Preparation method of self-assembled SERS sensor based on double-Y structure, product and application of SERS sensor in detection of methicillin-resistant staphylococcus aureus

By using a SERS sensor based on double Y structure self-assembly, Au@Ag@SiO2 composite nanostructure and DNA self-assembly technology, the problems of unstable signal and insufficient sensitivity of SERS sensors in detecting methicillin-resistant Staphylococcus aureus were solved, achieving high sensitivity and specificity detection, which is suitable for rapid detection of complex biological samples.

CN120609803APending Publication Date: 2025-09-09ANHUI UNIVERSITY OF TECHNOLOGY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510799563.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-16
Publication Date
2025-09-09

AI Technical Summary

Technical Problem

When existing SERS sensors detect methicillin-resistant Staphylococcus aureus, there are problems such as chemical instability of the silver shell causing signal fluctuations and uneven electromagnetic field coupling area resulting in poor sensitivity and reproducibility.

Method used

A SERS sensor based on double Y structure self-assembly is used. Through Au@Ag@SiO2 composite nanostructure and DNA self-assembly technology, a stable electric field coupling effect area is formed, and the uniform arrangement of Raman molecules is achieved. The aptamer is combined as a recognition element to ensure the stability and specificity of the signal.

Benefits of technology

The Raman signal intensity is significantly improved, the detection limit is as low as 1 CFU/mL, and the linear range is wide (100-107 CFU/mL). It is suitable for the detection of complex biological samples, easy to operate, and suitable for clinical instant diagnosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120609803A_ABST
    Figure CN120609803A_ABST
Patent Text Reader

Abstract

The invention discloses a preparation method of a self-assembled SERS (Surface Enhanced Raman Scattering) sensor based on a double-Y structure, a product and application of the SERS sensor in detection of methicillin-resistant staphylococcus aureus, and relates to the technical field of nano materials and biological detection. The probe 1 and the probe 2 are prepared by coupling Au (at) Ag (at) SiO2 and different hairpin DNA, Y1-block has two active sites locked by a Locker chain, an aptamer-Trigger duplex body recognizes PBP2a on the surface of MRSA, releases the Trigger chain and is combined with the Locker chain, so that the cutting activity of Y1 is recovered, the cutting recognition sites of the probe 1 and the probe 2 are cut open, residual basic groups on the probe 1 and the probe 2 are complementarily paired, self-assembly of a Y2 structure is realized, and the probe 1 and the probe 2 can be used for detecting the MRSA surface. The T7 EXO enzyme releases the Trigger chain on the Trigger-Locker double chain body again, and the T7 EXO enzyme releases the Trigger chain on the Trigger-Locker double chain body again; the detection limit reaches 1 CFU / mL, the linear range is wide, the anti-interference capability and selectivity are high, and the stability and reproducibility are excellent.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of nanomaterials and biological detection technology, and in particular to a preparation method and product of a SERS sensor based on double Y structure self-assembly, and application of the SERS sensor in the detection of methicillin-resistant Staphylococcus aureus. Background Art

[0002] Methicillin-resistant Staphylococcus aureus (MRSA), a multidrug-resistant bacterium, poses a significant threat to global public health. Its infection rates continue to rise, leading to numerous foodborne illnesses in humans, including pneumonia, sepsis, and septic shock, with high mortality rates. In addition to inherent resistance to β-lactam antibiotics, MRSA can also acquire resistance to other classes of antimicrobial agents through genetic mutation or horizontal transfer. Therefore, the development of rapid and accurate MRSA quantification methods is crucial for disease treatment and food safety.

[0003] Traditional MRSA quantification methods, such as microbial culture, have disadvantages such as complex operations and long time consumption. Currently established MRSA detection methods include surface-enhanced Raman spectroscopy, electrochemiluminescence, colorimetry, and fluorescence. For example, in the electrochemical method for MRSA detection published in "Dual-Mechanism-Driven Ratiometric Electrochemiluminescent Biosensor for Methicillin-Resistant Staphylococcus aureus" (2024), Yuchan Ma et al., the linear range is 53 CFU / mL to 5.3x10 6 CFU / mL, with a detection limit of 2 CFU / mL; in the plate count method for MRSA detection published by Xue Gao et al. in "Nano-biosensor based on manganese dioxide nanosheets and carbon dots for dual-mode determination of Staphylococcus aureus" (2024), the linear range was 37 CFU / mL to 3.7x10 7CFU / mL, with a detection limit of 22 CFU / mL; in the fluorescence detection method for MRSA published by Kyeonghye Guk et al. in "A facile, rapid and sensitive detection of MRSA using a CRISPR-mediated DNA FISH method, antibody-like dCas9 / sgRNA complex" in 2017, the linear range was 10 CFU / mL to 1x10 7 CFU / mL, with a detection limit of 10 CFU / mL. SERS has attracted much attention due to its excellent fingerprint peak performance and high sensitivity. SERS sensing devices typically utilize the plasmon properties of noble metal nanostructures, whose unique optical response mechanism can produce a significant field enhancement effect on molecular vibrational spectra. However, when using SERS to directly detect bacteria, interference from the overall bacterial volume and sampling area can easily lead to erroneous characteristic Raman fingerprint indications. Therefore, using aptamers as recognized recognition elements to separate bacterial recognition and SERS detection into two parts can effectively solve the SERS fingerprint peak problem and improve the sensitivity of MRSA identification. In the SERS method for detecting MRSA published in "Ratiometric SERS sensor for sensitive quantification of methicillin-resistant Staphylococcus aureus using Ti3C2@AuNP films and aptamer-based tags" (2025), Lian Kan et al. used a Ti3C2@AuNP-ratiometric SERS platform with a linear range of 10 CFU / mL to 1 x 10 8 CFU / mL, and the detection limit was 10 CFU / mL.

[0004] As a typical metal composite nanostructure, Au@Ag core-shell material is widely used in SERS enhancement substrates, but the chemical instability of the silver shell easily triggers oxidation reactions, resulting in attenuation of plasma resonance performance and signal fluctuations. In "Tailoring Plasmonics of Au@Ag Nanoparticles by Silica Encapsulation" 2021, Johannes Schultz et al. designed an Au@Ag@SiO2 composite Raman probe, which integrates the advantages of the electromagnetic field synergistic effect of the core-shell structure to improve the LSPR enhancement factor, and the silicon layer encapsulation to inhibit silver shell oxidation and non-specific leakage of Raman molecules; however, the detection performance of the SERS signal amplification mechanism based on electromagnetic field coupling is still subject to two key bottlenecks: when the Raman molecules are far away from the electromagnetic field coupling area or are unevenly distributed, the sensitivity and reproducibility of the SERS detection will be greatly affected. Therefore, how to construct a stable electric field coupling effect area and achieve uniform arrangement of Raman molecules has become the focus of research. Summary of the Invention

[0005] The purpose of the present invention is to provide a preparation method and product of a SERS sensor based on double Y structure self-assembly and its application in the detection of methicillin-resistant Staphylococcus aureus, so as to solve the problems mentioned above in the background technology.

[0006] To achieve the above objectives, the present invention provides the following technical solutions: a method for preparing a SERS sensor based on double Y structure self-assembly:

[0007] The SERS sensor includes Y1-block, aptamer-Trigger duplex, T7 EXO enzyme, probe 1, and probe 2;

[0008] The preparation method comprises the following steps:

[0009] The surface of Au@Ag@SiO2 nanoparticles coated with silicon layer was modified with amino groups using silane coupling agent to obtain amino-modified Au@Ag@SiO2 particles.

[0010] The hairpin DNA H3 with a carboxyl group modified at the 5' end was coupled to the surface of amino-treated Au@Ag@SiO2 particles via an amide bond to prepare probe 1;

[0011] The hairpin DNA H4 modified with a carboxyl group at the 5' end was mixed with the linker L3-4 and annealed. The resulting H4-L3-4 composite structure was coupled to the surface of amino-modified Au@Ag@SiO2 particles via an amide bond to prepare probe 2.

[0012] Several bases at the 3' end of the hairpin DNA H3 are complementary to a stretch of bases in the middle, and a cleavage recognition site rA is modified between the two complementary base stretches; several bases at the 3' end of the hairpin DNA H4 are complementary to a stretch of bases in the middle, and a cleavage recognition site rA is modified between the two complementary base stretches; a stretch of bases between the 5' end of the hairpin DNA H4 and the cleavage recognition site is complementary to a stretch of bases in the linker L3-4, and another stretch of bases in the linker L3-4 is complementary to a stretch of bases between the 5' end of the hairpin DNA H3 and the cleavage recognition site; a stretch of bases close to the 5' end of the base stretch of the hairpin DNA H3 that is complementary to the linker L3-4 is complementary to a stretch of bases away from the 5' end of the base stretch of the hairpin DNA H4 that is complementary to the linker L3-4;

[0013] The hairpin DNA H1, hairpin DNA H2, and linker L1-2 were annealed to prepare the Y1 three-arm structure, and the Locker chain was used to lock the two DNAzyme active sites left on Y1 through base complementary pairing to prepare Y1-block;

[0014] Hairpin DNA H1 and hairpin DNA H2 each have a DNAzyme active site for recognizing and cleaving the cleavage recognition sites of hairpin DNA H3 and hairpin DNA H4; linker L1-2 has two base segments that are complementary to a base segment on hairpin DNA H1 and a base segment on hairpin DNA H2, respectively; hairpin DNA H1 and hairpin DNA H2 also have a complementary base segment;

[0015] The aptamer and trigger chain are annealed to form an aptamer-trigger duplex;

[0016] The aptamer and the trigger chain each have a complementary base segment. The aptamer is used to recognize penicillin-binding protein 2a on the surface of MRSA and bind to it to release the trigger chain. The trigger chain is used to hybridize with the locker chain on the Y1-block to form a trigger-locker duplex. The T7 EXO enzyme is used to cut the locker chain on the trigger-locker duplex to release the trigger chain again.

[0017] Preferably, before the hairpin DNA H3 and H4-L3-4 complex structures are coupled to the surface of the amino-Au@Ag@SiO2 particles via amide bonds, the amino-Au@Ag@SiO2 particles are first washed with PBS, centrifuged, and resuspended in a PBS solution containing EDC and NHS for activation. The reaction conditions for amide bond coupling are shaking in the dark until the reaction is sufficient.

[0018] Preferably, the annealing temperature is 95° C. for 5 minutes, and then the temperature is slowly lowered to below 40° C. within 1 to 2 hours.

[0019] Preferably, the molar ratio of hairpin DNA H4 to linker L3-4 is 1:1; the molar ratio of hairpin DNA H1, hairpin DNA H2, linker L1-2 and Locker chain is 1:1:1:2.

[0020] Preferably, in the SERS sensor, the molar ratio of Y1-block, aptamer-trigger duplex, probe 1 and probe 2 is 1:1:1:1.

[0021] Preferably, the preparation of amination Au@Ag@SiO2 particles comprises the following steps:

[0022] Under constant temperature and magnetic stirring at 27°C, HAuCl4 was added dropwise to the CTAB aqueous solution and stirred vigorously until the solution turned transparent and light yellow. NaBH4 was then rapidly injected and stirred until the solution turned dark orange. The solution was allowed to stand for aging to obtain the gold seed solution.

[0023] HAuCl4 was added to the CTAC solution, heated to 27°C, and ascorbic acid was quickly injected. After stirring, the gold seed solution was added and the mixture was stirred continuously to prepare the Au nanoparticle solution.

[0024] Ascorbic acid, CTAC, and deionized water were added, the temperature was raised to 65°C, AgNO3 was slowly added dropwise, 4-NTP was added and allowed to react fully, and Au@Ag nanoparticles were obtained by centrifugation.

[0025] The Au@Ag nanoparticles were resuspended in CTAC solution, washed by centrifugation, and then an aqueous solution containing thiol-PEG was added and allowed to stand to thiolate the surface of the nanoparticles.

[0026] The thiolated Au@Ag particles were mixed with ethanol, ammonia-ethanol solution, and TEOS-ethanol solution, stirred in a water bath to form Au@Ag@SiO2 particles, and then centrifuged and dried to obtain Au@Ag@SiO2 nanoparticles.

[0027] The Au@Ag@SiO2 nanoparticles were added with sufficient amount of APTES and then dispersed evenly by shaking to obtain amino-modified Au@Ag@SiO2 particles.

[0028] Preferably, the sequence of hairpin DNA H1 is TGAGGATCTCTTCTCCGAGCCGGTCGAAAATAGTGAGTGTAGCACGTGGAACCGGCTCGGTGTTGGCAAC; the sequence of hairpin DNA H2 is TGAGGATCTCTTCTCCGAGCCGGTCGAAAATAGTGAGTATTCGGAGAAGAACTATCCACGTGCTAC; the sequence of hairpin DNA H3 is COOH-TTTTGACTATTCGAAGCCAACTCACTAT / rA / GGAAGAGATTGGCTTCGAA; The sequence of H4 is COOH-TTCGGCAGGACATCGAATAGTCACTCACTAT / rA / GGAAGAGATGACTATTCGA; the sequence of linker L1-2 is TTTTTTTTCCAACACCGAGCCGGTTAGTTCTTCTCCGAAT; the sequence of linker L3-4 is TGAGTTGGCTTGTCCTGCCG; the sequence of the trigger chain is CTCGAGCCGGCCCAACCGCAACCAACCGCAT; the sequence of the locker chain is ATGCGGTTGGTTGCGGTTGGGCCGGCTCGGAGAAGA; the sequence of the adaptor is ATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTG.

[0029] Another technical solution provided by the present invention is a SERS sensor based on double Y structure self-assembly prepared by the above preparation method.

[0030] Another technical solution provided by the present invention is the application of the above-mentioned SERS sensor in the detection of methicillin-resistant Staphylococcus aureus.

[0031] Preferably, the SERS sensor is added with the sample to be tested and sufficient Mg 2+ PBS was used to make up the volume, and the mixture was placed in a 37°C constant temperature metal bath for incubation for 120 minutes to avoid precipitation during the period. Raman spectrometer was used to scan and identify 1342 cm -1 4-NTP characteristic peak intensity, with a laser wavelength of 785 nm, a power of 20 mW, an objective lens magnification of 20×, and an exposure time of 15 seconds.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] The preparation method and product of the SERS sensor based on double Y structure self-assembly and its application in the detection of methicillin-resistant Staphylococcus aureus are as follows: high sensitivity, through double Y structure self-assembly and nucleic acid cyclic amplification, the Raman signal intensity is significantly improved, the detection limit is as low as 1 CFU / mL, and the linear range is wide (10 0 -10 7 CFU / mL); strong stability: the SiO2 layer in the Au@Ag@SiO2 composite nanostructure effectively inhibits silver shell oxidation, and precise DNA assembly ensures signal uniformity, making it suitable for testing complex biological samples such as serum, milk, saliva, and sewage. High specificity: the aptamer, as a recognition element, combined with the precise assembly of the double Y structure, can specifically identify MRSA and avoid interference from non-target bacteria. Easy operation: combining nucleic acid self-assembly with Raman spectroscopy detection, the process is relatively simple, and rapid detection can be achieved through optimized experimental conditions, providing a new approach for clinical point-of-care diagnosis (POCT). BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 : Schematic diagram of the construction principle of the double Y-structure self-assembled SERS sensor, showing the process of MRSA triggering the aptamer to release the Trigger chain, thereby activating the Y1zyme, inducing the formation of the Y2 structure, and realizing the self-assembly of Au@Ag@SiO2 nanoparticles and Raman signal enhancement.

[0035] Figure 2 :Non-denaturing polyacrylamide gel electrophoresis verified the DNA assembly process, including the formation of Y1block structure, trigger chain cycle, magnesium ion enzyme cleavage ability and Y2 structure self-assembly process.

[0036] Figure 3 : Transmission electron microscopy (TEM), energy dispersive spectroscopy (EDS) and ultraviolet absorption spectroscopy characterization of Au@Ag@SiO2 nanoparticles showed that they were uniform in size and regular in shape, and were successfully coated with silica shells and modified with DNA.

[0037] Figure 4 TEM observation of the aggregation state of Au@Ag@SiO2 nanoparticles at different time points shows that as the reaction time increases, the nanoparticles gradually aggregate to form larger aggregates.

[0038] Figure 5 : The response spectra and linear relationship of the SERS sensor to different concentrations of MRSA showed that the Raman signal intensity had a good linear correlation with the logarithm of MRSA concentration.

[0039] Figure 6 : The stability and reproducibility verification results of the sensor, continuous scanning and continuous multi-day detection showed that the signal was stable and the relative standard deviation was small.

[0040] Figure 7 : Specificity analysis of MRSA detection in actual samples (serum, milk, saliva, sewage) showed that only MRSA produced significant SERS signals, while other non-target bacteria signals were weak. DETAILED DESCRIPTION

[0041] To address the issues of easy oxidation and poor signal stability of the traditional Au@Ag substrate silver shell, this invention adopts an Au@Ag@SiO2 composite nanostructure. Its core parameters and functions are as follows:

[0042] Multi-layer structure synergy

[0043] Au@Ag core: Au core with a diameter of 10±2 nm was prepared by seed growth method, and a 20 nm thick Ag shell was deposited on the surface. The initial electromagnetic field enhancement hotspot was formed by the Au-Ag interface plasma coupling effect (enhancement factor EF≈10 7 ).

[0044] SiO2 shell: A 7.5±1.5 nm silicon layer was coated using a modified Stöber method, and the amino groups were modified with a silane coupling agent (APTES), which not only isolated the silver shell from the external environment (oxidation rate < 5%) but also provided covalent coupling sites for DNA assembly.

[0045] DNA functionalized layer: Through EDC / NHS coupling reaction, 200-300 DNA chains / particles, including hairpin probes (H3, H4) and linkers (L3-4), are fixed on the SiO2 surface to form a "core-shell-biomolecule" composite structure.

[0046] Silver shell uniformity control: By adding AgNO3 dropwise (0.1 mL / min) and maintaining the reaction at a constant temperature of 65°C, the uniform deposition of silver ions along the surface of the Au core can be ensured, avoiding the broadening of the plasma resonance peak caused by porous or rough structures.

[0047] Silicon layer thickness control: By adjusting the amount of TEOS added (50 µL / 20 mL nanosolution) and the ultrasonic dispersion frequency (5 minutes of ultrasonication every 30 minutes), the thickness of the silicon layer can be precisely controlled within the range of 2-10 nm, balancing stability and electromagnetic field penetration efficiency.

[0048] To address the random distribution of electromagnetic field hotspots in traditional SERS substrates, the present invention developed a double Y-shaped DNA self-assembly system, which achieves precise control of the spacing between nanoparticles from 50 nm to 1-3 nm through a cascade reaction:

[0049] Y1 structure: a molecular switch that triggers signal amplification

[0050] Locked state: The three DNA chains H1, H2, and L1-2 anneal to form a three-arm Y-shaped structure, in which the DNAzyme active site is locked by the Locker chain through base complementary pairing to avoid nonspecific cleavage (non-target activation rate < 1%).

[0051] Unlocking mechanism: When MRSA is present, the aptamer (Apt) recognizes the PBP2a protein on its surface, releases the Trigger chain (containing the 5'-CTCGAG-3' sequence), hybridizes with the Locker chain, activates the T7 EXO enzyme to gradually cut the Locker chain from the 5' end, releases the complete Trigger chain, and the Trigger chain gradually increases, realizing the cyclic amplification of the Trigger chain.

[0052] Y2 structure: the molecular engine of nanoparticle aggregation

[0053] Cleavage reaction: Y1zyme activated after losing Locker chain (containing Mg 2+ The hairpin structures on probes 1 (Au@Ag@SiO2-H3) and 2 (Au@Ag@SiO2-H4-L3-4) were recognized by a DNAzyme-dependent DNAzyme. 2+ Under the conditions of 5 mM (typically 5 mM), H3 and H4 are cleaved, releasing the single-stranded H33 (containing the L3-4 complementary sequence) and H44 with the linker L3-4.

[0054] Self-assembly process: H33, H44, and linker L3-4 hybridize to form a rigid Y-shaped structure, which pulls the distance between adjacent Au@Ag@SiO2 nanoparticles to 1.5±0.3 nm, forming a high-density electromagnetic field hotspot (FDTD simulation shows that the enhancement factor EF is increased to 1.1×10 8 ).

[0055] Nucleic acid cascade amplification

[0056] T7 EXO enzyme cycle: After the Trigger chain cuts the Locker chain, it is not consumed and can repeatedly participate in the cutting reaction, causing the number of Y1zyme to increase exponentially (10 every 30 minutes). 2 times), significantly improving the efficiency of DNAzyme cleavage probes.

[0057] DNAzyme synergy: Each Y1 structure contains two DNAzyme active sites, which can simultaneously cleave two probe molecules, further amplifying the signal generation efficiency.

[0058] Aptamer-specific binding

[0059] Aptamers with extremely high affinity for the PBP2a protein on the surface of MRSA (KD=1.2 nM) were screened. Their sequences contain two stem-loop structures: one for binding to the PBP2a protein and the other for releasing the trigger chain, ensuring that subsequent reactions are triggered only when MRSA is present.

[0060] The aptamer sequence was optimized by systematic evolution of ligands by exponential enrichment (SELEX) to reduce its cross-binding rate to sensitive strains of Staphylococcus aureus (MSSA) to < 0.1% and its binding rate to Gram-negative bacteria such as Escherichia coli to < 0.05%.

[0061] Silicon layer physical barrier and charge repulsion

[0062] The negative charge on the surface of the SiO2 layer (Zeta potential - 17.27 mV) forms an electrostatic repulsion layer, which prevents the non-specific adsorption of negatively charged non-target bacteria (such as Escherichia coli Zeta potential - 25 mV).

[0063] The porous structure of the silicon layer (pore size 2-5 nm) allows small molecule Raman probes (such as 4-NTP) to diffuse freely to the Au@Ag interface, while blocking the entry of bacterial macromolecules (such as lipopolysaccharide), reducing background signal interference (the background intensity is only 5% of the target signal).

[0064] The present invention is further illustrated below by means of several examples. However, the following examples are merely several optional embodiments of the present invention and should not be construed as absolute limitations on the present application. In addition, some of the following examples are well known in the art and are not described in detail (e.g., the binding of DNA requires Mg ion assistance, the specific process of DNA annealing reaction, etc.), so as not to cause misunderstanding to those skilled in the art.

[0065] The raw materials, reagents and instruments used in the following examples are as follows:

[0066] Nanomaterial synthesis reagents

[0067] Gold / silver nanoparticle preparation

[0068] Chloroauric acid (HAuCl4): 0.01 M, used for the synthesis of gold nanoseeds and gold core growth, purchased from Sinopharm Group. Silver nitrate (AgNO3): 0.01 M, used for the deposition of silver shells, purchased from Aladdin Reagent. Ascorbic acid (AA): 0.1 M, used as a reducing agent, purchased from Sigma-Aldrich. Cetyltrimethylammonium bromide (CTAB / CTAC): 0.1 M, used as a surfactant to stabilize nanoparticles, purchased from Sangon Biotech (Shanghai) Co., Ltd. (hereinafter referred to as Shanghai Sangon). Sodium borohydride (NaBH4): 0.1 M, used for the rapid reduction of gold seeds, purchased from Sinopharm Group.

[0069] Silicon coating and modification

[0070] Tethyl orthosilicate (TEOS): used for the synthesis of the SiO2 layer, purchased from Shanghai Sinopharm Chemical Reagent Co., Ltd. Ammonia (NH3 / H2O): 28% concentration, used to adjust the pH to promote TEOS hydrolysis, purchased from Sigma-Aldrich. Thiol-polyethylene glycol (SH-PEG): 0.26 mg / mL concentration, used for thiolation of nanoparticles, purchased from Aladdin Reagent. γ-Aminopropyltriethoxysilane (APTES): used for amino-group modification of nanoparticles, purchased from Sigma-Aldrich.

[0071] Nucleic Acid Assembly and Modification Reagents

[0072] DNA sequences: Trigger strand, Locker strand, aptamer (hereinafter referred to as aptamer or apt), hairpin DNA H1, hairpin DNA H2, hairpin DNA H3, hairpin DNA H4, linker L1-2, linker L3-4, all commissioned by Shanghai Bioengineering to synthesize. Specific sequences are shown in Table 1 below. Some sequences contain thiol or carboxyl modifications (e.g., H3 and H4 contain COOH labels). The / rA / (the modification name provided by Shanghai Bioengineering) in hairpin DNA H3 and hairpin DNA H4 is the cleavage recognition site.

[0073] Table 1 DNA sequences

[0074]

[0075] As shown in Table 1, the cleavage recognition site rA is modified between the 28th and 29th bases at the 5' end of the hairpin DNA H3, and between the 31st and 32nd bases at the 5' end of the hairpin DNA H4; several bases at the 3' end of the hairpin DNA H3 are complementary to a segment of bases in the middle, and the cleavage recognition site rA is modified between the two complementary base segments; several bases at the 3' end of the hairpin DNA H4 are complementary to a segment of bases in the middle, and the cleavage recognition site rA is modified between the two complementary base segments; a segment of bases between the 5' end of the hairpin DNA H4 and the cleavage recognition site is complementary to a segment of bases in the linker L3-4, and another segment of bases in the linker L3-4 is complementary to a segment of bases between the 5' end of the hairpin DNA H3 and the cleavage recognition site; a segment of bases close to the 5' end of the base segment of the hairpin DNA H3 complementary to the linker L3-4 is complementary to a segment of bases away from the 5' end of the base segment of the hairpin DNA H4 complementary to the linker L3-4; H1 and hairpin DNA H2 are each equipped with a DNAzyme active site for recognizing and cleaving the cleavage recognition sites of hairpin DNA H3 and hairpin DNA H4; the linker L1-2 is equipped with two base segments that are complementary to a base segment on hairpin DNA H1 and a base segment on hairpin DNA H2, respectively, and hairpin DNA H1 and hairpin DNA H2 are each equipped with a complementary base segment; the aptamer and the trigger chain are each equipped with a complementary base segment. The aptamer is used to recognize penicillin-binding protein 2a (PBP2a) on the surface of MRSA and bind to it to release the trigger chain. The trigger chain is used to hybridize with the locker chain on the Y1-block to form a trigger-locker duplex.

[0076] T7 exonuclease (T7 EXO): final concentration 0.2 U / µL, used to cut the Locker chain on the Trigger-Locker duplex to release the Trigger chain again, purchased from Shanghai Bioengineering.

[0077] DNA coupling and activation

[0078] 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC): 20 mM, used to activate amino groups on the nanoparticle surface; purchased from Sigma-Aldrich. N-Hydroxybutanediimide (NHS): 10 mM, used for DNA coupling with EDC; purchased from Sigma-Aldrich. MES buffer: 10 mM, pH 5.5, used for DNA-nanoparticle coupling; purchased from Sigma-Aldrich. Tris-HCl buffer: 40 mM, pH 8.0, used for DNA annealing; purchased from Shanghai Bioengineering. Magnesium chloride (MgCl2): 100 mM, used to activate DNAzyme activity; purchased from Sigma-Aldrich.

[0079] Raman signal enhancement and detection reagents

[0080] 4-Nitrothiophenol (4-NTP): 10 mM, used as a Raman reporter, purchased from Shanghai Xianding Biotechnology Co., Ltd. Analytical grade ethanol, used for dissolving 4-NTP and washing nanoparticles, purchased from Sinopharm Group. Phosphate buffered saline (PBS): 10 mM, pH 7.4, containing 0.05% Tween 20 (PBST), used for sample dilution and washing, purchased from Sigma-Aldrich.

[0081] Sample processing and quality control reagents

[0082] Proteinase K (20 U / μL, used to digest protein impurities in samples) was purchased from Sigma-Aldrich. Ultrafiltration centrifuge tubes (10 kDa molecular weight cutoff, used to remove large proteins from serum) were purchased from Millipore. Bovine serum albumin (BSA), 1% w / v, was used to block unreacted sites on the nanoparticle surface and was purchased from Sigma-Aldrich. Sodium azide (NaN3), 0.02% w / v, was used to inhibit microbial growth and preserve reagents and was purchased from Sigma-Aldrich.

[0083] Instrument supporting reagents

[0084] Gel electrophoresis related:

[0085] Polyacrylamide (6%), used for native PAGE gel preparation, purchased from Shanghai Bioengineering. GelRed dye (1×), used for DNA electrophoresis staining, purchased from Biotium. TAE buffer (1×, pH 8.0), used for electrophoretic separation, purchased from Shanghai Bioengineering.

[0086] Spectral detection:

[0087] Portable Raman spectrometer: The i-Raman Plus BWS465-785S uses a 785 nm semiconductor laser light source (power 20 mW), a 20x objective lens, and a charge-coupled device (CCD) detector. With a single scan time of 15 seconds, it can quickly acquire spectral data on site. The built-in machine learning algorithm (support vector machine, SVM) can automatically identify the 1342 cm -1 Characteristic peaks are detected and background noise is subtracted. The quantitative results can be transmitted to a signal receiving device such as a smartphone via Bluetooth, and the test report is generated in less than 5 minutes.

[0088] Ultrapure water: resistivity ≥18.2 MΩ・cm, used for reagent preparation and instrument cleaning, prepared by an ultrapure water purification system (Hefei Shengfern Technology SJ-CS-1).

[0089] Example 1

[0090] Step 1: Gold nanoseed preparation

[0091] Under constant temperature and magnetic stirring at 27 °C, 0.25 mL of HAuCl4 (0.01 M) was added dropwise to 7.5 mL of CTAB (0.1 M) aqueous solution and stirred vigorously for 5 min until the solution turned transparent and light yellow.

[0092] 0.06 mL of NaBH4 (0.1 M) was quickly injected and stirred for 2 minutes. The color of the solution turned into dark orange and was allowed to stand for 2 hours to obtain a gold seed solution with a diameter of about 10 nm.

[0093] Step 2: Gold core growth and silver shell deposition

[0094] Gold nucleus growth: 1 mL of HAuCl4 (0.01 M) was added to 39 mL of CTAC (0.1 M) solution, heated to 27°C, and 15 mL of ascorbic acid (0.1 M) was quickly injected. After stirring for 1 minute, 500 µL of gold seeds were added and stirring was continued for 15 minutes to form Au nanoparticles with a diameter of 40 nm.

[0095] Silver shell deposition: 275 µL of Au nanoparticle solution was added to 1.2 mL of ascorbic acid (0.1 M), 3 mL of CTAC (0.1 M), and 21 mL of deionized water. The temperature was raised to 65°C, and 3 mL of AgNO₃ (0.01 M) was slowly added dropwise. 100 µL of 4-NTP was then added. The reaction was allowed to stand for 12 hours, and the Au@Ag nanoparticles were collected by centrifugation at 5000 rpm for 5 minutes.

[0096] Step 3: Silicon coating and amino modification

[0097] The Au@Ag nanoparticles were resuspended in CTAC (0.05 M) solution, centrifuged at 6000 rpm for 5 min, and washed twice.

[0098] 1.67 mL of an aqueous solution containing 0.26 mg of thiol-PEG (SH-PEG) was added and allowed to stand for 1 hour to thiolate the surface of the nanoparticles.

[0099] Solution A (12.5 mL ethanol + 0.34 mL ammonia) and solution B (7.4 mL ethanol + 50 µL TEOS) were prepared. The thiolated Au@Ag particles were mixed with 0.83 mL ethanol, 12.84 mL solution A, and 5 µL solution B. The mixture was stirred in a 30°C water bath for 2 h to form Au@Ag@SiO2 particles. The particles were then centrifuged and dried for later use.

[0100] Take 1 mL of Au@Ag@SiO2 particles (2 mg / mL), add 60 μL of APTES, and shake at 25°C for 30 minutes to amino-modify the surface of the nanoparticles.

[0101] Step 4: DNA functionalized probe preparation

[0102] Probe 1 (Au@Ag@SiO2-H3):

[0103] The amino-modified Au@Ag@SiO2 particles were washed with PBS and centrifuged, then resuspended in a PBS solution containing 20 mM EDC and 10 mM NHS. 3 µM hairpin DNA (H3) was added and shaken in the dark for 4 h to couple H3 to the nanoparticle surface through amide bonds.

[0104] Probe 2 (Au@Ag@SiO2-H4-L3-4):

[0105] 10 μM H4 and 10 μM L3-4 were mixed and annealed at 95°C for 5 minutes. After annealing, the temperature was slowly lowered to below 40°C for 1 to 2 hours to form an H4-L3-4 composite structure.

[0106] Aminated Au@Ag@SiO2 particles were prepared in the same manner as probe 1. After activation with EDC / NHS, they were reacted with the H4-L3-4 complex structure in PBS for 4 hours and coupled to the surface of the nanoparticles.

[0107] Results Test

[0108] Transmission electron microscopy (TEM) observation: The gold seed particles are about 10 nm in size, spherical, and evenly dispersed ( Figure 3 A). Au@Ag core-shell particles: diameter 40 nm, Ag shell thickness about 10 nm, clear core-shell interface, smooth surface ( Figure 3 B). Au@Ag@SiO2 particles: overall diameter 55 nm, SiO2 layer thickness 7.5 nm, translucent and wrapped around the Au@Ag core, with blurred edges ( Figure 3 C).

[0109] Energy-dispersive X-ray spectroscopy (EDS) analysis revealed elemental composition: Au (44.2%), Ag (32.1%), Si (15.8%), and O (7.9%), confirming the Au@Ag@SiO2 core-shell structure. Si and O signals originate from the silicon layer (Figure 3D). Elemental distribution: Au and Ag signals are concentrated in the center of the particle, while Si and O signals are evenly distributed around the periphery, indicating complete silicon coverage (Figure 3E).

[0110] Ultraviolet-visible absorption (UV-Vis) spectroscopy: Au@Ag particles exhibit a surface plasmon resonance (SPR) peak at 465 nm, attributed to Au-Ag interfacial coupling. Au@Ag@SiO2 particles exhibit a red-shifted SPR peak to 468 nm, attributed to the influence of the SiO2 layer's dielectric constant on the plasmon resonance frequency (Figure 3F, curves b vs. c). After DNA modification, a characteristic DNA absorption peak appears at 260 nm, indicating successful nucleic acid coupling (Figure 3F, curve d).

[0111] Dynamic Light Scattering (DLS) and Zeta Potential: Particle Size Distribution: The hydrodynamic diameter of the Au@Ag@SiO2 was 58 nm (PDI = 0.12), which increased to 65 nm (PDI = 0.15) after DNA modification, indicating a DNA layer thickness of approximately 7 nm (Figure 3G). Zeta Potential: The surface potential of the Au@Ag@SiO2 was -12 mV, but decreased to -17.27 mV after DNA modification, confirming successful adsorption of negatively charged DNA (Figure 3H).

[0112] Example 2

[0113] Y1-block structure preparation

[0114] H1 (100 µM, 10 µL), H2 (100 µM, 10 µL), and L1-2 (100 µM, 10 µL) were mixed and annealed at 95°C for 5 minutes. After annealing, the temperature was slowly lowered to below 40°C within 1 to 2 hours to form a Y1 three-arm structure.

[0115] Add 20 µL of Locker chain (100 µM) and incubate at 37°C for 3 hours to lock the DNAzyme active site of Y1 through base complementary pairing to form a Y1-block structure.

[0116] Trigger chain release and loop amplification

[0117] MRSA recognition: aptamer (100 µM, 6 µL) and trigger chain (100 µM, 6 µL) were mixed and 10 mM Mg 2+ and 40 mM TAE buffer, anneal at 95°C for 5 minutes, and then slowly cool down to below 40°C for 1 to 2 hours to form an aptamer-trigger duplex.

[0118] When MRSA samples are added, the aptamer binds to the PBP2a protein on the bacterial surface and releases the trigger chain (containing the CTCGAG sequence).

[0119] The trigger chain released from the aptamer-trigger duplex can hybridize with the locker chain of the Y1-block to form a trigger-locker duplex. Adding T7 EXO enzyme (0.2 U / µL) and incubating at 25°C for 90 minutes can cleave the locker chain and release the complete trigger chain again. Therefore, in the presence of MRSA, the trigger chain will gradually increase, more quickly unlocking the locked active site on the Y1-block, achieving cyclic amplification.

[0120] Nanoparticle self-assembly

[0121] Mix Y1zyme (Y1-block after losing the Locker chain) with probe 1 and probe 2 in a volume ratio of 1:1:1, and add 5 mM Mg 2+ Solution was incubated at 37°C for 120 minutes.

[0122] The two active sites on Y1zyme recognize and cleave the rA sites on H3 of probe 1 and H4 of probe 2, releasing the H33 and H44 single chains connected to the surface of the amino-modified Au@Ag@SiO2 particles. The two hybridize with the L3-4 linker to form a Y2 three-arm structure, pulling the Au@Ag@SiO2 particles to aggregate, forming aggregates with a diameter of 200-300 nm, and enhancing the Raman signal.

[0123] Experimental results

[0124] Figure 2A demonstrates the formation of the Y1block structure and the recycling of the trigger chain. Compared to channels 4 and 5, a new band appears in channel 6, located higher than both, confirming the successful duplex formation of the locker and trigger chains. Observation of channels 7 through 9 reveals a continuous upward migration of the band, indicating the gradual generation of products with larger molecular weights, ultimately leading to the successful formation of the Y1block structure. Comparison of channels 9 and 10 reveals the appearance of a band below channel 10 with the same mobility as the duplex in channel 6, indicating that the trigger chain displaces the locker chain from the Y1block structure, unlocking the Y1block. Simultaneously, the lock shell, locked by the locker, shifts downward, restoring the magnesium ion enzymatic activity of the Y1 arm. To verify the trigger chain recycling caused by T7 EXO cleavage, the duplex structure beneath channel 11 disappears compared to channel 10, and a band with the same mobility as channel 5 appears. However, when the trigger chain is not added to the Y1block structure, the locked Y1 is not unlocked, and duplex digestion does not occur (channel 12). As shown in Figure 2B, a new band with a slower migration speed appears in channel 6 compared to channels 2 and 3, confirming the successful ligation of H4 to the linker (L3-4). To verify the cleavage ability of the enzyme in the presence of magnesium ions, channels 11 and 12, and channel 1 and 6, were compared. In the presence of Mg2+, new bands with faster migration speeds appeared in channels 11 and 12, corresponding to channels 4 and 5, respectively. This demonstrates that Y1zyme cleaves the probe H3 and H4 labeled strands in the presence of magnesium ions. Adding both probe structures to the reaction in channel 13 produced a band corresponding to the position in channel 14, confirming the successful assembly of Y2. When the DNAzyme structure failed to form, probes H3 and H4 were not cleaved (channel 15). Polyacrylamide gel electrophoresis experiments successfully demonstrated the successful assembly of DNA using this strategy. These results validated the Y1 locking process, the trigger chain cycling process, the cleavage ability of the magnesium ion enzyme, and the subassembly process of the Y2 structure.

[0125] Example 3

[0126] MRSA test validation

[0127] Sample pretreatment

[0128] Clinical samples (e.g. serum): Take 100 µL of sample and spike it with 1x107 CFU / mL, add 10 μL proteinase K (20 U / μL), incubate at 56°C for 10 minutes to digest the protein, centrifuge at 14,000 rpm for 10 minutes, and collect the supernatant for later use.

[0129] Environmental samples (e.g. sewage): Take 100 µL of sample and spike it with 1x10 7 CFU / mL, filtered through a 0.22 μm filter membrane to remove large particles, diluted 10 times with PBS, and adjusted to pH 7.4.

[0130] Construction of self-assembly reaction system

[0131] Add the following to a PCR tube: 50 µL pretreated spiked serum sample, 10 µL 10 mM Y1-block solution, 10 µL 10 mM aptamer-Trigger duplex, 10 µL 10 mM probe 1, 10 µL 10 mM probe 2, 5 µL 100 mM MgCl2, and T7 EXO enzyme to a constant volume of 0.2 U / µL. Make up to 100 µL with PBS.

[0132] After mixing, place the mixture in a 37°C thermostatic metal bath and incubate for 120 minutes. Gently invert the mixture every 30 minutes to avoid precipitation.

[0133] Raman signal acquisition

[0134] Take 10 μL of the reaction solution and drop it onto the center of the detection pad, then place it into the sample slot of the portable Raman spectrometer.

[0135] The parameters were set as follows: laser wavelength 785 nm, power 20 mW, objective lens magnification 20×, exposure time 15 s, and 3 scans to obtain the average value.

[0136] The Raman spectrometer software automatically identifies 1342 cm -1 (4-NTP characteristic peak) intensity.

[0137] Experimental results

[0138] The effect of self-assembly time on signal peak intensity change:

[0139] 30 minutes: 1342 cm -1Peak intensity = 8,000 arb. units, indicating only a small amount of nanoparticle aggregation. 60 minutes: Peak intensity = 15,000 arb. units, indicating initial activation of Y1zyme, with the formation of small aggregates. 120 minutes: Peak intensity = 28,000 arb. units, reaching a signal plateau, with aggregates approximately 200 nm in diameter (Figure 4C). 150 minutes: Peak intensity = 28,500 arb. units, indicating no significant signal increase, indicating partial signal quenching due to excessive aggregation (Figure 4A). TEM verification: Dense nanoaggregates were visible at 120 minutes, with interparticle spacing < 3 nm and numerous electromagnetic field hotspots (Figure 4D).

[0140] Example 4

[0141] Construction and detection of SERS sensors

[0142] Construction of sensor key points

[0143] Method: Take 6 PCR products and number them sequentially from a to f;

[0144] a: 10 µL 10 mM Y1-block solution, 10 µL 10 mM aptamer-Trigger duplex, 5 µL 100 mM MgCl2, make up to 100 µL with PBS;

[0145] b: 10 µL 10 mM Y1-block solution, 10 µL 10 mM aptamer-Trigger duplex, 5 µL 100 mM MgCl2, T7 EXO enzyme (0.2 U / µL), and make up to 100 µL with PBS;

[0146] c: 10 µL 10 mM Y1-block solution, 10 µL 10 mM aptamer-Trigger duplex, 10 µL 10 mM probe 1, 5 µL 100 mM MgCl2, T7 EXO enzyme (0.2 U / µL after adjustment), and make up to 100 µL with PBS;

[0147] d: 10 µL 10 mM Y1-block solution, 10 µL 10 mM aptamer-Trigger duplex, 10 µL 10 mM Probe 2, 5 µL 100 mM MgCl2, T7 EXO enzyme (0.2 U / µL after adjustment), and make up to 100 µL with PBS;

[0148] e: 10 µL 10 mM Y1-block solution, 10 µL 10 mM aptamer-Trigger duplex, 10 µL 10 mM probe 1, 10 µL 10 mM probe 2, 5 µL 100 mM MgCl2, T7 EXO enzyme (0.2 U / µL after adjustment), make up to 100 µL with PBS;

[0149] f: 50 µL of the pretreated spiked serum sample from Example 3, 10 µL of 10 mM Y1-block solution, 10 µL of 10 mM aptamer-Trigger duplex, 10 µL of 10 mM probe 1, 10 µL of 10 mM probe 2, 5 µL of 100 mM MgCl2, and T7 EXO enzyme diluted to 0.2 U / µL, then made up to 100 µL with PBS.

[0150] After incubation using the method in Example 3, 1342 cm -1 Peak strong.

[0151] Experimental results:

[0152] As shown in Figure 5 AB, without the addition of probes 1 and 2 to the PCR tube systems (a and b), there is no background signal in the solution (curves a and b). With the addition of probes 1 and 2, the background signal increases slightly (curve ce), but the fluctuation is within an acceptable range. In the presence of the target MRSA, the sensor triggers a specific SERS signal response, with a significant increase in intensity (curve f).

[0153] 2. Linear equation verification

[0154] Method: Take 8 PCR tubes and number them in sequence, add (1ml, 1x10 0 ~1x10 7 CFU / mL) MRSA, then added (1 mL, 10 mM) Y1-block solution, (1 mL, 10 mM) aptamer-Trigger duplex, (1 mL, 10 mM) probe 1, (1 mL, 10 mM) probe 2, 500 µL MgCl2 (100 mM), and T7 EXO enzyme (0.2 U / µL) to each tube. After incubation using the method described in Example 3, the fluorescence intensity was recorded at 1342 cm -1 Peak strong.

[0155] Experimental results:

[0156] As shown in Figure 5C-D, the SERS spectra at 1342 cm-1 The Raman intensity of the characteristic peaks showed a good correlation with the MRSA concentration. 0 ~1x10 7 In the wide linear range of CFU / mL, the Raman signal intensity (Y) and the logarithm of bacterial concentration (logC) have a linear relationship: Y = 1069.12 lgC + 1859.5 (R 2 = 0.995), with a sensor detection limit (LOD) of 1 CFU / mL. Compared with existing SERS sensing systems, this platform exhibits a lower detection limit and a wider dynamic monitoring range.

[0157] 3. Stability Verification

[0158] Method: Add 1 mL, 10 mM Y1-block solution, 1 mL, 10 mM aptamer-Trigger duplex, 1 mL, 10 mM probe 1, 1 mL, 10 mM probe 2, 500 μL MgCl2 (100 mM), and T7 EXO enzyme (0.2 U / μL) to the reaction system. 7 CFU / mL of MRSA, and the sample was scanned 20 times in a row.

[0159] Experimental results:

[0160] Figure 6A-B shows that at 1342 cm -1 The SERS signal intensities at the characteristic peaks were basically consistent, with a relative standard deviation (RSD) of 2.79%, which effectively demonstrated that the detection time and scanning number had little effect on the sensor.

[0161] 4. Reproducibility Verification

[0162] Method: The same operator measured 5 samples with the same concentration at the same time for 7 consecutive days (10 7 CFU / mL).

[0163] Experimental results:

[0164] The sensor reproducibility Figure 6 CD, 5 bacteria with consistent concentrations were measured for 7 consecutive days. According to the color comparison study of the array thermal map, it was found that the SERS signal value did not change significantly.

[0165] Example 5

[0166] Actual sample testing

[0167] To verify the detection performance of the double-Y structure self-assembled SERS sensor in complex real-world samples, four representative matrices, serum, milk, saliva, and sewage, were selected for spiked experiments. The specific steps and results are as follows:

[0168] Sample type and preprocessing

[0169] Serum samples: 10% fetal bovine serum was collected and centrifuged at 10 kDa ultrafiltration (14,000 rpm, 10 min) to remove large molecular weight proteins, and then diluted to 1% with PBS (to reduce matrix interference).

[0170] Milk sample: Commercially available whole milk was diluted 1:10 and filtered through a 0.22 μm filter membrane to remove fat particles.

[0171] Saliva samples: Volunteers collected saliva after rinsing their mouths, and high-speed centrifugation (12,000 rpm, 5 minutes) was performed to remove cell debris, and the supernatant was collected for later use.

[0172] Sewage samples: Hospital sewage was collected, filtered through double gauze, adjusted to pH 7.4 with PBS, and diluted 20 times to reduce the ionic strength.

[0173] Spiking experiment design

[0174] Spike concentration: MRSA standard strains were added to each sample to a final concentration of 10 7 CFU / mL;

[0175] Detection process: Take 1 mL of each spiked sample and add (1 mL, 10 mM) aptamer-Trigger duplex, (1 mL, 10 mM) Y1-block solution, (1 mL, 10 mM) probe 1, (1 mL, 10 mM) probe 2, 500 µL MgCl2 (100 mM), and T7 EXO enzyme (0.2 U / µL after constant volume). Make up to 5 mL with PBS and incubate at 37°C for 120 minutes to avoid precipitation. Take 20 μL of the reaction solution and drop it onto the detection pad. Use a portable Raman spectrometer to collect the SERS signal excited by 785 nm laser (power 20 mW, exposure time 15 seconds × 3 times).

[0176] Specific recognition of MRSA

[0177] Methods: Four non-target bacteria, Gram-positive bacteria S. enteritidis and B. subtilis and Gram-negative bacteria E. coli and S. typhimurium, as well as the test bacteria MRSA were taken, and five standard strains were added to each sample separately to make the final concentration of the sample 10 7 CFU / mL;

[0178] Detection Procedure: 1 mL of each sample was added to each sample (1 mL, 10 mM) of the aptamer-trigger duplex, (1 mL, 10 mM) of the Y1-block solution (1 mL, 10 mM) of the probe 1, (1 mL, 10 mM) of the probe 2, 500 µL of 100 mM MgCl₂, and T7 EXO enzyme (0.2 U / µL after calibrating to volume). The volume was then made up to 5 mL with PBS. Incubate at 37°C for 120 minutes, avoiding precipitation. 20 µL of the reaction solution was then dropped onto the detection pad, and the SERS signal was collected using a portable Raman spectrometer using 785 nm laser excitation (20 mW power, 15 s exposure time x 3).

[0179] Test results

[0180] SERS signal characteristics: In all spiked samples, a significant 1342 cm -1 The characteristic peak (CN stretching vibration of 4-NTP) was detected, while the intensity of this peak in the blank control sample was below the detection limit (Figure 7). 7 The peak intensity of CFU / mL spiked serum samples reached 2.1×10 4 arb.units, and the difference in signal intensity with the buffer solution was < 10%, indicating that the serum matrix had no significant interference with the detection. The detection performance of MRSA was relatively good in different actual samples. Figure 7 As shown in Figure B, the SERS signal of the target MRSA in each sample was significantly higher than that of other bacteria.

[0181] The above examples demonstrate that the SERS sensor of the present invention (including Y1-block, aptamer-trigger duplex, T7 EXO enzyme, probe 1 and probe 2) has not only an extremely low detection limit of 1 CFU / mL for MRSA in samples, but also a detection limit of 1 to 10 7 The wide linear range of CFU / mL, especially the detection limit, has significant advantages over the existing methods mentioned in the background technology. Moreover, the sensor has excellent anti-interference ability and good and superior selectivity in the complex matrix of actual samples. In addition, the sensor has excellent stability and reproducibility, and has reliable application performance in actual detection scenarios.

[0182] The above are only preferred embodiments of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by a person skilled in the art within the technical scope disclosed in the present invention should be covered by the scope of protection of the present invention. For example, although the Y1-block, aptamer-trigger duplex, probe 1, and probe 2 of the SERS sensor in the embodiment are all in equimolar ratios, this is only the best effect, and slightly more or less can also be used. Although the T7 EXO enzyme is used at a final concentration of 0.2 U / µL, its cleavage efficiency is high, and the dosage can be adjusted appropriately. The cooling of the annealing treatment can also be adjusted appropriately, for example, from 1°C / 30s to room temperature. Therefore, the scope of protection of the present invention should be based on the scope of protection defined by the claims.

[0183] Any matters not described in detail in the present invention are well-known technologies to those skilled in the art.

Claims

1. A method for preparing a SERS sensor based on double Y structure self-assembly, characterized by: The SERS sensor includes a Y1-block, an aptamer-Trigger duplex, a T7 EXO enzyme, a probe 1, and a probe 2; The preparation method comprises the following steps: The surface of Au@Ag@SiO2 nanoparticles coated with silicon layer was modified with amino groups using silane coupling agent to obtain amino-modified Au@Ag@SiO2 particles. The hairpin DNA H3 with a carboxyl group modified at the 5' end was coupled to the surface of amino-treated Au@Ag@SiO2 particles via an amide bond to prepare probe 1; The hairpin DNA H4 modified with a carboxyl group at the 5' end was mixed with the linker L3-4 and annealed. The resulting H4-L3-4 composite structure was coupled to the surface of amino-modified Au@Ag@SiO2 particles via an amide bond to prepare probe 2. Several bases at the 3' end of the hairpin DNA H3 are complementary to a stretch of bases in the middle, and a cleavage recognition site rA is modified between the two complementary base stretches; several bases at the 3' end of the hairpin DNA H4 are complementary to a stretch of bases in the middle, and a cleavage recognition site rA is modified between the two complementary base stretches; a stretch of bases between the 5' end of the hairpin DNA H4 and the cleavage recognition site is complementary to a stretch of bases in the linker L3-4, and another stretch of bases in the linker L3-4 is complementary to a stretch of bases between the 5' end of the hairpin DNA H3 and the cleavage recognition site; a stretch of bases close to the 5' end of the base stretch of the hairpin DNA H3 that is complementary to the linker L3-4 is complementary to a stretch of bases away from the 5' end of the base stretch of the hairpin DNA H4 that is complementary to the linker L3-4; The hairpin DNA H1, hairpin DNA H2, and linker L1-2 were annealed to prepare the Y1 three-arm structure, and the Locker chain was used to lock the two DNAzyme active sites left on Y1 through base complementary pairing to prepare Y1-block; Hairpin DNA H1 and hairpin DNA H2 each have a DNAzyme active site for recognizing and cleaving the cleavage recognition sites of hairpin DNA H3 and hairpin DNA H4; linker L1-2 has two base segments that are complementary to a base segment on hairpin DNA H1 and a base segment on hairpin DNA H2, respectively; hairpin DNA H1 and hairpin DNA H2 also have a complementary base segment; The aptamer and trigger chain are annealed to form an aptamer-trigger duplex; The aptamer and the trigger chain each have a complementary base segment. The aptamer is used to recognize penicillin-binding protein 2a on the surface of MRSA and bind to it to release the trigger chain. The trigger chain is used to hybridize with the locker chain on the Y1-block to form a trigger-locker duplex. The T7 EXO enzyme is used to cut the locker chain on the trigger-locker duplex to release the trigger chain again.

2. The method for preparing a SERS sensor based on double Y structure self-assembly according to claim 1, wherein: Before the hairpin DNA H3 and H4-L3-4 complex structures were coupled to the surface of the amino-Ag@SiO2 particles via amide bonds, the amino-Ag@SiO2 particles were washed with PBS, centrifuged, and resuspended in a PBS solution containing EDC and NHS for activation. The reaction conditions for amide bond coupling were shaking in the dark until the reaction was complete.

3. The method for preparing a SERS sensor based on double Y structure self-assembly according to claim 1, wherein: The annealing temperature is 95° C. for 5 minutes, and the temperature is slowly lowered after the annealing to below 40° C. within 1 to 2 hours.

4. The method for preparing a SERS sensor based on double Y structure self-assembly according to claim 1, wherein: The molar ratio of the hairpin DNA H4 to the linker L3-4 is 1:1; the molar ratio of the hairpin DNA H1, the hairpin DNA H2, the linker L1-2 and the locker chain is 1:1:1:

2.

5. The method for preparing a SERS sensor based on double Y structure self-assembly according to claim 1, wherein: In the SERS sensor, the molar ratio of Y1-block, aptamer-trigger duplex, probe 1 and probe 2 is 1:1:1:

1.

6. The method for preparing a SERS sensor based on double Y structure self-assembly according to claim 1, characterized in that: The preparation of the amination Au@Ag@SiO2 particles comprises the following steps: Under constant temperature and magnetic stirring at 27°C, HAuCl4 was added dropwise to the CTAB aqueous solution and stirred vigorously until the solution turned transparent and light yellow. NaBH4 was then rapidly injected and stirred until the solution turned dark orange. The solution was allowed to stand for aging to obtain the gold seed solution. HAuCl4 was added to the CTAC solution, heated to 27°C, and ascorbic acid was quickly injected. After stirring, the gold seed solution was added and the mixture was stirred continuously to prepare the Au nanoparticle solution. Ascorbic acid, CTAC, and deionized water were added, the temperature was raised to 65°C, AgNO3 was slowly added dropwise, 4-NTP was added and allowed to react fully, and Au@Ag nanoparticles were obtained by centrifugation. The Au@Ag nanoparticles were resuspended in CTAC solution, washed by centrifugation, and then an aqueous solution containing thiol-PEG was added and allowed to stand to thiolate the surface of the nanoparticles. The thiolated Au@Ag particles were mixed with ethanol, ammonia-ethanol solution, and TEOS-ethanol solution, stirred in a water bath to form Au@Ag@SiO2 particles, and then centrifuged and dried to obtain Au@Ag@SiO2 nanoparticles. The Au@Ag@SiO2 nanoparticles were added with sufficient amount of APTES and then dispersed evenly by shaking to obtain amino-modified Au@Ag@SiO2 particles.

7. The method for preparing a SERS sensor based on double Y structure self-assembly according to claim 1, wherein: The sequence of the hairpin DNA H1 is TGAGGATCTCTTCTCCGAGCCGGTCGAAAATAGTGAGTGTAGCACGTGGAACCGGCTCGGTGTTGGCAAC; the sequence of the hairpin DNA H2 is TGAGGATCTCTTCTCCGAGCCGGTCGAAAATAGTGAGTATTCGGAGAAGAACTATCCACGTGCTAC; the sequence of the hairpin DNA H3 is COOH-TTTTGACTATTCGAAGCCAACTCACTAT / rA / GGAAGAGATTGGCTTCGAA; the hairpin DNA The sequence of H4 is COOH-TTCGGCAGGACATCGAATAGTCACTCACTAT / rA / GGAAGAGATGACTATTCGA; the sequence of linker L1-2 is TTTTTTTTCCAACACCGAGCCGGTTAGTTCTTCTCCGAAT; the sequence of linker L3-4 is TGAGTTGGCTTGTCCTGCCG; the sequence of the trigger chain is CTCGAGCCGGCCCAACCGCAACCAACCGCAT; the sequence of the locker chain is ATGCGGTTGGTTGCGGTTGGGCCGGCTCGGAGAAGA; the sequence of the adaptor is ATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTG.

8. A SERS sensor based on double Y structure self-assembly prepared by the preparation method according to any one of claims 1 to 7. 9 . Use of the SERS sensor according to claim 8 in the detection of methicillin-resistant Staphylococcus aureus.

10. The use according to claim 9, characterized in that: The SERS sensor is added with the sample to be tested and sufficient Mg 2 + PBS was used to make up the volume, and the mixture was placed in a 37°C constant temperature metal bath for incubation for 120 minutes to avoid precipitation during the period. Raman spectrometer was used to scan and identify 1342 cm -1 4-NTP characteristic peak intensity, with a laser wavelength of 785 nm, a power of 20 mW, an objective lens magnification of 20×, and an exposure time of 15 seconds.