2 - / - The genotypes of the F2 generation ck1 knockout mutants are AA, Aa, and aa, and the genotypes of the F2 generation ck2 knockout mutants are BB, Bb, and bb.
[0063] Two genotypes of F2 generation ck1 knockout mutants, M1 and M2, were obtained. M1 has a 14bp deletion at the target site, resulting in the ck1 gene encoding only 27 amino acids (the wild-type zebrafish ck1 gene encodes 123 amino acids). M2 has a 10bp deletion at the target site, resulting in the ck1 gene encoding only 52 amino acids (e.g., ...). Figure 1 (as shown in part (A)).
[0064] One genotype of the F2 generation ck2 knockout mutant M1 was obtained. The M1 mutant has a 7bp deletion at the target site, resulting in the ck2 gene encoding only 80 amino acids (the wild-type zebrafish ck2 gene encodes 117 amino acids). Figure 1 (as shown in part (B)).
[0065] S7. Preparation of ck1 and ck2 dual knockout (ck1 - / - ;ck2 - / - Zebrafish mutants. Based on sequencing results, zebrafish mutants with genotype aa (aaBB) from the F2 generation ck1 knockout mutant and zebrafish mutants with genotype bb (AAbb) from the F2 generation ck2 knockout mutant were selected for hybridization. The offspring (F3 generation) had the genotype AaBb. The F3 generation mutants were self-crossed to obtain the F4 generation zebrafish mutants, among which the zebrafish mutant with genotype aabb was the ck1 and ck2 double knockout zebrafish mutant (ck1... - / - ;ck2 - / - This accounts for 1 / 16 of the F4 generation.
[0066] Tests were conducted during the period of sexual maturity, ck1 - / - ;ck2 - / - The results of the mutant hypothalamus knockout test are as follows: Figure 2 As shown, immunofluorescence revealed that CK protein was undetectable in the hypothalamus after ck1 and ck2 gene knockout.
[0067] sexually mature ck1 - / - ;ck2 - / - Anatomical diagrams of the gonads of mutant and wild-type zebrafish are shown below. Figure 3 As shown, wild-type zebrafish (A) had normal gonadal development. No females appeared after ck1 and ck2 were knocked out at the same time, and the male gonads were completely sterile until the sg and sc stages (B).
[0068] Immunohistochemical results of zebrafish gonads with simultaneous knockout of ck1 and ck2 are as follows: Figure 4 As shown, staining with VASA and SYCP3 proteins revealed that zebrafish with simultaneous knockout of ck1 and ck2 had completely sterile testes and were unable to undergo meiosis, while wild-type zebrafish had normal testicular development.
[0069] The sex ratio (A), sex-to-body ratio (B), spawning rate (C), spawning quantity, fertilization rate, and success rate of ck-knockout zebrafish are as follows: Figure 5 As shown, knocking out the ck gene alone leads to a male-dominant sex ratio in zebrafish, while double knockout results in an all-male phenotype. Knocking out the ck gene alone reduces the sex ratio in zebrafish, while double knockout results in complete sterility. Knocking out the ck gene alone also reduces the number of eggs laid, the fertilization rate, and the success rate of fertilization in zebrafish, while double knockout results in zero number of eggs laid, the fertilization rate, and the success rate of fertilization.
[0070] Using ck1 + / - ;ck2 - / - Female zebrafish and ck1 - / - ;ck2 + / - Male zebrafish were mated, and the offspring were selected at 4 months of age. Males with the AaBb hull type were compared with those with the aabb hull type in terms of weight, body length, and feeding rate.
[0071] Feed intake calculation: After measuring body length and weight, the food was placed in a numbered 1.25L transparent plastic bowl (containing 1L of water) and placed in a light incubator. The food was fasted the night before the experiment and the experiment started at 8:00 am the next day. Based on the preliminary experiment, it was determined that 8% of the body weight of the food was fed with pelleted feed with a particle size of 600μm. After 1 hour, the remaining feed was sucked out, dried and weighed.
[0072] The formula for calculating feed intake rate is: (weight of feed given - weight of feed remaining) / body weight.
[0073] The results are as follows Figure 6 As shown, when ck1 and ck2 were simultaneously knocked out, the body weight (A), body length (B), and feeding rate (C) of zebrafish were significantly increased.
[0074] Therefore, this invention is the first to discover the role of the CK gene in regulating the growth rate and fertility of fish: fish with simultaneous knockout of ck1 and ck2 genes exhibit rapid growth and complete gonadal abortion; a fast-growing sterile zebrafish model was successfully constructed using the method provided in this invention, in which the zebrafish exhibits gonadal dysplasia and sterility, and rapid growth. Compared with wild-type zebrafish, the body length and weight of the 4-month-old double mutant zebrafish are significantly increased; the disclosed gene function and zebrafish model construction method can be used for the breeding of fast-growing fish varieties, sterile varieties, and related mechanism research, which is of great significance for improving the economic benefits of aquaculture and maintaining ecological security.
[0075] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. Knockout ck1 and ck2 The application of genes in regulating the growth rate and fertility of zebrafish is characterized by: Simultaneously knock out ck1 and ck2 The genetically modified zebrafish grow quickly and are all gonadally sterile. ck1 The CDS sequence of the gene is shown in SEQ ID NO.
1. ck2 The CDS sequence of the gene is shown in SEQ ID NO.2.